Abstract
Lake Taihu is the third-largest freshwater lake in China and has been suffering from cyanobacterial blooms for over two decades. The northern part of the lake, Meiliang Bay, is known to be at high risk of dense and sustained Microcystis blooms and toxins. This study aimed to investigate and record the annual and seasonal dynamics of toxic genotype, Microcystis morphospecies succession and microcystin variation. It also aimed to find out the underlying driving factors influencing the dynamic changes. Microcystin (MC) and the Microcystis genotype were quantified using HPLC and quantitative real-time PCR, respectively. Our study, over three consecutive years, showed that the pattern of morphospecies succession was seasonally distinct and annually consistent. During the same period in 2012, 2013 and 2014, the average MC were, on dry weight basis, 733 μg·g−1, 844 μg·g−1, 870 μg·g−1, respectively. The proportion of toxic Microcystis accounted for 41%, 44% and 52%, respectively. Cell bound microcystin was found to correlate with the percentage of toxic Microcystis. Based on historical and current data, we conclude that annual bloom toxicity was relatively stable or possibly increased over the last decade.
1. Introduction
Toxic cyanobacterial blooms are increasing worldwide and sustaining in large water ecosystems, leading to serious consequences for the supply of drinking water [1]. Among bloom-forming toxic cyanobacteria, Microcystis is the most frequently reported genus forming blooms in freshwater systems [2]; it can produce highly stable and potent polypeptides known as microcystins [3,4]. The hepatotoxic microcystins, synthesized by an integrated peptide-polyketide synthetase [5,6], are cyclic peptides and share a common structure {cyclo(-Adda-D-Glu-Mdha-D-Ala-L-X-D-MeAsp-L-Z)}, where X and Z represent variable amino acids [7]. Microcystin-LR (MC-LR) and microcystin-RR (MC-RR) are the most common variants among over 90 microcystin analogues found [8,9]. The former is five times more toxic, as indicated by LD50 in mice [10].
Microcystis populations in bloom season are usually composed of both toxic and non-toxic strains, with the former capable of producing MC. The development and application of quantitative PCR (qPCR) enable researchers to distinguish between toxic and non-toxic strains, thus promoting studies on the spatial and temporal pattern dynamics of microcystin-producing genotypes, thereby helping to understand the correlation between toxic genotypes and microcystin concentrations [11,12,13]. Most studies have indicated a correlation between the molecular quantification or proportion of toxic genotypes and toxicity (microcystin concentration or/and MC content per Microcystis cell) [14,15,16,17]. However, other studies have described a less clear-cut or inconsistent correlation [18,19,20].
Variation in microcystin concentrations per unit biomass can be influenced by the relative abundance of toxic genotypes and/or by the response to physical-chemical factors of individual toxic genotypes. A few studies have specifically focused on microcystin quotas in natural systems. Microcystin quota (µg·g−1) was positively correlated with the concentration of soluble reactive phosphorus [21,22], the Daphnia biomass [23] and nitrogen [24].
Microcystis has several morphotypes whose compositions tend to vary both seasonally and annually in cyanobacterial blooms [25,26,27]. Kurmayer et al. [28] and Via-Ordorika et al. [29] pointed out that different Microcystis morphospecies are likely to possess different toxicity potentials. They suggested that the toxin content of field populations can be assessed by the strain composition according to morphological criteria. Typical morphospecies [25,30] and Microcystis colony size [31,32] have also been shown to be correlated with microcystin concentration. It is understandable that the application of the morphotype as an indicator of toxicity for individual lakes should be based on the consistency of successive patterns of morphospecies over a prolonged period.
Lake Taihu, the third-largest freshwater lake in China, with an area of 2338 km2, provides drinking water for over ten million residents. The large-scale occurrence of Microcystis blooms corresponds with pollutants being discharged into the lake since the 1980s [33]. MC pollution is present across the entire area of Lake Taihu, but the risk is higher in the Northern part than in the center of the lake [34,35,36]. The dynamics of MC concentration are considered to correlate with abiotic factors, such as water temperature [37], nitrate [38] and pH [39], and with biotic factors, such as Microcystis biomass [40] and Chl-a [41]. However, most studies had been carried out over periods that cover only a bloom cycle or only one year, making it difficult to assess the status or the trend of toxicity over multiple years. The purpose of this study was to investigate the dynamics of toxic Microcystis, morphospecies and MCs, attempting to illustrate the associations between toxic Microcystis, morphospecies and MCs and the possible driving forces influencing the dominance of toxicity. In so-doing, we hoped to be able to assess the toxicity of blooms over the past decade. A three year long study was conducted in the northern part of Lake Taihu to determine a suite of biotic and abiotic parameters. In addition, experiments were undertaken to detect the toxins of the dominant Microcystis morphospecies. It is anticipated that this study will be of importance for mitigation and management of toxic blooms in Lake Taihu.
2. Results
2.1. Physicochemical Parameters
Environmental factors (temperature, pH, TN, TDN, NO3-N, NH3-N, TP, TDP, SRP) of samples collected monthly in bloom period are shown in Figure 1. During the sampling period, the water temperature varied from 9.7 °C to 32.7 °C, and generally peaked at the end of July or beginning of August (Figure 1A). The maximum temperature was higher in 2013 than in 2012 and 2014. The pH ranged from 7.0 to 9.2, with a minimum of 7.0 in the early phase of bloom, June in 2013, which increased corresponding with high Microcystis biomass. Based on datasets from two years, the variation patterns of TN and TDN in 2013 tended to decrease during blooms. TN concentrations decreased from 6.3 mg·L−1 in June 2013 to 1.73 mg·L−1 in August 2013, while another peak of 5.42 mg·L−1 was observed in October. In 2014, TN concentrations were low from late July to late November. The average concentration of TN (1.9 mg·L−1) in 2014 was lower than in 2013 (2.8 mg·L−1), which was calculated with values of the same four months. Nitrate concentrations decreased from 0.67 mg·L−1 in early June 2013 to 0.10 mg·L−1 in early August 2013. Interestingly, nitrate concentrations were not lower in 2014 than during the same months in 2013 and ammonium concentrations were relatively higher in 2013 than in 2014. In addition, concentrations of TP, TDP and SRP, fluctuating over sampling time, ranged from 0.05 to 0.38 mg·L−1, 0.027 to 0.097 mg·L−1 and 0.015 mg·L−1 to 0.067 mg·L−1, respectively.
Figure 1.
Environmental parameters in Meiliang Bay, N2, of Lake Taihu. (A) Temperature (■), pH (о); (B) TN (■), TDN (□), NO3-N (△), NH3-N (●); (C) TP (■), TDP (□), SRP (▲).
2.2. Dynamics of Abundance and Succession of Microcystis
In sampling periods, cyanobacteria populations were mainly composed of non-N2-fixing Microcystis spp., N2-fixing Dolichospermum spp. and Aphanizomenon spp. The abundance of Microcystis, the most dominant genus in the lake, ranged from 5 × 106 to 8 × 108 cells·L−1 in the three years in site N2. The Chl-a concentration ranged from 9.1 to 115 µg·L−1 (Figure 2A). The bloom of Microcystis comprised at least five different Microcystis morphotypes, M. flos-aquae, M. aeruginosa, M. wesenbergii, M. viridis and M. ichthyoblabe. The percentage of abundance of each Microcystis morphospecies during the sampling period was shown in Figure 2B. During the period of blooming, it was found that the pattern of succession of Microcystis morphotypes followed a trend: M. flos-aquae as major morphotype usually appeared at the onset of Microcystis bloom and sustained throughout the year. Subsequently, M. flos-aquae, M. aeruginosa and M. wesenbergii coexisted from August to November. Towards the decline of the bloom, M. viridis was either in large or low quantities in October and November.
Figure 2.
(A) Monthly variation of cell density of Microcystis (white column) and chlorophyll-a (■) in Meiliang Bay, N2, of Lake Taihu, from 2012 to 2014; (B) The percentage of biomass of the major Microcystis morphospecies in N2, Meiliang Bay, from 2012 to 2014.
2.3. Dynamics of Toxic Microcystis
The potential microcystin-producing Microcystis genotypes (mcyB) and total Microcystis (16S rDNA) were independently detected by qPCR in all samples. Highly significant linear curves between the initial DNA (equivalent to cell numbers) and the Ct values were obtained. Regression equations were y = 33.127 − 3.3236x (R2 = 0.9977, n = 6) for 16S rDNA and y = 35.518 − 3.485x (R2 = 0.9999, n = 6) for mcyB, respectively, where y is the Ct at the set fluorescence threshold level and x is the amount of DNA (expressed as log10 cell number equivalents). The amplification efficiency of both are >90% (Table 1).
Table 1.
Primers used in this study.
| Target Gene | Sequence (5′–3′) | Length (bp) | Reference | Efficiency |
|---|---|---|---|---|
| 16S rDNA | ATGTGCCGCGAGGTGAAACCTAAT | 200 | Neilan et al., 1997 [42] | 99.9% |
| TTACAATCCAAAGACCTTCCTCCC | ||||
| mcyB | CCTACCGAGCGCTTGGG | 78 | Kurmayer et al., 2003 [11] | 93.6% |
| GAAAATCCCCTAAAGATTCCTGAGT |
Microcystis 16S rDNA copy numbers ranged from 4.1 × 106 copies·L−1 to 7.7 × 108 copies·L−1 (Figure 3). The copy number of mcyB ranged from 1.8 × 105 to 3.6 × 108 copies·L−1; the highest value of mcyB copy was found in September or October in all three years. Using the PCR of the mcyB and 16S rDNA, the relative proportion of mcyB genotype was estimated, ranging from 0.2% to 83% in N2. In general, the proportion of toxic Microcystis was relatively high from August to October in each year. At other periods, non-toxic Microcystis occurred in large proportions.
Figure 3.
The dynamic of Microcystis (16S rDNA) and its toxic genotypes (mcyB) characterized by molecular analysis in N2, Lake Taihu in 2012, 2013 and 2014. The toxic Microcystis proportion was calculated using the ratio of mcyB to 16S rDNA.
2.4. Microcystin Content of Field Samples and Cultivated Morphospecies
Dry-weight-specific MC-RR and MC-LR were detected by HPLC analysis in phytoplankton cells collected with a 40-µm plankton net. The sum of MC-RR and MC-LR were roughly considered as total microcystin. At the site of N2, total microcystin content ranged from 45 to 1664 µg·g−1 (Table 2). The peaks of microcystin concentrations per unit dry weight were observed in November 2012, November 2013 and October 2014, respectively. The maximum value was 1664 µg·g−1 in November 2013. The average microcystin (MC) concentrations were 733 µg·g−1, 844 μg·g−1, 870 μg·g−1 during the same period of 2012 to 2014, respectively.
On average, total microcystin was composed of 58% RR and 42% LR in N2. The percentage of RR (the average of data from July to December) was 60% in 2012. In 2013 and 2014 it was slightly less, being 53% and 54%, respectively.
Table 2.
Microcystins content, and the percentage of RR in N2 during bloom seasons.
| Site | Sampling Date (Year-Month-Day) | RR (µg/g) | LR (µg/g) | MCs (µg/g) | RR (%) |
|---|---|---|---|---|---|
| N2 | 2012-7-24 | 220.5 ± 19.3 | 143.7 ± 5.6 | 363.2 ± 74.3 | 61 |
| 2012-8-29 | 672.8 ± 178.2 | 349.3 ± 45.5 | 1022.1 ± 146.7 | 66 | |
| 2012-9-24 | 251.6 ± 38.5 | 155.0 ± 111.5 | 406.6 ± 22.8 | 62 | |
| 2012-11-2 | 615.4 ± 23.3 | 525.7 ± 127.6 | 1141.1 ± 104.3 | 54 | |
| 2013-6-2 | 78.9 ± 68.9 | 14.9 ± 15.0 | 93.8 ± 53.9 | 84 | |
| 2013-7-8 | 250.9 ± 2.9 | 145.5 ± 37.1 | 396.4 ± 62.7 | 63 | |
| 2013-8-1 | 359.9 ± 47.3 | 356.4 ± 63.2 | 716.3 ± 110.5 | 50 | |
| 2013-8-28 | 165.1 ± 2.9 | 173.5 ± 5.6 | 338.6 ± 8.5 | 48 | |
| 2013-10-12 | 769.9 ± 4.0 | 686.7 ± 81.5 | 1455.6 ± 77.5 | 52 | |
| 2013-11-5 | 838 | 826 | 1664 | 50 | |
| 2013-12-5 | ND | 45 | 45 | ND | |
| 2014-7-23 | 676.7 ± 173.3 | 642.0 ± 125.2 | 1318.7 ± 298.5 | 51 | |
| 2014-8-30 | 193.3 ± 11.8 | 152.4 ± 15.7 | 345.7 ± 27.5 | 55 | |
| 2014-10-14 | 769.6 ± 121.1 | 617.1 ± 50.3 | 1386.8 ± 171.4 | 55 | |
| 2014-11-26 | 229.2 ± 9.6 | 202.3 ± 3.5 | 431.5 ± 13.0 | 53 |
ND: below detection limit.
2.5. The Variations in the Microcystis Community and their Correlation with Environmental Factors
The PCA was performed using morphospecies abundances, gene copy numbers and MC concentrations as variables. The first component (PC1) and second component (PC2) combined accounted for 82.1% of the data variation (PC1 = 67.5%; PC2 = 14.6%). It was clearly demonstrated that M. aeruginosa and M. wesenbergii correlated positively with total Microcysits (16S rDNA), while M. flos-aquae and M. ichthyoblabe appeared to correlate negatively with microcystins (Figure 4). In addition, M.viridis appeared to be responsible for a small portion of the toxic potential of the samples based on PCA analysis (Figure 4) and its variation (Figure 2).
Figure 4.
Principal component analysis plot displaying the correlation between Microcystis morphospecies, gene copies and MCs.
Spearman analysis was used to assess the potential effects of physical-chemical factors on total Microcystis and the toxicity of Microcystis. There was no clear relationship between nutrients concentration and total microcystin content. However, the abundance of Microcystis 16S rDNA showed a positive correlation with TP (p < 0.01) and SRP (p < 0.05), and mcyB genotype showed a significant positive correlation with TDP (p < 0.01) and SRP (p < 0.01). The results indicate that Microcystis (16S rDNA copies) was positively correlated with Microcystis cell numbers (p < 0.01) (Table 3).
Table 3.
Correlation between physical-chemical factors and Microcystis 16S rDNA gene, Microcystis mcyB gene and microcystins.
| Variable | Microcystis 16S rDNA (Gene Copies/L) | Microcystis mcyB (Gene Copies/L) | Microcystins (µg/g) |
|---|---|---|---|
| Microcystis cells (cells/L) | 0.664 ** | −0.248 | −0.371 |
| TN (mg/L) | 0.055 | 0.055 | −0.079 |
| TDN (mg/L) | 0.236 | −0.340 | 0.224 |
| NO3− (mg/L) | −0.249 | −0.173 | 0.012 |
| NH4+ (mg/L) | −0.309 | −0.136 | 0.100 |
| TP (mg/L) | 0.755 ** | 0.518 | −0.273 |
| TDP (mg/L) | 0.589 | 0.767 ** | 0.420 |
| SRP (mg/L) | 0.715 * | 0.784 ** | 0.374 |
| WT (°C) | 0.068 | 0.186 | −0.018 |
| pH | 0.329 | 0.436 | −0.118 |
* Correlation is significant at p < 0.05; ** Correlation is significant at p < 0.01.
3. Discussion
Ranked as the third largest shallow lake in China, Lake Taihu has become one of the principle focuses of the study of cyanobacterial blooms in large shallow lakes in the world. This is a consequence of the high intensity and frequency of bloom outbreaks, and massive research funding from central and local government. Over the last decade, knowledge of the dynamics of toxic Microcystis and toxins has been increasing, leading to a much better understanding of the lake in comparison with other lakes. Our study demonstrated that toxic Microcystis generally coexisted with non-toxic Microcystis strains in the entire Microcystis population. Based on data between July and December, the average percentage of toxic Microcystis was 41%, 43% and 52% from 2012 to 2014, respectively. In comparison, the percentage was usually <10% during the declining or early stages of bloom. It was thus conspicuous that toxic strains were more likely to dominate during the sustaining stage of bloom. Several studies in Lake Taihu have also shown that the occurrence of toxic genotypes was often associated with the period of heavy bloom [38,43,44]. Similar findings were also reported in Lake Chaohu [45] and Lake Dianchi [46]. Among the studies exploring the relationship between toxic Microcystis genotypes and environmental factors, Rantala et al. [47] reported that an increasing abundance of toxic Microcystis genotypes correlated with eutrophic conditions. The concentrations of phosphorus correlated strongly with the abundance of Microcystis and toxic Microcystis in Lake Erie (USA) [48], and toxic Microcystis cells increased with increasing levels of phosphorus and temperature [15,44,45]. In addition, Otten et al. [41] found that a low N: P ratio (i.e., sufficient DTN and DTP) were more likely to promote toxigenic Microcystis strains, based on a comparison of the spatial distribution of toxic genotypes in Lake Taihu during 2009 and 2010. In our study, a relationship between toxic Microcystis genotype and phosphorus concentration was also found. Copy abundance of Microcystis 16S rDNA showed a significantly positive correlation with TP (p < 0.05), and the mcyB genotype showed a significantly positive correlation with TDP (p < 0.01) (Table 3). Interestingly, data from THL-5 (31.41°N, 120.19°E), a site near our sampling area, indicated Chl a significantly correlated with TP during 2005 to 2013 (Figure S1).
During the three years of this study, a distinctive pattern of morphospecies succession existed in the lake. Normally, M. flos-aquae and M. ichthyoblabe dominated in the early stages of bloom; subsequently, M. aeruginosa and M. wesenbergii began to increase and co-dominate in summer and autumn, whereas M. viridis was often found in October and November. This phenomena was partially evidenced by the study of Zhu et al. [49]. However, it should be stressed that M. flos-aquae could proliferate either in large or small quantities throughout the entire bloom period. A previous study from our group [30] illustrated that, from June to December in 2005, the dominant species changed in the following pattern: M. flos-aquae + M. aeruginosa − M. wesenbergii − M. flos-aquae + M. aeruginosa. Thus, this similarity in the pattern of succession of morphospecies from 2005 until 2014 suggested that the succession of Microcystis morphospecies is not only seasonally distinctive, but also annually consistent. Based on the dynamics of toxic Microcystis morphospecies in our study, it was observed that the dominance of M. flos-aquae and M. ichthyoblabe coincided with a quite low percentage of toxic genotypes, whereas the presence of M. flos-aquae, M. wesenbergii and M. aeruginosa often coexisted during bloom peak and showed no clear correlation with the percentage of toxic genotypes. There were also reports exploring the correlations between morphospecies and toxic genotypes of Microcystis, Kurmayer et al. [28] found that in Lake Wannsee in Germany, most colonies (73%) of M. aeruginosa contained the mcyB gene, whereas only 16% of the M. ichthyoblabe colonies and no colonies of M. wesenbergii resulted a PCR product of mcyB. The same researchers expanded their surveys across nine European countries and further showed that M. aeruginosa was high in potential microcystin-producing species, and that colonies of M. ichthyoblabe and M. viridis contained 20% fewer copies of the mcyB gene. However, other studies showed that high microcystin concentration coincided with the dominance of the toxic M. viridis [25,50] and that all strains of M. viridis are microcystin producers [51,52]. We observed that a high percentage of a toxic genotype and high microcystin content corresponded with a high prevalence of M. viridis. Thus, we speculated that M. viridis is a high-toxicity strain in Lake Taihu. To test whether Microcystis morphospecies could be indicative of toxicity, strains of M. flos-aquae and M. aeruginosa from Lake Taihu and M. viridis from Lake Dianchi were isolated and analyzed for their microcystin content. Strains of M. flos-aquae produced trace amounts of MC or no toxin, whereas M. aeruginosa and M. viridis produced large amounts of MC (Table S1). This approach, to some extent, supported the relationship between morphospecies and toxic genotype which had been observed in the field. Therefore, we propose that the morphotype of Microcystis may be a marker of bloom toxicity, as the pattern of morphospecies succession was distinctive and consistent in Lake Taihu.
The average MC content was, on dry weight basis, 733 µg·g−1, 844 µg·g−1 and 870 µg·g−1 (data from July to November) in N2 in 2012–2014, respectively. Correspondingly, the percentage of toxic genotype was found to be 41%, 43% and 52% from the same period, indicating that unit dry weight MC correlates with the percentage of toxic Microcystis. In 2005, the average MC was ~700 µg·g−1 (from June to December) in the nearby site [34], suggesting that on an annual basis, the toxicity of bloom in the northern lake area was relatively stable or possibly increasing over the past ten years. However, the toxicity fluctuated widely on a monthly basis. This has also been reported by other studies in Taihu Lake. For instance, the toxin concentration was ~2.0 to 9.6 µg·g−1 in Meiliang Bay in 2006 [18], 28.7 µg·g−1 in the northern area during the summers of 2009 and 2010 [41], and ~7 µg·g−1 (the average value was calculated from July to October) in Meiliang Bay in 2009 [38]. In general, MC concentration was closely correlated with the biomass of the toxin-producing species [14,15,17,48,53]. We also found that MCs positively correlated with mcyB/16S rDNA, but not with nutrients (N&P).
Our previous studies [30,34] and other studies [36,37] of Lake Taihu illustrated that MC-RR and MC-LR were the two major variants of MC, with MC-RR accounting for >50% of total MC. From 2012 to 2014, we observed a slight increase in the percentage of MC-LR, which might be associated with reduced surrounding nitrogen. The fact that the gradual decrease of TN concentration over the last decade in northern part of Taihu (Figure S2) did not coincide with a decrease and/or distinctive changes in cyanobacterial bloom biomass, toxicity or even with pattern of succession indicates the complicated relationships between nitrogen and biotic parameters. Future research in Lake Taihu should pay more attention to this issue. In summary, our findings increase the understanding of the dynamics of toxic Microcystis and morphospecies, and are relevant to and useful for the long-term management and mitigation of cyanobacterial blooms and to the improvement of water quality in general. Our study described the pattern of Microcystis morphospecies succession and the dynamics of toxic Microcystis over three years of investigation. As the dynamics of algal blooms can change rapidly in large shallow lakes such as Lake Taihu, sampling frequency at monthly intervals will miss some potential patterns. Therefore, future studies should utilize short high frequency sampling in order to fully understand the short and long-term dynamics of this dynamic system.
4. Experimental Section
4.1. Study Site and Sampling
The large, shallow Lake Taihu is located near Wuxi city in Jiangsu province, China. The surface area is ~2238 km2 and the mean depth is ~1.9 m [33]. Samples were collected four times in Meiliang Bay N2 (31.41°N, 120.19°E) (Figure 5) from July to November 2012; seven times from June to December 2013 and four times from July to December 2014 in N2, Meiliang Bay.
Figure 5.
Location of the sampling site N2 (black circles) in Meiliang Bay, Lake Taihu.
Water samples were collected from 0.5 m depth of surface layer. One liter of water was collected and preserved with 1% Lugol’s iodine solution for identification of the phytoplankton assemblage. Water samples for Microcystis DNA extraction and nitrogen-phosphorus nutrients index were transported into the lab in an ice box.
Algae samples were collected from surface water using a phytoplankton net (40-µm mesh) and were washed in freshwater to eliminate cell-bound nutrients effect. They were then stored in 50-mL sterile polyethylene bottles and frozen in solid CO2.
4.2. Physicochemical Parameters and Nutrients
Physicochemical parameters, including temperature and pH, were determined using the YSI multi-parameter water quality Sonde (6600 V2, Yellow Springs Instruments, Yellow Springs, OH, USA). The chemical variables, such as total nitrogen (TN) and dissolved total nitrogen (DTN) (GB 11894-89), total phosphorus (TP), dissolved total phosphorus (DTP) and soluble reactive phosphorus (SRP) (GB 11893-89), nitrate (NO3-N) (HJ/T 346-2007), nitrite (NO2-N) (GB 7493-87), ammonium (NH3-N) (HJ 535-2009), were measured according to Chinese standard methods. Water samples were filtered onto a 1.2-µm nominal pore-size polycarbonate GF/C (47-mm diameter Millipore) membrane and extracted by 90% acetone; the concentration of chlorophyll-a (Chl-a) was determined by spectrophotometry [54].
4.3. Identification and Counting of Microcystis Morphospecies
Microcystis morphospecies were classified according to morphology (Komárek and Komárková, 2002) with fresh samples collected using a plankton net (25 μm diameter). Samples of each Microcystis morphotype colonies were picked out from fresh sampling, fixed using 0.1 mL Lugol′s iodine solution and shaken until the colonies turned into single-cells. These were counted using a microscope (Eclipse E200, Nikon, Tokyo, Japan). The average cell numbers of each colony type were used to calculated the relative biomass of each type of Microcystis colony, and the abundance of each major Microcystis morphospecies was calculated using the average cell numbers of each morphospecies [30].
4.4. DNA Extraction and qPCR
Water samples were filtered onto a 0.22-µm nominal pore-size polycarbonate membrane (XingYa factory, Shanghai, China) until high phytoplankton biomass had accumulated on the membrane, and genomic DNA was extracted by a water DNA kit D5525-01 (Omega Bio-tek, Norcross, GA, USA) according to its protocol.
To quantify the abundance of toxic Microcystis spp. and total Microcystis spp. in Lake Taihu, a standard curve preparation real-time PCR assay was performed using 16S rRNA and mcyB gene primers. A 20-mL culture solution of M. aeruginosa PCC7806, containing 2.7 × 107 cells·mL−1, was filtered through a 0.22-µm nominal pore-size polycarbonate membrane (XingYa factory, Shanghai). Extracted DNA from the membrane was prepared using five dilution gradients, ranging from 10 to 105 dilutions of template DNA (equivalent to 5.4 × 107 cells to 5.4 × 103 cells). The standard curve was based on DNA concentrations (equal to cell numbers) with the threshold cycle (Ct) of the diluted samples.
A quantitative real-time PCR assay was performed in a volume of 20 µL, with 10 µL SYBR-Green (Toyobo, Osaka, Japan), 8 µL sterile water, 0.5 µL each of forward and reverse primer and 1 µL template DNA (~100 ng): mcyB and 16S rDNA primers see Table 1. Amplification was performed in a Bio-Rad real-time Thermos Cycler using the following protocol: for mcyB, initial denaturation at 95 °C for 1 min, followed by 40 cycles of 95 °C for 15 s, 59 °C for 30 s (decreasing by 0.5 °C each cycle) and 72 °C for 30 s. For 16S: preheating for 1 min at 95 °C, followed by 40 cycles of 25 s at 95 °C, 30 s at 53 °C and 60 s at 70 °C. All samples were amplified in triplicate. After PCR, fluorescent melting curve analysis was performed by gradually increasing the temperature from 65 °C to 95 °C at a rate of 0.1 °C·s−1.
4.5. Extraction and Determination of Particulate Microcystins
Freeze-dried algal cell samples (about 50 mg) were magnetically stirred with 5% acetic acid for 30 min, centrifuged at 7000 rpm for 10 min and the supernatant transferred to a bottle; the algal residues were extracted with 90% (v/v) aqueous methanol for 30 min. Methanol extract was concentrated to 1–2 mL by rotary concentration and all extract were through C18 Sep-pak cartridges. Elution was performed on a C18 Sep-pak column with 10–15 mL methanol and evaporation to dry. Finally, microcystin was eluted in solutions with 1 mL 50% (v/v) chromatographic pure methanol (Thermo Fisher Scientific, Waltham, MA, USA) and stored at −20 °C for HPLC analysis. The microcystin concentration was determined by HPLC [55].
4.6. Statistical Analysis
The principal component analysis of the Microcystis morphospecies, gene copies and MCs, was performed using CANOCO 4.5 (Microcomputer Power, Ithaca, NY, USA). Spearman’s correlation analysis was used to determine the relationship between microcystin content, Microcystis, toxic Microcystis and physical-chemical factors using SPSS statistics software version 20 (SPSS Inc., Chicago, IL, USA). A correlation was considered significant at p < 0.05.
5. Conclusions
Based on three consecutive years of investigation of the dynamics of toxic genotypes, MC production and morphospecies succession, combined with the comparison of data obtained over a decade, we were able to describe the status of toxic Microcystis and its toxicity in the northern parts of Lake Taihu.The average proportions of toxic genotypes ranged from 41% to 52% during the bloom periods. The pattern of morphospecies succession was seasonally distinct and annually consistent. The MC concentration of dominant morphospecies was relatively stable. Therefore, we propose that morphospecies could indicate toxicity of a bloom, especially during the early or late stages. The toxicity of the bloom was not only dependent on the abundance of toxic Microcystis, but also related to MC production and the composition of MC congeners. Based on historical and current data, we can conclude that the annual bloom toxicity of Lake Taihu was relatively stable or has possibly increased during the last decade.
Supplementary Materials
The following are available online at www.mdpi.com/2072-6651/8/1/23/s1.
Acknowledgments
This work was supported by the National Basic Research Program of China [grant number 2008CB418006], the National Science Foundation of China (grant numbers 41561144008, 31300362, 2013004). We are grateful to Boqiang Qin for kindly providing THL5 data. We also thank Tao Li and his team for their kind cooperation during the sampling.
Author Contributions
H.L., S.L. conceived and designed the field survey and experiments; H.L. performed field survey and experiments, and wrote the paper; S.L., G.N. and S.K. modified the paper; L.L., S.W. and H.L. assisted in sampling and analysis.
Conflicts of Interest
The authors declare no conflict of interest.
References
- Falconer, I.R.; Humpage, A.R. Health risk assessment of cyanobacterial (blue-green algal) toxins in drinking water. Int. J. Environ. Res. Pubulic Health 2005, 2, 43–50. [Google Scholar] [CrossRef]
- Codd, G.A.; Lindsay, J.; Young, F.M.; Morrison, L.F.; Metcalf, J.S. From mass mortalities to management measures. In Harmful Cyanobacteria; Huisman, J., Matthijs, H.C.P., Visser, P.M., Eds.; Springer Netherlands: Dordrecht, The Netherland, 2005; pp. 1–23. [Google Scholar]
- Honkanen, R.E.; Zwiller, J.; Moore, R.E.; Daily, S.L.; Khatra, B.S.; Dukelow, M.; Boynton, A.L. Characterization of microcystin-LR, a potent inhibitor of type 1 and type 2A protein phosphatases. J. Biol. Chem. 1990, 265, 19401–19404. [Google Scholar] [PubMed]
- Meiβner, K.; Dittmann, E.; Börner, T. Toxic and non-toxic strains of the cyanobacterium Microcystis aeruginosa contain sequences homologous to peptide synthetase genes. FEMS Microbiol. Lett. 1996, 135, 295–303. [Google Scholar] [CrossRef]
- Dittmann, E.; Neilan, B.A.; Erhard, M.; Döhren, H.V.; Börner, T. Insertional mutagenesis of a peptide synthetase gene that is responsible for hepatotoxin production in the cyanobacterium Microcystis aeruginosa PCC 7806. Mol. Microbiol. 1997, 26, 779–787. [Google Scholar] [CrossRef] [PubMed]
- Tillett, D.; Parker, D.L.; Neilan, B.A. Detection of toxigenicity by a probe for the microcystin synthetase a gene (mcyA) of the cyanobacterial genus Microcystis: Comparison of toxicities with 16S rRNA and phycocyanin operon (phycocyanin intergenic spacer) phylogenies. Appl. Environ. Microb. 2001, 67, 2810–2818. [Google Scholar] [CrossRef] [PubMed]
- Mikalsen, B.; Boison, G.; Skulberg, O.M.; Fastner, J.; Davies, W.; Gabrielsen, T.M.; Rudi, K.; Jakobsen, K.S. Natural variation in the microcystin synthetase operon mcyABC and impact on microcystin production in Microcystis strains. J. Bacteriol. 2003, 185, 2774–2785. [Google Scholar] [CrossRef] [PubMed]
- Welker, M.; von Döhren, H. Cyanobacterial peptides-nature’s own combinatorial biosynthesis. FEMS Microbiol. Rev. 2006, 30, 530–563. [Google Scholar] [CrossRef] [PubMed]
- Bortoli, S.; Oliveira-Silva, D.; Krüger, T.; Dörr, F.; Colepicolo, P.; Volmer, D.; Pinto, E. Growth and microcystin production of a Brazilian Microcystis aeruginosa strain (LTPNA 02) under different nutrient conditions. Rev. Bras. Farmacogn. 2014, 24, 389–398. [Google Scholar] [CrossRef]
- Gupta, N.; Pant, S.C.; Vijayaraghavan, R.; Lakshmana Rao, P.V. Comparative toxicity evaluation of cyanobacterial cyclic peptide toxin microcystin variants (LR, RR, YR) in mice. Toxicology 2003, 188, 285–296. [Google Scholar] [CrossRef]
- Kurmayer, R.; Kutzenberger, T. Application of real-time PCR for quantification of microcystin genotypes in a population of the toxic cyanobacterium Microcystis sp. Appl. Environ. Microb. 2003, 69, 6723–6730. [Google Scholar] [CrossRef]
- Rinta-Kanto, J.M.; Ouellette, A.; Boyer, G.L.; Twiss, M.R.; Bridgeman, T.B.; Wilhelm, S.W. Quantification of toxic Microcystis spp. during the 2003 and 2004 blooms in western Lake Erie using quantitative real-time PCR. Environ. Sci. Technol. 2005, 39, 4198–4205. [Google Scholar] [CrossRef] [PubMed]
- Furukawa, K.; Noda, N.; Tsuneda, S.; Saito, T.; Itayama, T.; Inamori, Y. Highly sensitive real-time PCR assay for quantification of toxic cyanobacteria based on microcystin synthetase A gene. J. Biosci. Bioeng. 2006, 102, 90–96. [Google Scholar] [CrossRef] [PubMed]
- Hotto, A.M.; Satchwell, M.F.; Berry, D.L.; Gobler, C.J.; Boyer, G.L. Spatial and temporal diversity of microcystins and microcystin-producing genotypes in Oneida Lake, NY. Harmful Algae 2008, 7, 671–681. [Google Scholar] [CrossRef]
- Davis, T.W.; Berry, D.L.; Boyer, G.L.; Gobler, C.J. The effects of temperature and nutrients on the growth and dynamics of toxic and non-toxic strains of Microcystis during cyanobacteria blooms. Harmful Algae 2009, 8, 715–725. [Google Scholar] [CrossRef]
- Okello, W.; Portmann, C.; Erhard, M.; Gademann, K.; Kurmayer, R. Occurrence of microcystin-producing cyanobacteria in Ugandan freshwater habitats. Environ. Toxicol. 2010, 25, 367–380. [Google Scholar] [CrossRef] [PubMed]
- Srivastava, A.; Choi, G.G.; Ahn, C.Y.; Oh, Hee-Mock.; Ravi, A.K.; Asthana, R.K. Dynamics of microcystin production and quantification of potentially toxigenic Microcystis sp. using real-time PCR. Water Res. 2012, 46, 817–827. [Google Scholar] [CrossRef] [PubMed]
- Ye, W.; Liu, X.L.; Tan, J.; Li, D.; Yang, H. Diversity and dynamics of microcystin—Producing cyanobacteria in China's third largest lake, Lake Taihu. Harmful Algae 2009, 8, 637–644. [Google Scholar] [CrossRef]
- Sabart, M.; Pobel, D.; Briand, E.; Combourieu, B.; Salencon, M.J.; Humbert, J.F.; Latour, D. Spatiotemporal variations in microcystin concentrations and in the proportions of microcystin-producing cells in several Microcystis aeruginosa populations. Appl. Environ. Microb. 2010, 76, 4750–4759. [Google Scholar] [CrossRef] [PubMed]
- Guedes, I.A.; da Costa Leite, D.M.; Manhães, L.A.; Bisch, P.M.; Azevedo, S.; Pacheco, A. Fluctuations in microcystin concentrations, potentially toxic Microcystis and genotype diversity in a cyanobacterial community from a tropical reservoir. Harmful Algae 2014, 39, 303–309. [Google Scholar] [CrossRef]
- Jacoby, J.; Collier, D.C.; Welch, E.B.; Hardy, F.J.; Crayto, M. Environmental factors associated with a toxic bloom of Microcystis aeruginosa. Can. J. Fish. Aquat. Sci. 2000, 57, 231–240. [Google Scholar] [CrossRef]
- Kotak, B.G.; Lam, A.; Prepas, E.E.; Hrudey, S. Role of chemical and physical variables in regulating microcystin-LR concentration in phytoplankton of eutrophic lakes. Can. J. Fish. Aquat. Sci. 2000, 57, 1584–1593. [Google Scholar] [CrossRef]
- Izydorczyk, K.; Jurczak, T.; Wojtal-Frankiewicz, A.; Skowron, A.; Mankiewicz-Boczek, J.; Tarczyńska, M. Influence of abiotic and biotic factors on microcystin content in Microcystis aeruginosa cells in a eutrophic temperate reservoir. J. Plankton Res. 2008, 30, 393–400. [Google Scholar] [CrossRef]
- Horst, G.P.; Sarnelle, O.; White, J.D.; Hamilton, S.K.; Kaul, R.; Bressie, J.D. Nitrogen availability increases the toxin quota of a harmful cyanobacterium, Microcystis aeruginosa. Water Res. 2014, 54, 188–198. [Google Scholar] [CrossRef] [PubMed]
- Park, H.D.; Kim, B.; Kim, E.; Okino, T. Hepatotoxic microcystins and neurotoxic anatoxin-a in cyanobacterial blooms from Korean lakes. Environ. Toxicol. Water Qual. 1998, 13, 225–234. [Google Scholar] [CrossRef]
- Honma, T.; Park, H.D. Influences of nitrate and phosphate concentrations on Microcystis species composition and microcystin concentration in Lake Suwa. J. Jpn. Soc. Water Environ. 2005, 28, 373–378. [Google Scholar] [CrossRef]
- Yamamoto, Y.; Nakahara, H. Seasonal variations in the morphology of bloom-forming cyanobacteria in a eutrophic pond. Limnology 2009, 10, 185–193. [Google Scholar] [CrossRef]
- Kurmayer, R.; Dittmann, E.; Fastner, J.; Chorus, I. Diversity of microcystin genes within a population of the toxic cyanobacterium Microcystis spp. in lake Wannsee (Berlin, Germany). Microb. Ecol. 2002, 43, 107–118. [Google Scholar] [CrossRef] [PubMed]
- Via-Ordorika, L.; Fastner, J.; Kurmayer, R.; Hisbergues, M.; Dittmann, E.; Komarek, J.; Erhard, M.; Chorus, I. Distribution of microcystin-producing and non-microcystin-producing Microcystis sp. in European freshwater bodies: Detection of microcystins and microcystin genes in individual colonies. Syst. Appl. Microbiol. 2004, 27, 592–602. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Peng, L.; Wan, N.; Song, L. Mechanism study on the frequent variations of cell-bound microcystins in cyanobacterial blooms in Lake Taihu: Implications for Water Quality Monitoring and Assessments. Chemosphere 2009, 77, 1585–1593. [Google Scholar] [CrossRef] [PubMed]
- Kurmayer, R.; Christiansen, G.; Chorus, I. The abundance of microcystin-producing genotypes correlates positively with colony size in Microcystis sp. and determines its microcystin net production in Lake Wannsee. Appl. Environ. Microb. 2003, 69, 787–795. [Google Scholar] [CrossRef]
- Wang, X.; Sun, M.; Xie, M.; Liu, M.; Luo, L.; Li, P.F.; Kong, F.X. Differences in microcystin production and genotype composition among Microcystis colonies of different sizes in Lake Taihu. Water Res. 2013, 47, 5659–5669. [Google Scholar] [CrossRef] [PubMed]
- Qin, B.; Xu, P.; Wu, Q.; Luo, L.C.; Zhang, Y.L. Environmental issues of lake Taihu, China. Hydrobiologia 2007, 581, 3–14. [Google Scholar] [CrossRef]
- Song, L.; Chen, W.; Peng, L.; Wan, N.; Gan, N.Q.; Zhang, X.M. Distribution and bioaccumulation of microcystins in water columns: A Systematic Investigation into the Environmental Fate and the Risks Associated with Microcystins in Meiliang Bay, Lake Taihu. Water Res. 2007, 41, 2853–2864. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Song, L.; Peng, L.; Wan, N.; Zhang, X.; Gan, N. Reduction in microcystin concentrations in large and shallow lakes: Water and Sediment-Interface Contributions. Water Res. 2008, 42, 763–773. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Niu, Y.; Xie, P.; Chen, J.; Ma, Z.; Tao, M.; Qi, M.; Wu, L.; Guo, L. Factors affecting temporal and spatial variations of microcystins in Gonghu Bay of Lake Taihu, with potential risk of microcystin contamination to human health. Sci. World J. 2010, 10, 1795–1809. [Google Scholar] [CrossRef] [PubMed]
- Otten, T.G.; Paerl, H.W. Phylogenetic inference of colony isolates comprising seasonal Microcystis blooms in Lake Taihu, China. Microb. Ecol. 2011, 62, 907–918. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Sun, M.; Wang, J.; Yang, L.; Luo, L.; Li, P.; Kong, F. Microcystis genotype succession and related environmental factors in Lake Taihu during cyanobacterial blooms. Microb. Ecol. 2012, 64, 986–999. [Google Scholar] [CrossRef] [PubMed]
- Tao, M.; Xie, P.; Chen, J.; Qin, B.; Zhang, D.; Niu, Y.; Zhang, M.; Wang, Q.; Wu, L. Use of a generalized additive model to investigate key abiotic factors affecting microcystin cellular quotas in heavy bloom areas of Lake Taihu. PLoS ONE 2012, 7, e32020. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Xie, P.; Zhang, D.; Wen, Z. Seasonal dynamics of microcystins with associated biotic and abiotic parameters in two bays of Lake Taihu, the third largest freshwater lake in China. Bull. Environ. Contam. Toxicol. 2008, 80, 24–29. [Google Scholar] [CrossRef] [PubMed]
- Otten, T.G.; Xu, H.; Qin, B.; Zhu, G.; Paerl, H.W. Spatiotemporal patterns and ecophysiology of toxigenic Microcystis blooms in Lake Taihu, China: implications for water quality management. Environ. Sci. Technol. 2012, 46, 3480–3488. [Google Scholar] [CrossRef] [PubMed]
- Neilan, B.A.; Jacobs, D.; Blackall, L.L.; Hawkins, P.R.; Cox, P.T.; Goodman, A.E. rRNA sequences and evolutionary relationships among toxic and nontoxic cyanobacteria of the genus Microcystis. Int. J. Syst. Bacteriol. 1997, 47, 693–697. [Google Scholar] [CrossRef] [PubMed]
- Paerl, H.W.; Xu, H.; McCarthy, M.J.; Zhu, G.; Qin, B.; Li, Y.; Gardner, W. Controlling harmful cyanobacterial blooms in a hyper-eutrophic lake (Lake Taihu, China): The Need for a Dual Nutrient (N & P) Management Strategy. Water Res. 2011, 45, 1973–1983. [Google Scholar] [PubMed]
- Li, D.; Kong, F.; Shi, X.; Ye, L.; Yu, Y.; Yang, Z. Quantification of microcystin-producing and non-microcystin producing Microcystis populations during the 2009 and 2010 blooms in Lake Taihu using quantitative real-time PCR. J. Environ. Sci. 2012, 24, 284–290. [Google Scholar] [CrossRef]
- Yu, L.; Kong, F.; Zhang, M.; Yang, Z.; Shi, X.; Du, M. The Dynamics of Microcystis Genotypes and Microcystin Production and Associations with Environmental Factors during Blooms in Lake Chaohu, China. Toxins 2014, 6, 3238–3257. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.; Wu, Y.; Song, L.; Gan, N. Ecological dynamics of toxic Microcystis spp. and microcystin-degrading bacteria in Dianchi Lake, China. Appl. Environ. Microb. 2014, 80, 1874–1881. [Google Scholar] [CrossRef] [PubMed]
- Rantala, A.; Rajaniemi-Wacklin, P.; Lyra, C.; Lepisto, L.; Rintala, J.; MankiewiczBoczek, J.; Sivonen, K. Detection of microcystin-producing cyanobacteria in Finnish lakes with genus-specific microcystin synthetase gene E (mcyE) PCR and associations with environmental factors. Appl. Environ. Microb. 2006, 72, 6101–6110. [Google Scholar] [CrossRef] [PubMed]
- Rinta-Kanto, J.M.; Konopko, E.A.; DeBruyn, J.M.; Bourbonniere, R.A.; Boyer, G.L.; Wilhelm, S.W. Lake Erie Microcystis: Relationship between Microcystin Production, Dynamics of Genotypes and Environmental Parameters in a Large Lake. Harmful Algae 2009, 8, 665–673. [Google Scholar] [CrossRef]
- Zhu, W.; Li, M.; Dai, X.; Xiao, M. Differences in vertical distribution of Microcystis morphospecies composition in a shallow hypertrophic lake (Lake Taihu, China). Environ. Earth Sci. 2015, 73, 5721–5730. [Google Scholar] [CrossRef]
- Chan, W.S.; Recknagel, F.; Cao, H.; Park, H.D. Elucidation and short-term forecasting of microcystin concentrations in Lake Suwa (Japan) by means of artificial neural networks and evolutionary algorithms. Water Res. 2007, 41, 2247–2255. [Google Scholar] [CrossRef] [PubMed]
- Namikoshi, M.; Rinehart, K.L.; Sakai, R.; Stotts, R.R.; Dahlem, A.M.; Beasley, V.R.; Carmichael, W.W.; Evans, W.R. Identification of 12 hepatotoxins from a Homer Lake bloom of the cyanobacteria Microcystis aeruginosa, Microcystis viridis and Microcystis wesenbergii: Nine New Microcystins. J. Org. Chem. 1992, 57, 866–872. [Google Scholar] [CrossRef]
- Otsuka, S.; Suda, S.; Li, R.; Watanabe, M.; Oyaizu, H.; Matsumoto, S.; Watanabe, M. Phylogenetic relationships between toxic and non-toxic strains of the genus Microcystis based on 16S to 23S internal transcribed spacer sequence. FEMS Microbiol. Lett. 1999, 172, 15–21. [Google Scholar] [CrossRef] [PubMed]
- Ha, J.H.; Hidaka, T.; Tsuno, H. Quantification of toxic Microcystis and evaluation of its dominance ratio in blooms using real-time PCR. Environ. Sci. Technol. 2009, 43, 812–818. [Google Scholar] [CrossRef] [PubMed]
- Nusch, E.A. Comparison of different methods for chlorophyll and phaeopigment determination. Archiv. Hydrobiol. Beih. Ergebn. Limnol. 1980, 14, 14–36. [Google Scholar]
- Chen, W.; Gan, N.Q.; Song, L.R. Photodegradation dynamics of pure microcystin variants with illumination of fixed wavelength UV-lights. Acta Chim. Sin. 2004, 62, 142–147. [Google Scholar]
© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons by Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).