Expression of Toll-like Receptor Genes and Antiviral Cytokines in Macrophage-like Cells in Response to Indole-3-carboxylic Acid Derivative
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design
2.2. RNA Isolation
2.3. Reverse Transcription (Rt) Reaction
2.4. Real-Time PCR
2.5. Gene Expression Level Calculations
3. Results
3.1. Determination of Cytotoxicity of the XXV Compound
3.2. Effect of the XXV on TLR Gene Expression
3.3. Effect of the XXV Compound on the Interferon Gene Expression
3.4. Effect of the XXV on the Expression of Immunoregulatory Cytokine Genes
3.5. Effect of the XXV on the Expression of Interferon Receptor Genes and Signalling Molecules Involved in Immune Signal Transmission
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Available online: https://www.who.int/ru/emergencies/disease-outbreak-news (accessed on 28 August 2024).
- Available online: https://www.vedomosti.ru/society/news/2024/08/14/1055829-voz-obyavila-epidemiyu (accessed on 14 August 2024). (In Russian).
- Lvov, D.K. (Ed.) Handbook of Virology. Viruses and Viral Infections of Humans and Animals; Publishing House “Medical Information Agency”: Moscow, Russian, 2013; 656p, ISBN 978-5-9986-0145-3. (In Russian) [Google Scholar]
- Brubaker, S.W.; Bonham, K.S.; Zanoni, I.; Kagan, J.C. Innate immune pattern recognition: A cell biological perspective. Annu. Rev. Immunol. 2015, 33, 257–290. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Huang, H.; Zhan, Q.; Ding, H.; Li, Y. Toll-like receptors in health and disease. MedComm 2024, 5, e549. [Google Scholar] [CrossRef] [PubMed]
- Khoo, J.J.; Forster, S.; Mansell, A. Toll-like receptors as interferon regulated genes and their role in disease. J. Interferon Cytokine Res. 2011, 31, 13–25. [Google Scholar] [CrossRef] [PubMed]
- Aluri, J.; Cooper, M.A.; Schuettpelz, L.G. Toll-Like Receptor Signaling in the Establishment and Function of the Immune System. Cells 2021, 10, 1374. [Google Scholar] [CrossRef]
- Fitzgerald, K.A.; Kagan, J.C. Toll-like Receptors and the Control of Immunity. Cell 2020, 180, 1044–1066. [Google Scholar] [CrossRef]
- Zhang, H.; Kang, L.; Yao, H.; He, Y.; Wang, X.; Xu, W.; Song, Z.; Yin, Y.; Zhang, X. Streptococcus pneumoniae Endopeptidase O (PepO) Elicits a Strong Innate Immune Response in Mice via TLR2 and TLR4 Signaling Pathways. Front. Cell. Infect. Microbiol. 2016, 6, 23. [Google Scholar] [CrossRef]
- Agier, J.; Żelechowska, P.; Kozłowska, E.; Brzezińska-Błaszczyk, E. Expression of surface and intracellular Toll-like receptors by mature mast cells. Cent. Eur. J. Immunol. 2016, 41, 333–338. [Google Scholar] [CrossRef]
- Chen, Y.; Lin, J.; Zhao, Y.; Ma, X.; Yi, H. Toll-like receptor 3 (TLR3) regulation mechanisms and roles in antiviral innate immune responses. J. Zhejiang Univ. Sci. B 2021, 22, 609–632. [Google Scholar] [CrossRef]
- Zhang, Z.; Ohto, U.; Shibata, T.; Krayukhina, E.; Taoka, M.; Yamauchi, Y.; Tanji, H.; Isobe, T.; Uchiyama, S.; Miyake, K.; et al. Structural Analysis Reveals that Toll-like Receptor 7 Is a Dual Receptor for Guanosine and Single-Stranded RNA. Immunity 2016, 45, 737–748. [Google Scholar] [CrossRef]
- Patamawenu, A.A.; Wright, N.E.; Shofner, T.; Evans, S.; Manion, M.M.; Doria-Rose, N.; Migueles, S.A.; Mendoza, D.; Peterson, B.; Wilhelm, C.; et al. Toll-like receptor 7-adapter complex modulates interferon-α production in HIV-stimulated plasmacytoid dendritic cells. PLoS ONE 2019, 14, e0225806. [Google Scholar] [CrossRef]
- Greulich, W.; Wagner, M.; Gaidt, M.M.; Stafford, C.; Cheng, Y.; Linder, A.; Carell, T.; Hornung, V.; Greulich, W.; Wagner, M.; et al. TLR8 Is a Sensor of RNase T2 Degradation Products. Cell 2019, 179, 1264–1275.e13. [Google Scholar] [CrossRef] [PubMed]
- Hochrein, H.; Schlatter, B.; O’Keeffe, M.; Wagner, C.; Schmitz, F.; Schiemann, M.; Bauer, S.; Suter, M.; Wagner, H. Herpes simplex virus type-1 induces IFN-alpha production via Toll-like receptor 9-dependent and -independent pathways. Proc. Natl. Acad. Sci. USA 2004, 101, 11416–11421. [Google Scholar] [CrossRef] [PubMed]
- Filimonova, M.V.; Tsyshkova, N.G.; Narovlyansky, A.N.; Marinchenko, V.P.; Koval, L.S.; Parfenova, T.M.; Izmestieva, A.V.; Ershov, F.I. Indole-3-Carboxylic Acid Derivatives with Antiviral Activity. Patent RU 2552422 C2, 10 June 2015. (In Russian). [Google Scholar]
- Narovlyansky, A.N.; Filimonova, M.V.; Tsyshkova, N.G.; Pronin, A.V.; Grebennikova, T.V.; Karamov, E.V.; Larichev, V.F.; Kornilaeva, G.V.; Fedyakina, I.T.; Dolzhikova, I.V.; et al. Indole-3-Carboxylic Acid Derivative with Antiviral Activity Against SARS-CoV-2. Application No. 2022133152/04(072130), 16 December 2022. (In Russian). [Google Scholar]
- Narovlyansky, A.N.; Filimonova, M.V.; Tsyshkova, N.G.; Pronin, A.V.; Grebennikova, T.V.; Karamov, E.V.; Larichev, V.F.; Kornilayeva, G.V.; Fedyakina, I.T.; Dolzhikova, I.V.; et al. In Vitro Antiviral Activity of a New Indol-3-carboxylic Acid Derivative Against SARS-CoV-2. Acta Naturae 2023, 15, 83–91. [Google Scholar] [CrossRef] [PubMed]
- Sokolova, T.M.; Poloskov, V.V.; Burova, O.S.; Shuvalov, A.N.; Sokolova, Z.A.; Inshakov, A.N.; Shishkin, Y.V.; Ershov, F.I. The effect of interferons and interferon inducers on the expression of TLR/RLR receptor genes and differentiation of tumor cell lines THP-1 and HCT-116. Russ. J. Biother. 2016, 15, 28–33. (In Russian) [Google Scholar] [CrossRef]
- Sokolova, T.M.; Poloskov, V.V.; Shuvalov, A.N.; Burova, O.S.; Sokolova, Z.A. Signaling TLR/RLR mechanisms of immunomodulatory action of the drugs Ingavirin and Thymogen. Russ. J. Biother. 2019, 18, 60–66. (In Russian) [Google Scholar] [CrossRef]
- Sokolova, T.M.; Shuvalov, A.N.; Poloskov, V.V.; Ershov, F.I. Stimulation of signal transduction genes by Ridostin, Cycloferon and Ingavirin. Cytokines Inflamm. 2015, 14, 26–34. (In Russian) [Google Scholar]
- Sokolova, T.M.; Poloskov, V.V. Effect of Kagocel® on the expression of Toll-like receptor genes of the innate immune system in human THP-1 monocytes with different levels of differentiation. BIOpreparations. Prev. Diagn. Treat. 2021, 21, 116–121. (In Russian) [Google Scholar] [CrossRef]
- Tsuchiya, S.; Yamabe, M.; Yamaguchi, Y.; Kobayashi, Y.; Konno, T.; Tada, K. Establishment and characterization of a human acute monocytic leukemia cell line (THP-1). Int. J. Cancer 1980, 26, 171–176. [Google Scholar] [CrossRef]
- Human Monocytes with Reduced NLRP3 Activity. Available online: https://www.invivogen.com/sites/default/files/invivogen/products/files/thp1_defnlrp3_tds.pdf (accessed on 29 August 2024).
- Mosmann, T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J. Immunol. Methods 1983, 65, 55–63. [Google Scholar] [CrossRef]
- Khabriev, R.U. (Ed.) Manual on Experimental (Preclinical) Study of New Pharmacological Substances; Meditsina: Moscow, Russia, 2005; 832p. (In Russian) [Google Scholar]
- Zhao, X.; Wang, J.; Yaojie, Y.; Zhang, M.; Zhao, W.; Zhang, H.; Zhao, L. Interferon-stimulated gene 15 promotes progression of endometrial carcinoma and weakens antitumor immune response. Oncol. Rep. 2022, 47, 110. [Google Scholar] [CrossRef]
- ISG15 Gene-ISG15 Ubiquitin Like Modifier. Gene Cards. The Human Gene Database. Updated: 6 August 2024. Available online: https://www.genecards.org/cgi-bin/carddisp.pl?gene=ISG15#summaries (accessed on 24 October 2024).
- Wikipedia-ISG15. Available online: https://en.wikipedia.org/wiki/ISG15 (accessed on 24 October 2024).
- Interleukin 1 Receptor Associated Kinase 3. Gene Cards. The Human Gene Database. Updated: 6 August 2024. Available online: https://www.genecards.org/cgi-bin/carddisp.pl?gene=IRAK3 (accessed on 24 October 2024).
- Maeß, M.B.; Wittig, B.; Cignarella, A.; Lorkowsk, S. Reduced PMA enhances the responsiveness of transfected THP-1 macrophages to polarizing stimuli. J. Immunol. Methods 2014, 402, 76–81. [Google Scholar] [CrossRef] [PubMed]
- Lund, M.E.; To, J.; O’Brien, B.A.; Donnelly, S. The choice of phorbol 12-myristate 13-acetate differentiation protocol influences the response of THP-1 macrophages to a pro-inflammatory stimulus. J. Immunol. Methods 2016, 430, 64–70. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, T.H.; Turek, I.; Meehan-Andrews, T.; Zacharias, A.; Irving, H. Analysis of interleukin-1 receptor associated kinase-3 (IRAK3) function in modulating expression of inflammatory markers in cell culture models: A systematic review and meta-analysis. PLoS ONE 2020, 15, e0244570. [Google Scholar] [CrossRef] [PubMed]
- Poloskov, V.V.; Sokolova, Z.A.; Burova, O.S.; Shuvalov, A.N.; Sokolova, T.M. The effect of mitogens on the differentiation of THP-1 cells and the expression of TLR/RLR genes. Cytokines Inflamm. 2016, 15, 161–165. (In Russian) [Google Scholar]
- Medzhitov, R.; Janeway, C. Innate immunity. N. Engl. J. Med. 2000, 343, 338–344. [Google Scholar] [CrossRef]
- Medzhitov, R.; Preston-Hurlburt, P.; Janeway, C. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 1997, 388, 394–397. [Google Scholar] [CrossRef]
- Hussein, W.M.; Liu, T.-Y.; Skwarczynski, M.; Toth, I. Toll-like receptor agonists: A patent review (2011–2013). Expert Opin. Ther. Pat. 2014, 24, 453–470. [Google Scholar] [CrossRef]
- Everson, R.G.; Hugo, W.; Sun, L.; Antonios, J.; Lee, A.; Ding, L.; Bu, M.; Khattab, S.; Chavez, C.; Billingslea-Yoon, E.; et al. TLR agonists polarize interferon responses in conjunction with dendritic cell vaccination in malignant glioma: A randomized phase II Trial. Nat. Commun. 2024, 15, 3882. [Google Scholar] [CrossRef]
- Su, L.; Wang, Y.; Wang, J.; Mifune, Y.; Morin, M.D.; Jones, B.T.; Moresco, E.M.Y.; Boger, D.L.; Beutler, B.; Zhang, H. Structural basis of TLR2/TLR1 activation by the synthetic agonist Diprovocim. J. Med. Chem. 2019, 62, 2938–2949. [Google Scholar] [CrossRef]


| Gene Name | Sequence | Source |
|---|---|---|
| TLR2 | F:ATCCTCCAATCAGGCTTCTCT R:GGACAGGTCAAGGCTTTTTACA | NM_003264.5 |
| TLR3 | F:TTGCCTTGTATCTACTTTTGGGG R:TCAACACTGTTATGTTTGTGGGT | NM_003265.3 |
| TLR4 | F:AGACCTGTCCCTGAACCCTAT R:CGATGGACTTCTAAACCAGCCA | NM_138557.3 |
| TLR7 | F: TCCTTGGGGCTAGATGGTTTC R: TCCACGATCACATGGTTCTTTG | NM_016562.4 |
| TLR8 | F: ATGTTCCTTCAGTCGTCAATGC R: TTGCTGCACTCTGCAATAACT | NM_138636.5 |
| TLR9 | F: AATCCCTCATATCCCTGTCCC R: GTTGCCGTCCATGAATAGGAAG | NM_017442.4 |
| IFNA1 | F: GCCTCGCCCTTTGCTTTACT R: CTGTGGGTCTCAGGGAGATCA | NM_024013.3 |
| IFNA2 | F: GCTTGGGATGAGACCCTCCTA R: CCCACCCCCTGTATCACAC | NM_000605.4 |
| IFNB1 | F:GCTTGGATTCCTACAAAGAAGCA R: ATAGATGGTCAATGCGGCGTC | NM_002176.4 |
| IFNE | F:GGCCTCTACCACTATCTTCTCTC R:ACACTGCTGAATTGACAAGGTTT | NM_176891.5 |
| IFNK | F: GTGGCTTGAGATCCTTATGGGT R: CAGATTTTGCCAGGTGACTCTT | NM_020124.3 |
| IFNW1 | F:GAAGGCCCATGTCATGTCTGT R:GAGTTGGTCTAGGAGGGTCAT | NM_002177.3 |
| IFNG | F: TCGGTAACTGACTTGAATGTCCA R: TCGCTTCCCTGTTTTAGCTGC | NM_000619.3 |
| IFNλ1(IL29) | F:CACATTGGCAGGTTCAAATCTCT R:CCAGCGGACTCCTTTTTGG | NM_172140.2 |
| IFNλ3(IL29B) | F: TAAGAGGGCCAAAGATGCCTT R: CTGGTCCAAGACATCCCCC | NM_172139.4 |
| TNF-α | F:ATGATGGCTTATTACAGTGGCAA R:GTCGGAGATTCGTAGCTGGA | NM_000576.3 |
| IL-6 | F:ACTCACCTCTTCAGAACGAATTG R:CCATCTTTGGAAGGTTCAGGTTG | NM_000600.5 |
| IL12A | F: CCTTGCACTTCTGAAGAGATTGA R: ACAGGGCCATCATAAAAGAGGT | NM_000882.4 |
| IL12B | F: ACCCTGACCATCCAAGTCAAA R:TTGGCCTCGCATCTTAGAAAG | NM_002187.3 |
| IFNAR1 | F: ATTTACACCATTTCGCAAAGCTC R: TCCAAAGCCCACATAACACTATC | NM_000629.3 |
| IFNAR2 | F: TCATGGTGTATATCAGCCTCGT R: AGTTGGTACAATGGAGTGGTTTT | NM_207585.3 |
| Jak1 | F: CCACTACCGGATGAGGTTCTA R: GGGTCTCGAATAGGAGCCAG | NM_002227.4 |
| ISG15 | F: GCGCAGATCACCCAGAAGAT R: GTTCGTCGCATTTGTCCACC | [27] |
| IRAK3 | F:TGCGGGATCTCCTTAGAGAA R:GCAGAGAAATTCCGAGGGCA | NM_007199.3 |
| 18S PHK | F GTAACCCGTTGAACCCCATT R CCATCCAATCGGTAGTAGGCG | NR_003286 |
| Gene Name | Fold Increase in the Stimulation of Gene Expression Levels | |||
|---|---|---|---|---|
| Drug Concentration | 6.25 μg/mL (10.8 µM) | 12.5 μg/mL (21.6 µM) | ||
| Exposure Time | 4 h | 24 h | 4 h | 24 h |
| TLR2 | 93.67 | 0.1 | 1.42 | 0.6 |
| TLR3 | 16,312.25 | N/A | 205.5 | 0.3 |
| TLR4 | 406.02 | 0.1 | 6.59 | 1 |
| TLR7 | 33.39 | 0.2 | 0.3 | 0.6 |
| TLR8 | 78.17 | 0.2 | 1.44 | 0.8 |
| TLR9 | 5.55 | 0.09 | 0.2 | 3.4 |
| Gene Name | Fold Increase in the Stimulation of Gene Expression Levels | |||
|---|---|---|---|---|
| Drug Concentration | 6.25 μg/mL | 12.5 μg/mL | ||
| Exposure Time | 4 h | 24 h | 4 h | 24 h |
| IFNA1 | 2.09 | 1.24 | 10.73 | 0.71 |
| IFNA2 | 1.18 | 1.06 | 0.1 | 8.8 |
| IFNB1 | 3.18 | N/A | 2.66 | 2.0 |
| IFNE | N/A | N/A | 1 | N/A |
| IFNK | 0.37 | 2.59 | 12.03 | 11.59 |
| IFNW1 | 2.0 | N/A | 0.16 | 1.27 |
| IFNG | 1.87 | N/A | N/A | N/A |
| IFNλ1 | N/A | N/A | 2.7 | N/A |
| IFNλ3 | 0.23 | 0.57 | 0.44 | 2.17 |
| Gene Name | Fold Increase in the Stimulation of Gene Expression Levels | |||
|---|---|---|---|---|
| Drug Concentration | 6.25 μg/mL | 12.5 μg/mL | ||
| Exposure Time | 4 h | 24 h | 4 h | 24 h |
| TNFA | 1.8 | N/A | 4.4 | N/A |
| IL6 | 213.85 | N/A | 28.7 | N/A |
| IL12A | 45.39 | 0.07 | 19.8 | 0.08 |
| IL12B | N/A | 321.76 | N/A | 3.37 |
| Gene Name | Fold Increase in the Stimulation of Gene Expression Levels | |||
|---|---|---|---|---|
| Drug Concentration | 6.25 μg/mL | 12.5 μg/mL | ||
| Exposure Time | 4 h | 24 h | 4 h | 24 h |
| IFNAR1 | 46.24 | 0.12 | 7.53 | 0.37 |
| IFNAR2 | 7.0 | N/A | 2.14 | N/A |
| JAK1 | 10.73 | 0.44 | 3.93 | 0.45 |
| ISG15 | 14.39 | 1.18 | 3.97 | 1.46 |
| IRAK3 | 47.93 | 0.18 | 13.67 | 0.47 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Narovlyansky, A.; Pronin, A.; Poloskov, V.; Sanin, A.; Mezentseva, M.; Fedyakina, I.; Suetina, I.; Zubashev, I.; Ershov, F.; Filimonova, M.; et al. Expression of Toll-like Receptor Genes and Antiviral Cytokines in Macrophage-like Cells in Response to Indole-3-carboxylic Acid Derivative. Viruses 2024, 16, 1718. https://doi.org/10.3390/v16111718
Narovlyansky A, Pronin A, Poloskov V, Sanin A, Mezentseva M, Fedyakina I, Suetina I, Zubashev I, Ershov F, Filimonova M, et al. Expression of Toll-like Receptor Genes and Antiviral Cytokines in Macrophage-like Cells in Response to Indole-3-carboxylic Acid Derivative. Viruses. 2024; 16(11):1718. https://doi.org/10.3390/v16111718
Chicago/Turabian StyleNarovlyansky, Alexander, Alexander Pronin, Vladislav Poloskov, Alexander Sanin, Marina Mezentseva, Irina Fedyakina, Irina Suetina, Igor Zubashev, Felix Ershov, Marina Filimonova, and et al. 2024. "Expression of Toll-like Receptor Genes and Antiviral Cytokines in Macrophage-like Cells in Response to Indole-3-carboxylic Acid Derivative" Viruses 16, no. 11: 1718. https://doi.org/10.3390/v16111718
APA StyleNarovlyansky, A., Pronin, A., Poloskov, V., Sanin, A., Mezentseva, M., Fedyakina, I., Suetina, I., Zubashev, I., Ershov, F., Filimonova, M., Surinova, V., Volkova, I., & Bogdanov, E. (2024). Expression of Toll-like Receptor Genes and Antiviral Cytokines in Macrophage-like Cells in Response to Indole-3-carboxylic Acid Derivative. Viruses, 16(11), 1718. https://doi.org/10.3390/v16111718

