1. Introduction
Fungal infection represents one of the deadliest yet under-recognized infectious diseases in the world. Every year, at least 1.5 million people succumb to severe fungal diseases and the mortality rate continues to rise steadily, catalyzed by the growing population of vulnerable individuals, such as immunocompromised patients undergoing myeloablative chemotherapy and stem cell transplants, as well as a newly emerging group of COVID-19 patients being treated with corticosteroids and tocilizumab [
1,
2,
3]. While antifungal drugs are the mainstream therapies used for fungal diseases, the rapid emergence of drug resistance in the environment due to the widespread use of agricultural fungicides necessitates the development of alternative and diverse antifungal pipelines to reduce the impact of such resistance on the treatment of fungal diseases [
4].
The host immune system plays a key role in surveillance and defense against invading fungal pathogens, evidenced by the self-limiting and superficial nature of fungal diseases observed in immunocompetent individuals as opposed to the life-threatening invasive infections affecting immunocompromised patients [
5]. During fungal infection, the C-type lectin receptor Dectin-1, expressed on the dendritic cell, macrophage, and neutrophil surfaces, recognizes the β-glucan ligand present on the yeast cell wall and initiates the activation of Card9, a critical adaptor protein involved in antifungal defense [
6,
7,
8]. Card9 consists of an N-terminal CARD domain and a C-terminal coiled-coil domain. Upon activation, the CARD domain of Card9 forms a homophilic interaction with Bcl10, while the coiled-coil domain undergoes ubiquitination by TRIM62 to disrupt its autoinhibition. These processes result in the assembly of a functional Card9-Bcl10-Malt1 (CBM) signalosome, which subsequently turns on downstream NF-kb and MAPK signaling to trigger phagocytosis, as well as the production of antifungal cytokines, such as interleukin (IL)-6, TNFα, and IL-1β for fungal clearance [
9,
10,
11]. Notably, humans with deficiencies or loss-of-function mutations in Card9 are presented clinically with spontaneous fungal infections across multiple sites, including that of the skin, oral cavities, kidneys, and the central nervous system, suggesting its pivotal and indispensable role in mediating antifungal defense [
12,
13,
14,
15,
16]. As such, interventions that enhance Card9 activity in innate immune cells can potentially boost host antifungal immunity, thereby acting as an immune-based therapy for fungal diseases.
Previously, we have identified a new adaptor molecule, Dok3, to be a critical negative regulator of Card9 signaling in neutrophils. Dok3 contains an N-terminal pleckstrin homology (PH) domain for plasma membrane localization, a central phosphotyrosine binding (PTB) domain to mediate interaction with phosphotyrosine-containing consensus motif, and a C-terminal proline-rich region that serves as a docking site for SH2-containing proteins [
17]. Specifically, Dok3 mediates the recruitment of Protein Phosphatase 1 (PP1) to maintain Card9 in its de-phosphorylated and inactive state, thereby dampening downstream antifungal immune responses. Consequently, a loss of Dok3 enhances phagocytosis and antifungal cytokine production via neutrophils, which protect the host from morbidity and mortality induced by a systemic
Candida albicans infection [
18]. Since Dok3 suppresses Card9 activity, disrupting the Dok3–Card9 interaction could potentially be a novel therapeutic strategy used to boost neutrophilic responses to fight fungal infection [
17].
In this study, we reported that two synthetic peptides derived from the coiled-coil region of Card9 can specifically interfere with Dok3–Card9 binding to enhance antifungal immune responses in human neutrophils. As such, these peptides represent a novel class of immune-based therapeutics which can act as an adjunctive to current antifungal drugs, thereby enhancing therapeutic efficacy and minimizing the chances of treatment failure due to antifungal resistance.
2. Materials and Methods
2.1. Peptide Synthesis
Peptides were synthesized by Bio Basic Inc. (Singapore) with a 95% purity, as determined by HPLC. The sequences of the peptides are shown in
Figure 1.
2.2. Isolation of Neutrophils
The venous blood of healthy human donors was collected and neutrophils were purified using an EasySep Direct Human Neutrophil Isolation Kit (Stemcell Technologies, Vancouver, BC, Canada), according to the manufacturer’s protocol. The neutrophils obtained were rested at 37 °C for at least 1 h.
2.3. Neutrophil Stimulation
Additionally, 2 × 106 purified neutrophils were preincubated with 20 µg/mL synthetic peptides for 30 min at 37 °C before stimulation with 10 µg/mL zymosan (Invivogen, San Diego, CA, USA), an insoluble preparation of the cell wall from Saccharomyces cerevisiae, for 1.5 h (mRNA analysis via qPCR) or 3 h in the presence of GolgiPlug (BD, Franklin Lakes, NJ, USA) (protein analysis via intracellular flow cytometry) at 37 °C in RPMI 1640 media supplemented with 2 mM L-Glutamine, 10% FBS, and penicillin/streptomycin. GolgiPlug is a brefeldin A-containing protein transport inhibitor that blocks intracellular protein transport processes, thereby allowing for the accumulation of cytokines intracellularly for detection by flow cytometry.
2.4. Recombinant Vectors
Recombinant vector pcDNA3.1 encoding Card9, Dok3, or the various truncated mutants were synthesized by Bio Basic Inc. (Singapore). Gene sequences for Card9 and Dok3 were extracted from the National Center for Biotechnology Information (NCBI) website. The amino acid position for the PH domain of Dok3 is 9–123, the PTB domain of Dok3 is 157–-215, the CARD domain of Card9 is 10–95, and the coiled-coil domain of Card9 is 127–-396.
2.5. Cell Transfection
In addition, HEK293T cells were seeded in 6-well plates and transfected the following day with recombinant vectors encoding Card9, Dok3, or various truncated mutants using Lipofectamine 3000 (ThermoFisher Scientific, Singapore); this occurred in the presence or absence of synthetic peptides. Specifically, as shown in
Figure 2B, the HEK293T cells were untransfected, transfected with HA-tagged Card9 alone, transfected with HA-tagged Card9 and FLAG-tagged Dok3-1 truncation variant, transfected with HA-tagged Card9 and FLAG-tagged Dok3-2 truncation variant, transfected with HA-tagged Card9 and FLAG-tagged Dok3-3 truncation variant, or transfected with HA-tagged Card9 and full-length (FL) FLAG-tagged Dok3. As displayed in
Figure 2C, the HEK293T cells were untransfected, transfected with FLAG-tagged Dok3 alone, transfected with FLAG-tagged Dok3 and HA-tagged Card9-1 truncation variant, transfected with FLAG-tagged Dok3 and HA-tagged Card9-2 truncation variant, or transfected with FLAG-tagged Dok3 and HA-tagged FL Card9. After 24 h of transfection, the cells were harvested by trypsinization and subsequently lysed with a cell lysis buffer (Cell Signaling Technology, Danvers, MA, USA) containing protease and phosphatase inhibitors (Cell Signaling Technology).
2.6. Immunoprecipitation (IP) and Western Blotting
The HEK293T cells were lysed with a cell lysis buffer (Cell Signaling Technology) containing protease and phosphatase inhibitors (Cell Signaling Technology) for 1 h at 4 °C with rolling. Cell homogenates were centrifuged at max spin for 5 min at 4 °C; supernatants (whole cell lysate) were collected and IP overnight with anti-FLAG or anti-HA antibodies and pulled down using Protein A/G Plus Agarose beads (Santa Cruz Biotechnology Inc., Dallas, TX, USA) at 4 °C. The beads were washed in lysis buffer 3 times and precipitates were collected by boiling them in SDS sample buffer for 5 min. The whole cell lysates and precipitates were analyzed by Western Blotting, according to standard protocol. Briefly, they were loaded into and electrophoresed in 10% SDS-polyacrylamide gels and subsequently transferred onto polyvinylidene difluoride membranes (Millipore, Burlington, MA, USA). The membranes were blocked with 5% BSA for 1 h at room temperature and probed overnight at 4 °C using the indicated antibodies: anti-FLAG-peroxidase (clone 6F7; Sigma Aldrich, St. Louis, MO, USA) and anti-HA-peroxidase (clone HA-7; Sigma Aldrich) in 1:1000 dilution. SuperSignal West Pico PLUS Chemiluminescent substrate (Thermo Scientific, Singapore) was applied to the blots and the chemiluminescent signals were imaged.
2.7. Peptide Uptake Assay
Purified neutrophils were incubated with 1, 5, or 20 µg/mL synthetic peptides for 30 min or 2 h at 37 °C. The uptake of the peptides was measured by flow cytometry, as indicated by levels of FITC fluorescence.
2.8. Cell Death Assay
Purified neutrophils were left untreated or incubated with 1, 5, or 20 µg/mL synthetic peptides for 30 min or 2 h at 37 °C. The cells were stained with APC Annexin V (Catalog 550475; BD Pharmingen, Franklin Lakes, NJ, USA) and Fixable Viability Stain 510 (Catalog 564406; BD Biosciences, Franklin Lakes, NJ, USA), according to the manufacturer’s protocol for identifying apoptotic and dead cells.
2.9. Phagocytosis Assay
Heat-killed Candida albicans (HKCA) were labeled with calcofluor-white (CFW) (Sigma-Aldrich) for 10 min at room temperature. Subsequently, purified neutrophils were co-cultured with CFW-labeled HKCA at 37 °C for 45 min. Adherent fungal cells were quenched with trypan blue and the cells were washed 5 times with PBS. The extent of the phagocytosis was measured by flow cytometry.
2.10. Flow Cytometry
Neutrophils were surface labeled with fluorochrome-conjugated antibodies for 10 mins at 4 °C in staining buffer (PBS containing 1% BSA). For intracellular staining, cells were fixed and permeabilized using the Cytofix/Cytoperm Kit (BD), according to the manufacturer’s protocol, before staining with the antibodies for 1 h at room temperature. Data were acquired using a LSRII (BD Biosciences) flow cytometer and analyzed using FlowJo software (Tree Star, Mountain View, CA, USA). The following antibodies were used: APC Annexin V (Catalog 550475; BD Pharmingen), Fixable Viability Stain 510 (Catalog 564406; BD Biosciences), and APC/Cyanine7 anti-human TNFα antibody (Clone MAb11; BioLegend, San Diego, CA, USA).
2.11. Quantitative PCR
Purified neutrophils were lysed with TRIzol (Gibco, Thermo Fisher Scientific, Billings, MT, USA) and RNA was purified using phenol/chloroform extraction, as per the manufacturer’s protocol. Complementary DNA was reverse transcribed using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA), as per the manufacturer’s protocol. The following primers were used for real-time PCR using SYBR Green PCR Master Mix (Applied Biosystems, Waltham, MA, USA):
Il1b (forward): AGATGATAAGCCCACTCTACAG;
Il1b (reverse): ACATTCAGCACAGGACTCTC;
Il6 (forward): ACAGCCACTCACCTCTTCAG;
Il6 (reverse): CCATCTTTTTCAGCCATCTTT;
hprt1 (forward): GAAAAGGACCCCACGAAGTGT;
hprt1 (reverse): AGTCAAGGGCATATCCTACAACA.
The mRNA expression of il1b and il6 were normalized to hprt1 using the 2−ΔΔCt method.
2.12. In Silico Model Generation
A structural model of the interaction between the N-terminal pleckstrin homology (PH) and phosphotyrosine binding (PTB) domains of Dok3 with the coiled-coil domain of Card9 was generated using ColabFold [
19] via its “advanced interface on Google Colab”. The MMseqs2 method [
20] was selected in ColabFold to generate the multiple sequence alignments.
2.13. Statistics
Figures and statistical analyses (one-way ANOVA and two-tailed Students’ t-test) were generated using the GraphPad Prism software version 9. A p-value of less than 0.05 was considered significant.
4. Discussion
Invasive fungal infection is a serious but neglected public health threat worldwide; the emerging resistance of pathogenic fungi to licensed antifungal drugs highlights the need to expand our therapeutic toolbox against this deadly and destructive disease. In this study, we identified two synthetic peptides which can specifically disrupt the Dok3–Card9 interaction to boost antifungal immunity in human neutrophils (
Figure 7). As such, these peptide inhibitors represent a new class of therapeutics aimed at enhancing host innate immunity and demonstrate a novel immune-based approach to antifungal therapy.
Card9 is a key signaling molecule involved in antifungal defense. In response to fungal recognition by C-type lectin receptors, Card9 will be activated to form the CBM complex, which then transduces the signal downstream to initiate immune responses to promote inflammation and fungi killing [
13,
21]. The importance of this signaling pathway in the antifungal response is demonstrated by human Card9 mutations and deficiencies that manifest spontaneous fungi infections across multiple tissues and organs [
12,
14,
15]. Additionally, amongst the innate immune cells involved in antifungal immunity, neutrophils are largely responsible for the eradication of systemic fungal infections. Previously, we identified that Dok3 is a novel negative regulator of antifungal immunity by recruiting PP1 to de-phosphorylate Card9, thereby dampening downstream immune responses in neutrophils. As such, a loss of Dok3 protects mice from the lethal systemic infection
C. albicans; this further suggests that disrupting the Dok3–Card9 interaction could potentially remove the brakes on antifungal immunity and enhance neutrophilic effector functions [
17]. In this study, based on the predicted interacting interface between the Dok3 PH and PTB domains and the Card9 coiled-coil domain, we derived two synthetic peptides which can specifically disrupt Dok3–Card9 binding. Indeed, these synthetic peptides are able to boost pro-inflammatory cytokine production and the phagocytic capacity of human neutrophils in the presence of fungal-cell-wall-component zymosan, demonstrating their efficacy in fighting fungal infection. Moreover, these synthetic peptides are relatively well-tolerated by neutrophils and do not trigger immune responses in the absence of a fungal ligand, thereby supporting their utility as antifungal therapeutics.
Currently, there are five major classes of antifungal drugs—azoles, echinocandins, polyenes, allylamines, and antimetabolites. They remain the mainstream therapy for invasive fungal infection, even though they are frequently associated with high treatment failure rates owing to the deep-seated nature of fungal infections that makes it difficult for the drugs to reach the affected site, as well as the widespread emergence of antifungal resistance [
4]. Despite ongoing efforts to develop new fungicides, the rate of the emergence of drug resistance is higher than the rate of fungicide discovery. Moreover, selection pressure exerted by these chemicals on fungi, in both the environment and clinics, will inadvertently drive the acquisition of resistance over time [
22,
23]. Hence, the development of alternative treatments for fungal infections is a priority. Since the host immune system plays a critical role in controlling fungal infection, as evidenced by their increased prevalence in patients with underlying immunological dysfunction, one strategy is to utilize immunotherapies to boost the weakened immunity of these high-risk individuals. Indeed, various clinical trials have demonstrated that therapies aimed at restoring the innate immune responses of immunocompromised patients, such as the administration of granulocyte colony-stimulating factors (G-CSF), the administration of granulocyte-macrophage colony-stimulating factors (GM-CSF), or granulocyte transfusion to improve neutrophil numbers in neutropenic patients, can prevent or improve outcomes of fungal infection. Here, we show that synthetic peptides that can interfere with Dok3–Card9 binding can enhance the neutrophil effector functions necessary for fungal clearance from the host. Such immunomodulatory modality can be used as an adjunctive therapy to antifungal drugs, thereby reducing the use of fungicides in clinics to slow down the evolution of fungi resistance.
While this study provides a proof of concept that disrupting the Dok3–Card9 interaction can enhance the antifungal effector functions of neutrophils, future work needs to be carried out to optimize peptide design to facilitate advancement into the clinics. Firstly, even though we showed that Peptide 1 or Peptide 2, when used alone, could boost antifungal immune responses in neutrophils in the presence of fungal ligands, they failed to demonstrate an additive or synergistic effect when added together. According to our in silico model, it is likely that Peptide 1 and Peptide 2 interact with each other since they are located on opposite sides within the coiled-coil domain of Card9; this could possibly reduce their binding efficacy to Dok3. However, more experiments will be required to address this possibility. In addition, one major limitation of the clinical translation of therapeutic peptides is their short half-life in vivo. To enhance the stability and bioavailability of the synthetic peptides, chemical modification of the peptide N- and C-termini or hydrocarbon stapling could be introduced to minimize proteolytic degradation. Moreover, the incorporation of unnatural amino acids has also been reported to have stabilized the synthetic peptides and prolonged their half-lives [
24,
25]. On the other hand, the binding affinity of the synthetic peptides can be improved via in silico screening to identify hotspots for the Dok3–Card9 interaction. Finally, it will be necessary to conduct preclinical testing of the optimized synthetic peptides in murine models of invasive fungal infections to ascertain their efficacy and safety profile in vivo.