Development, Evaluation, and Clinical Application of PRRSV-2 Vaccine-like Real-Time RT-PCR Assays
Abstract
:1. Introduction
2. Materials and Methods
2.1. Primers and Probes
2.2. Nucleic Acid Extraction
2.3. Commercial PRRSV Screening PCR
2.4. Singleplex PRRSV-2 Vaccine-like PCRs
2.5. PRRSV-2 IngelvacMLV/Fostera/Prevacent/XIPC 4-Plex PCR
2.6. Analytical Specificity
2.7. Analytical Sensitivity
2.8. In Vitro Transcribed RNA
2.9. Limit of Detection of Singleplex and IngelvacMLV/Fostera/Prevacent/XIPC 4-Plex Vaccine-like PCRs
2.10. Repeatability of Singleplex and 4-Plex Vaccine-like PCRs
2.11. Clinical Samples and Diagnostic Performances of Singleplex and 4-Plex Vaccine-like PCRs
2.12. Performance of 4-Plex PCR on Samples Containing a Mixture of Vaccine Virus and a Wild-Type PRRSV Isolate
2.13. Sequencing to Confirm Virus Identity
3. Results
3.1. Analytical Specificity of the Singleplex and 4-Plex Vaccine-like PCRs
3.2. Analytical Sensitivity of the Singleplex and 4-Plex Vaccine-like PCRs
3.3. Limit of Detection of the Singleplex and 4-Plex Vaccine-like PCRs Using Respective Vaccine IVT RNA
3.4. Repeatability of Singleplex and 4-Plex Vaccine-like PCRs
3.5. Diagnostic Performance of the Singleplex and 4-Plex Vaccine-like PCRs on Clinical Samples
3.6. Performance of the 4-Plex PCR Determined with Manual Mixture of Vaccine Virus and a Wild-Type PRRSV Isolate
3.7. Performance of the Singleplex and 4-Plex Vaccine-like PCRs on PRRSV-2 Isolates Representing Different Genetic Lineages and Sublineages
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Brinton, M.A.; Gulyaeva, A.A.; Balasuriya, U.B.R.; Dunowska, M.; Faaberg, K.S.; Goldberg, T.; Leung, F.C.C.; Nauwynck, H.J.; Snijder, E.J.; Stadejek, T.; et al. ICTV Virus Taxonomy Profile: Arteriviridae 2021. J. Gen. Virol. 2021, 102, 001632. [Google Scholar] [CrossRef] [PubMed]
- Lunney, J.K.; Fang, Y.; Ladinig, A.; Chen, N.; Li, Y.; Rowland, B.; Renukaradhya, G.J. Porcine Reproductive and Respiratory Syndrome Virus (PRRSV): Pathogenesis and Interaction with the Immune System. Annu. Rev. Anim. Biosci. 2016, 4, 129–154. [Google Scholar] [CrossRef] [PubMed]
- Fang, Y.; Treffers, E.E.; Li, Y.; Tas, A.; Sun, Z.; van der Meer, Y.; de Ru, A.H.; van Veelen, P.A.; Atkins, J.F.; Snijder, E.J.; et al. Efficient -2 frameshifting by mammalian ribosomes to synthesize an additional arterivirus protein. Proc. Natl. Acad. Sci. USA 2012, 109, E2920–E2928. [Google Scholar] [CrossRef]
- Zimmerman, J.; Dee, S.; Holtkamp, D.J.; Murtaugh, M.; Stadejek, T.; Stevenson, G.; Torremorell, M.; Yang, H.; Zhang, J. Porcine Reproductive and Respiratory Syndrome Viruses (Porcine Arteriviruses). In Diseases of Swine, 11th ed.; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2019; pp. 685–708. [Google Scholar]
- Holtkamp, D.J.; Kliebenstein, J.B.; Neumann, E.J.; Zimmerman, J.; Rotto, H.; Yoder, T.; Wang, C.; Yeske, P.; Mowrer, C.; Haley, C. Assessment of the economic impact of porcine reproductive and respiratory syndrome virus on United States pork producers. J. Swine Health Prod. 2013, 21, 72–84. [Google Scholar]
- Corzo, C.A.; Mondaca, E.; Wayne, S.; Torremorell, M.; Dee, S.; Davies, P.; Morrison, R.B. Control and elimination of porcine reproductive and respiratory syndrome virus. Virus Res. 2010, 154, 185–192. [Google Scholar] [CrossRef]
- Chae, C. Commercial PRRS Modified-Live Virus Vaccines. Vaccines 2021, 9, 185. [Google Scholar] [CrossRef]
- Charerntantanakul, W. Porcine reproductive and respiratory syndrome virus vaccines: Immunogenicity, efficacy and safety aspects. World J. Virol. 2012, 1, 23–30. [Google Scholar] [CrossRef]
- Renukaradhya, G.J.; Meng, X.J.; Calvert, J.G.; Roof, M.; Lager, K.M. Live porcine reproductive and respiratory syndrome virus vaccines: Current status and future direction. Vaccine 2015, 33, 4069–4080. [Google Scholar] [CrossRef]
- Hu, J.; Zhang, C. Porcine reproductive and respiratory syndrome virus vaccines: Current status and strategies to a universal vaccine. Transbound. Emerg. Dis. 2014, 61, 109–120. [Google Scholar] [CrossRef]
- Linhares, D.C.L.; Cano, J.P.; Wetzell, T.; Nerem, J.; Torremorell, M.; Dee, S.A. Effect of modified-live porcine reproductive and respiratory syndrome virus (PRRSv) vaccine on the shedding of wild-type virus from an infected population of growing pigs. Vaccine 2012, 30, 407–413. [Google Scholar] [CrossRef]
- Zhang, J.; Zheng, Y.; Xia, X.Q.; Chen, Q.; Bade, S.A.; Yoon, K.J.; Harmon, K.M.; Gauger, P.C.; Main, R.G.; Li, G. High-throughput whole genome sequencing of Porcine reproductive and respiratory syndrome virus from cell culture materials and clinical specimens using next-generation sequencing technology. J. Vet. Diagn. Invest. 2017, 29, 41–50. [Google Scholar] [CrossRef]
- Rawal, G.; Yim-Im, W.; Chamba, F.; Smith, C.; Okones, J.; Francisco, C.; Zhang, J. Development and validation of a reverse transcription real-time PCR assay for specific detection of PRRSGard vaccine-like virus. Transbound. Emerg. Dis. 2022, 69, 1212–1226. [Google Scholar] [CrossRef]
- Zhang, J.; Rossow, K.; Otterson, T.; Murtaugh, M.P. Differential diagnosis of PRRS infection and vaccination by one-step real-time RT-PCR. In Proceedings of the Meeting of American Association of Swine Veterinarians, Dallas, TX, USA, 1–4 March 2014; pp. 29–31. [Google Scholar]
- Wang, Y.; Yim-Im, W.; Porter, E.; Lu, N.; Anderson, J.; Noll, L.; Fang, Y.; Zhang, J.; Bai, J. Development of a bead-based assay for detection and differentiation of field strains and four vaccine strains of type 2 porcine reproductive and respiratory syndrome virus (PRRSV-2) in the USA. Transbound. Emerg. Dis. 2021, 68, 1414–1423. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.H.; Rawal, G.; Aljets, E.; Yim-Im, W.; Yang, Y.L.; Huang, Y.W.; Krueger, K.; Gauger, P.; Main, R.; Zhang, J. Development and clinical applications of a 5-plex real-time RT-PCR for swine enteric coronaviruses. Viruses 2022, 14, 1536. [Google Scholar] [CrossRef] [PubMed]
- Yim-im, W.; Huang, H.; Zheng, Y.; Li, G.; Rawal, G.; Gauger, P.; Krueger, K.; Main, R.; Zhang, J. Characterization of PRRSV in clinical samples and the corresponding cell culture isolates. Transbound. Emerg. Dis. 2022, 69, e3045–e3059. [Google Scholar] [CrossRef]
- Yim-im, W.; Anderson, T.K.; Paploski, I.; VanderWaal, K.; Gauger, P.; Kreuger, K.; Shi, M.; Main, R.; Zhang, J. Refining PRRSV-2 genetic classification based on global ORF5 sequences and investigation of their geographic distributions and temporal changes. Microbiol. Spectr. 2023, e0291623. [Google Scholar] [CrossRef] [PubMed]
- Martin, D.P.; Varsani, A.; Roumagnac, P.; Botha, G.; Maslamoney, S.; Schwab, T.; Kelz, Z.; Kumar, V.; Murrell, B. RDP5: A computer program for analyzing recombination in, and removing signals of recombination from, nucleotide sequence datasets. Virus Evol. 2021, 7, veaa087. [Google Scholar] [CrossRef] [PubMed]
- Lole, K.S.; Bollinger, R.C.; Paranjape, R.S.; Gadkari, D.; Kulkarni, S.S.; Novak, N.G.; Ingersoll, R.; Sheppard, H.W.; Ray, S.C. Full-length human immunodeficiency virus type 1 genomes from subtype C-infected seroconverters in India, with evidence of intersubtype recombination. J. Virol. 1999, 73, 152–160. [Google Scholar] [CrossRef]
- Wang, A.; Chen, Q.; Wang, L.; Madson, D.; Harmon, K.; Gauger, P.; Zhang, J.; Li, G. Recombination between vaccine and field strains of porcine reproductive and respiratory syndrome virus. Emerg. Infect. Dis. 2019, 25, 2335–2337. [Google Scholar] [CrossRef]
- Espy, M.J.; Uhl, J.R.; Sloan, L.M.; Buckwalter, S.P.; Jones, M.F.; Vetter, E.A.; Yao, J.D.; Wengenack, N.L.; Rosenblatt, J.E.; Cockerill, F.R., 3rd; et al. Real-time PCR in clinical microbiology: Applications for routine laboratory testing. Clin. Microbiol. Rev. 2006, 19, 165–256. [Google Scholar] [CrossRef]
- Gunson, R.N.; Collins, T.C.; Carman, W.F. Practical experience of high throughput real time PCR in the routine diagnostic virology setting. J. Clin. Virol. 2006, 35, 355–367. [Google Scholar] [CrossRef] [PubMed]
- Wernike, K.; Hoffmann, B.; Dauber, M.; Lange, E.; Schirrmeier, H.; Beer, M. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR. PLoS ONE 2012, 7, e38251. [Google Scholar] [CrossRef]
- Shi, K.-C.; Xu, X.-T.; Hu, J.; Su, Y.-Q.; Lu, W.-J.; Chen, H.-Z. Establishment and application of a multiple RT-PCR assay for differential detection of classical, highly pathogenic and vaccine strains of North American genotype PRRSV. China Anim. Husbandry Vet. Med. 2017, 44, 879–887. [Google Scholar]
- Yang, K.; Tian, Y.; Zhou, D.; Duan, Z.; Guo, R.; Liu, Z.; Yuan, F.; Liu, W. A Multiplex RT-PCR assay to detect and discriminate porcine reproductive and respiratory syndrome viruses in clinical specimens. Viruses 2017, 9, 205. [Google Scholar] [CrossRef] [PubMed]
- Eclercy, J.; Renson, P.; Hirchaud, E.; Andraud, M.; Beven, V.; Paboeuf, F.; Rose, N.; Blanchard, Y.; Bourry, O. Phenotypic and Genetic Evolutions of a Porcine Reproductive and Respiratory Syndrome Modified Live Vaccine after Limited Passages in Pigs. Vaccines 2021, 9, 392. [Google Scholar] [CrossRef]
- Nielsen, H.S.; Oleksiewicz, M.B.; Forsberg, R.; Stadejek, T.; Botner, A.; Storgaard, T. Reversion of a live porcine reproductive and respiratory syndrome virus vaccine investigated by parallel mutations. J. Gen. Virol. 2001, 82 Pt 6, 1263–1272. [Google Scholar] [CrossRef]
- Nilubol, D.; Tripipat, T.; Hoonsuwan, T.; Tipsombatboon, P.; Piriyapongsa, J. Dynamics and evolution of porcine reproductive and respiratory syndrome virus (PRRSV) ORF5 following modified live PRRSV vaccination in a PRRSV-infected herd. Arch. Virol. 2014, 159, 17–27. [Google Scholar] [CrossRef]
- Zhang, Z.; Zhou, L.; Ge, X.; Guo, X.; Han, J.; Yang, H. Evolutionary analysis of six isolates of porcine reproductive and respiratory syndrome virus from a single pig farm: MLV-evolved and recombinant viruses. Infect. Genet. Evol. 2018, 66, 111–119. [Google Scholar] [CrossRef]
- Kvisgaard, L.K.; Kristensen, C.S.; Ryt-Hansen, P.; Pedersen, K.; Stadejek, T.; Trebbien, R.; Andresen, L.O.; Larsen, L.E. A recombination between two Type 1 Porcine Reproductive and Respiratory Syndrome Virus (PRRSV-1) vaccine strains has caused severe outbreaks in Danish pigs. Transbound. Emerg. Dis. 2020, 67, 1786–1796. [Google Scholar] [CrossRef]
- Kristensen, C.S.; Christiansen, M.G.; Pedersen, K.; Larsen, L.E. Production losses five months after outbreak with a recombinant of two PRRSV vaccine strains in 13 Danish sow herds. Porc. Health Manag. 2020, 6, 26. [Google Scholar] [CrossRef]
- Bian, T.; Sun, Y.; Hao, M.; Zhou, L.; Ge, X.; Guo, X.; Han, J.; Yang, H. A recombinant type 2 porcine reproductive and respiratory syndrome virus between NADC30-like and a MLV-like: Genetic characterization and pathogenicity for piglets. Infect. Genet. Evol. 2017, 54, 279–286. [Google Scholar] [CrossRef]
- Cui, X.Y.; Xia, D.S.; Huang, X.Y.; Tian, X.X.; Wang, T.; Yang, Y.B.; Wang, G.; Wang, H.W.; Sun, Y.; Xiao, Y.H.; et al. Recombinant characteristics, pathogenicity, and viral shedding of a novel PRRSV variant derived from twice inter-lineage recombination. Vet. Microbiol. 2022, 271, 109476. [Google Scholar] [CrossRef]
- Eclercy, J.; Renson, P.; Lebret, A.; Hirchaud, E.; Normand, V.; Andraud, M.; Paboeuf, F.; Blanchard, Y.; Rose, N.; Bourry, O. A field recombinant strain derived from two type 1 porcine reproductive and respiratory syndrome virus (PRRSV-1) modified live vaccines shows increased viremia and transmission in SPF pigs. Viruses 2019, 11, 296. [Google Scholar] [CrossRef]
- Li, B.; Fang, L.; Xu, Z.; Liu, S.; Gao, J.; Jiang, Y.; Chen, H.; Xiao, S. Recombination in vaccine and circulating strains of porcine reproductive and respiratory syndrome viruses. Emerg. Infect. Dis. 2009, 15, 2032–2035. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Zhou, X.; Zhai, J.; Wei, C.; Dai, A.; Yang, X.; Luo, M. Recombination in JXA1-R vaccine and NADC30-like strain of porcine reproductive and respiratory syndrome viruses. Vet. Microbiol. 2017, 204, 110–120. [Google Scholar] [CrossRef] [PubMed]
- Wenhui, L.; Zhongyan, W.; Guanqun, Z.; Zhili, L.; Jingyun, M.; Qingmei, X.; Baoli, S.; Yingzuo, B. Complete genome sequence of a novel variant porcine reproductive and respiratory syndrome virus (PRRSV) strain: Evidence for recombination between vaccine and wild-type PRRSV strains. J. Virol. 2012, 86, 9543. [Google Scholar] [CrossRef]
- Zhou, L.; Kang, R.; Yu, J.; Xie, B.; Chen, C.; Li, X.; Xie, J.; Ye, Y.; Xiao, L.; Zhang, J.; et al. Genetic characterization and pathogenicity of a novel recombined porcine reproductive and respiratory syndrome virus 2 among NADC30-like, Jxa1-like, and MLV-like strains. Viruses 2018, 10, 551. [Google Scholar] [CrossRef]
- Zhou, L.; Kang, R.; Zhang, Y.; Yu, J.; Xie, B.; Chen, C.; Li, X.; Chen, B.; Liang, L.; Zhu, J.; et al. Emergence of two novel recombinant porcine reproductive and respiratory syndrome viruses 2 (lineage 3) in Southwestern China. Vet. Microbiol. 2019, 232, 30–41. [Google Scholar] [CrossRef] [PubMed]
- Pamornchainavakul, N.; Kikuti, M.; Paploski, I.A.D.; Makau, D.N.; Rovira, A.; Corzo, C.A.; VanderWaal, K. Measuring how recombination re-shapes the evolutionary history of PRRSV-2: A genome-based phylodynamic analysis of the emergence of a novel PRRSV-2 variant. Front. Vet. Sci. 2022, 9, 846904. [Google Scholar] [CrossRef]
Assay | Primer/Probe Name | Sequence (5′-3′) | Target Region | Amplicon Size | Reference |
---|---|---|---|---|---|
Singleplex Ingelvac PRRS MLV PCR | |||||
Assay 1 | IngelvacMLV-RTF | AGCTAACAAATTTGATTGGGCAGT | ORF5 | 178 bp | [14] |
IngelvacMLV-RTR | ACAGACCGCGTAGATGCTACTTAG | ORF5 | |||
IngelvacMLV-RTP | FAM/CTTTAGTCA/ZEN/CTGTGTCTACCGCCGGGTTTG/3IABkFQ | ORF5 | |||
Assay 2 | IngelvacMLV_F2 | TGGCGCCGGCTCTTTT | nsp2 | 86 bp | This study |
IngelvacMLV_R2 | GCTTTTCTTTTTACCGTCCGAAA | nsp2 | |||
IngelMLV_Prb2ABY | ABY/CGATTTGCCGCCTTCAGATGGC/QSY | nsp2 | |||
Singleplex Ingelvac PRRS ATP PCR | |||||
Assay 1 | IngelvacATP-RTF | CAACTTGACGCTATGTGAGCTGAAT | ORF5 | 130 bp | [14] |
IngelvacATP-RTR | ATGGCTAGTGGTGAGTGCACTATAT | ORF5 | |||
IngelvacATP-RTP | VIC/ATTGGCTGA/ZEN/AAGACAAATTTGATTGGGCATTGGAGACTTT/3IABkFQ | ORF5 | |||
Assay 2 | IngelvaATP_F1 | CCACCACAGTCGCTCAC | nsp2 | 94 bp | [15] |
IngelvacATP_R1 | CCTGAGATGCACAGCCTTATCA | nsp2 | |||
IngelvacATP_Prb1 | FAM/TCGTGAAATCCAGCAAGCCAA/MGB | nsp2 | |||
Singleplex Fostera PRRS PCR | |||||
FostFor2a-RTF | GACACAAATTTCAGCAGGTGGAA | nsp2 | 103 bp | This study | |
FostRev2a-RTR | TCATATTCAGTCTGTGAGGATGCA | nsp2 | |||
FostPrb-RTP_VIC | VIC/CAGCAGCGCCGATG/MGB | nsp2 | |||
Singleplex Prevacent PRRS PCR | |||||
Prevacent-RTF | GAAGGTTAAGTCTAGTTGTGGTGATCTG | nsp2 | 112 bp | This study | |
Prevacent-RTR | CACCGGCTCAGGTAAGATCTG | nsp2 | |||
Prevacent-RTP | FAM/TTTGGCTGGTGGCTC/MGB | nsp2 | |||
Singleplex Prime Pac PRRS PCR | |||||
PrimePAC-RTF2 | GCTCAACCGAGAAAAWTGAACAG | nsp2 | 81 bp | This study | |
PrimePAC-RTR2 | GCGGCAAATTGGTAAACGTT | nsp2 | |||
PrimePAC-RTP2 | FAM/CCAGCACACAGGCGT/MGB | nsp2 | |||
Singleplex PRRSGard PCR | |||||
PRRSGard-F | CGGGCCCTGTCATTGAAC | ORF1b/2 | 65 bp | [13] | |
PRRSGard-R | CATTGGCGCGCTATTTAAATTA | ORF1b/2 | |||
PRRSGard-Prb | FAM/CTTTAGGCCTGAATTGATTAA/MGB | ORF1b/2 | |||
IngelvacMLV/Fostera/Prevacent/XIPC 4-plex PCR | |||||
IngelvacMLV_F2 | TGGCGCCGGCTCTTTT | nsp2 | 86 bp | This study | |
IngelvacMLV_R2 | GCTTTTCTTTTTACCGTCCGAAA | nsp2 | |||
IngelMLV_Prb2ABY | ABY/CGATTTGCCGCCTTCAGATGGC/QSY | nsp2 | |||
FostFor2a-RTF | GACACAAATTTCAGCAGGTGGAA | nsp2 | 103 bp | This study | |
FostRev2a-RTR | TCATATTCAGTCTGTGAGGATGCA | nsp2 | |||
FostPrb-RTP_VIC | VIC/CAGCAGCGCCGATG/MGB | nsp2 | |||
Prevacent-RTF | GAAGGTTAAGTCTAGTTGTGGTGATCTG | nsp2 | 112 bp | This study | |
Prevacent-RTR | CACCGGCTCAGGTAAGATCTG | nsp2 | |||
Prevacent-RTP | FAM/TTTGGCTGGTGGCTC/MGB | nsp2 |
Pathogens | Singleplex PCR CT | IngelvacMLV /Fostera /Prevacent/XIPC 4-Plex PCR CT | Reference PRRSV Screening PCR CT | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
Ingelvac MLV Assay 1 | Ingelvac MLV Assay 2 | Ingelvac ATP Assay 1 | Ingelvac ATP Assay 2 | Fostera | Prevacent | Prime Pac | PRRS Gard | PRRSV-2 | PRRSV-1 | ||
Ingelvac PRRS MLV vaccine | 22.7 | 20.5 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | 21.2/≥40/≥40/22.5 | 20.4 | ≥40 |
Ingelvac PRRS ATP vaccine | ≥40 | ≥40 | 21.5 | 22.3 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.3 | 19.4 | ≥40 |
Fostera PRRS vaccine | ≥40 | ≥40 | 36.9 | ≥40 | 20.4 | ≥40 | ≥40 | ≥40 | ≥40/21.6/≥40/22.4 | 18.2 | ≥40 |
Prevacent PRRS vaccine | 32.1 | ≥40 | ≥40 | ≥40 | ≥40 | 15.7 | ≥40 | ≥40 | ≥40/≥40/16.9/22.4 | 16.5 | ≥40 |
Prime Pac PRRS vaccine | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | 24.1 | ≥40 | ≥40/≥40/≥40/22.3 | 22.7 | ≥40 |
PRRSGard vaccine | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | 15.2 | 15.1 | ≥40/≥40/≥40/22.4 | 13.6 | ≥40 |
PRRSV-1_Lelystad | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.5 | ≥40 | 12.6 |
Non-PRRSV swine viruses † | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.3–22.5 | ≥40 | ≥40 |
Bacteria ‡ | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.3–22.5 | ≥40 | ≥40 |
PCR | Vaccine Virus and Replicate | Serial Dilutions of MLV Vaccine Virus and PCR CT Value | ||||||
---|---|---|---|---|---|---|---|---|
10−1 | 10−2 | 10−3 | 10−4 | 10−5 | 10−6 | 10−7 | ||
Reference PRRSV screening PCR | Ingelvac MLV Rep 1 | 22.7 | 26.5 | 30.4 | 34.0 | 35.6 | ≥40 | ≥40 |
Ingelvac MLV Rep 2 | 22.5 | 26.4 | 30.5 | 33.9 | 35.6 | ≥40 | ≥40 | |
Ingelvac MLV Rep 3 | 22.3 | 26.6 | 30.4 | 33.9 | 35.4 | ≥40 | ≥40 | |
Ingelvac MLV singleplex PCR Assay 2 (ABY) | Ingelvac MLV Rep 1 | 24.3 | 27.9 | 31.1 | 34.4 | ≥40 | ≥40 | ≥40 |
Ingelvac MLV Rep 2 | 24.4 | 28.0 | 31.5 | 35.5 | 36.5 | ≥40 | ≥40 | |
Ingelvac MLV Rep 3 | 24.3 | 27.8 | 31.3 | 34.6 | 36.2 | ≥40 | ≥40 | |
IngelvacMLV/Fostera/Prevacent/XIPC 4-plex PCR | Ingelvac MLV Rep 1 | 24.8 | 28.7 | 33.3 | 36.4 | ≥40 | ≥40 | ≥40 |
Ingelvac MLV Rep 2 | 24.4 | 28.9 | 32.7 | 34.9 | ≥40 | ≥40 | ≥40 | |
Ingelvac MLV Rep 3 | 24.5 | 28.7 | 32.6 | 34.7 | ≥40 | ≥40 | ≥40 | |
Reference PRRSV screening PCR | IngelvacATP Rep 1 | 22.9 | 25.7 | 29.0 | 33.0 | 36.2 | ≥40 | ≥40 |
IngelvacATP Rep 2 | 22.6 | 25.6 | 29.0 | 32.7 | 36.6 | ≥40 | ≥40 | |
IngelvacATP Rep 3 | 22.8 | 25.7 | 29.2 | 32.7 | 36.5 | ≥40 | ≥40 | |
Ingelvac ATP singleplex PCR Assay 2 (FAM) | Ingelvac ATP Rep 1 | 23.0 | 26.6 | 30.2 | 33.8 | ≥40 | ≥40 | ≥40 |
Ingelvac ATP Rep 2 | 23.0 | 26.6 | 30.0 | 33.7 | 36.9 | ≥40 | ≥40 | |
Ingelvac ATP Rep 3 | 23.0 | 26.7 | 30.1 | 33.9 | ≥40 | ≥40 | ≥40 | |
Reference PRRSV screening PCR | Fostera Rep 1 | 20.7 | 23.2 | 27.4 | 31.2 | 36.0 | ≥40 | ≥40 |
Fostera Rep 2 | 20.6 | 23.3 | 27.4 | 31.3 | 36.2 | ≥40 | ≥40 | |
Fostera Rep 3 | 20.7 | 23.3 | 27.7 | 31.4 | 36.1 | ≥40 | ≥40 | |
Fostera singleplex PCR (VIC) | Fostera Rep 1 | 23.1 | 26.4 | 29.8 | 32.7 | 35.6 | 39.3 | ≥40 |
Fostera Rep 2 | 23.2 | 26.5 | 29.9 | 32.8 | 35.7 | 37.9 | ≥40 | |
Fostera Rep 3 | 23.2 | 26.6 | 30.0 | 32.8 | 35.4 | 39.3 | ≥40 | |
IngelvacMLV/Fostera/Prevacent/XIPC 4-plex PCR | Fostera Rep 1 | 21.1 | 24.3 | 29.9 | 33.0 | 36.5 | ≥40 | ≥40 |
Fostera Rep 2 | 21.1 | 24.4 | 29.0 | 33.3 | 36.3 | ≥40 | ≥40 | |
Fostera Rep 3 | 21.1 | 24.4 | 29.1 | 33.2 | 36.6 | ≥40 | ≥40 | |
Reference PRRSV screening PCR | Prevacent Rep 1 | 19.4 | 23.2 | 28.7 | 30.2 | 33.1 | 36.5 | ≥40 |
Prevacent Rep 2 | 19.3 | 23.1 | 28.6 | 30.2 | 33.0 | 36.0 | ≥40 | |
Prevacent Rep 3 | 19.3 | 23.1 | 28.6 | 30.2 | 34.0 | 36.8 | ≥40 | |
Prevacent singleplex PCR (FAM) | Prevacent Rep 1 | 19.8 | 22.9 | 26.4 | 30.1 | 34.0 | ≥40 | ≥40 |
Prevacent Rep 2 | 20.0 | 23.0 | 26.4 | 30.1 | 33.5 | ≥40 | ≥40 | |
Prevacent Rep 3 | 19.9 | 22.9 | 26.4 | 30.0 | 33.6 | ≥40 | ≥40 | |
IngelvacMLV/Fostera/Prevacent/XIPC 4-plex PCR | Prevacent Rep 1 | 20.3 | 23.7 | 26.5 | 30.8 | 34.0 | ≥40 | ≥40 |
Prevacent Rep 2 | 20.2 | 23.7 | 26.6 | 30.9 | 35.6 | ≥40 | ≥40 | |
Prevacent Rep 3 | 20.2 | 23.9 | 26.4 | 30.7 | 35.9 | ≥40 | ≥40 | |
Reference PRRSV screening PCR | Prime Pac Rep 1 | 25.0 | 26.2 | 29.7 | 33.4 | 38.8 | ≥40 | ≥40 |
Prime Pac Rep 2 | 24.9 | 26.5 | 29.7 | 33.4 | 38.8 | ≥40 | ≥40 | |
Prime Pac Rep 3 | 24.9 | 26.2 | 29.7 | 33.4 | 38.8 | ≥40 | ≥40 | |
Prime Pac singleplex PCR (FAM) | Prime Pac Rep 1 | 25.0 | 28.1 | 31.6 | 36.0 | ≥40 | ≥40 | ≥40 |
Prime Pac Rep 2 | 25.0 | 28.1 | 31.8 | 34.2 | 37.0 | ≥40 | ≥40 | |
Prime Pac Rep 3 | 25.0 | 28.2 | 31.8 | 35.0 | ≥40 | ≥40 | ≥40 |
Genomic Copies per Reaction | Singleplex Vaccine-like PCR | IngelvacMLV/Fostera/Prevacent/XIPC 4-Plex PCR | ||
---|---|---|---|---|
Ingelvac MLV partial nsp2 IVT RNA | % (No. of Pos for Ingelvac MLV) | Mean CT range | % (No. of Pos for Ingelvac MLV) | Mean CT (range) |
5 × 104 | 100% (3/3) | 29.7 (28.6–30.9) | 100% (3/3) | 29.9 (29.6–30.6) |
5 × 103 | 100% (3/3) | 33.5 (32.3–35.0) | 100% (3/3) | 34.1 (33.1–35.5) |
5 × 102 | 100% (3/3) | 35.9 (34.9–36.9) | 100% (3/3) | 36.7 (35.5–37.0) |
5 × 101 | 100% (20/20) | 37.8 (36.1–39.0) | 100% (20/20) | 38.3 (37.4–39.0) |
25 | 80% (16/20) | 38.4 (36.7–40) | 60% (12/20) | 39.1 (38.6–40) |
12.5 | 35% (7/20) | 39.4 (37.6–40) | 20% (4/20) | 39.8 (39.8–40) |
6.25 | 10% (2/20) | 39.9 (38.8–40) | 0% (0/20) | 40 (40) |
Ingelvac ATP partial nsp2 IVT RNA | % (No. of Pos for Ingelvac ATP) | Mean CT range | ||
5 × 104 | 100% (3/3) | 23.8 (23.7–24.0) | ||
5 × 103 | 100% (3/3) | 27.1 (27.0–27.2) | ||
5 × 102 | 100% (3/3) | 30.7 (30.5–30.9) | ||
5 × 101 | 100% (20/20) | 35.2 (32.8–38.3) | ||
25 | 85% (17/20) | 36.3 (33.9–40) | ||
12.5 | 65% (13/20) | 37.8 (35.0–40) | ||
6.25 | 40% (8/20) | 38.7 (34.4–40) | ||
Fostera partial nsp2 IVT RNA | % (No. of Pos for Fostera) | Mean CT range | % (No. of Pos for Fostera) | Mean CT (range) |
5 × 104 | 100% (3/3) | 25.6 (25.3–25.8) | 100% (3/3) | 25.8 (25.3–26.1) |
5 × 103 | 100% (3/3) | 28.7 (28.8–28.9) | 100% (3/3) | 29.0 (28.9–29.10) |
5 × 102 | 100% (3/3) | 32.1 (32.0–32.2) | 100% (3/3) | 32.2 (31.2–32.8) |
5 × 101 | 95% (19/20) | 36.8 (35.1–40) | 95% (19/20) | 37.1 (36.9–40) |
25 | 80% (16/20) | 38.5 (36.4–40) | 65% (13/20) | 38.7 (38.2–40) |
12.5 | 55% (11/20) | 39.1 (37.3–40) | 40% (8/20) | 39.9 (39.8–40) |
6.25 | 25% (5/20) | 39.6 (35.8–40) | 0% (0/20) | 40 (40) |
Prevacent partial nsp2 IVT RNA | % (No. of Pos for Prevacent) | Mean CT range | % (No. of Pos for Prevacent) | Mean CT (range) |
5 × 104 | 100% (3/3) | 26.5 (26.1–27.01) | 100% (3/3) | 26.9 (26.5–27.6) |
5 × 103 | 100% (3/3) | 30.1 (29.8–30.5) | 100% (3/3) | 30.1 (29.8–30.5) |
5 × 102 | 100% (3/3) | 33.9 (33.8–34.1) | 100% (3/3) | 34.0 (33.6–34.4) |
5 × 101 | 100% (20/20) | 35.0 (33.8–36.8) | 100% (20/20) | 35.7 (35.1–36.9) |
25 | 100% (20/20) | 36.2 (35.1–38.4) | 100% (20/20) | 37.9 (37.8–38.0) |
12.5 | 80% (16/20) | 36.8 (35.1–40) | 75% (15/20) | 38.8 (38.5–39.0) |
6.25 | 60% (12/20) | 37.9 (35.6–40) | 50% (10/20) | 38.9 (38.8–40) |
Prime Pac partial nsp2 IVT RNA | % (No. of Pos for Prime Pac) | Mean CT range | ||
5 × 104 | 100% (3/3) | 25.9 (25.8–26.2) | ||
5 × 103 | 100% (3/3) | 29.3 (29.2–29.5) | ||
5 × 102 | 100% (3/3) | 32.6 (32.2–33.2) | ||
5 × 101 | 95% (19/20) | 36.6 (34.4–40) | ||
25 | 60% (12/20) | 38.1 (35.7–40) | ||
12.5 | 20% (4/20) | 39.4 (37.0–40) | ||
6.25 | 25% (5/20) | 39.2 (35.5–40) |
Target | IVT RNA (Genomic Copies/Reactions) | Respective Singleplex Vaccine-like PCR | IngelvacMLV/Fostera/Prevacent/XIPC 4-Plex PCR | ||||||
---|---|---|---|---|---|---|---|---|---|
Intra-Assay (3 Replicates for Each Dilution) | Inter-Assay (3 Plates for Each Dilution) | Intra-assay (3 Replicates for Each Dilution) | Inter-Assay (3 Plates for Each Dilution) | ||||||
Mean CT value ± SD | CV, % | Mean CT value ± SD | CV, % | Mean CT value ± SD | CV, % | Mean CT value ± SD | CV, % | ||
Ingelvac PRRS MLV nsp2 | 5 × 104 | 29.70 ± 0.49 | 1.65 | 29.72 ± 0.03 | 0.09 | 29.76 ± 0.74 | 2.48 | 29.95 ± 0.40 | 1.33 |
5 × 103 | 33.35 ± 0.37 | 1.10 | 33.20 ± 0.34 | 1.02 | 34.14 ± 0.35 | 1.02 | 33.95 ± 0.29 | 0.85 | |
5 × 102 | 35.91 ± 0.48 | 1.33 | 35.52 ± 0.33 | 0.93 | 36.75 ± 0.49 | 1.35 | 36.16 ± 0.70 | 1.95 | |
5 × 101 | 37.85 ± 0.31 | 0.82 | 37.68 ± 0.38 | 1.01 | 38.30 ± 0.18 | 0.47 | 38.33 ± 0.41 | 1.08 | |
Average CV, % | 1.22 | Average CV, % | 0.76 | Average CV, % | 1.33 | Average CV, % | 1.30 | ||
Ingelvac PRRS ATP nsp2 | 5 × 104 | 23.21 ± 0.32 | 1.38 | 23.51 ± 0.51 | 2.17 | ||||
5 × 103 | 26.96 ± 0.35 | 1.31 | 27.07 ± 0.23 | 0.86 | |||||
5 × 102 | 30.57 ± 0.50 | 1.64 | 31.17 ± 0.66 | 2.10 | |||||
5 × 101 | 36.28 ± 0.52 | 1.43 | 36.25 ± 0.46 | 1.27 | |||||
Average CV, % | 1.44 | Average CV, % | 1.60 | ||||||
Fostera PRRS nsp2 | 5 × 104 | 25.31 ± 0.17 | 0.68 | 25.76 ± 0.20 | 0.78 | 25.82 ± 0.33 | 1.29 | 25.86 ± 0.25 | 0.97 |
5 × 103 | 28.44 ± 0.18 | 0.64 | 28.47 ± 0.34 | 1.18 | 28.63 ± 0.41 | 1.45 | 28.66 ± 0.31 | 1.07 | |
5 × 102 | 32.22 ± 0.04 | 0.12 | 32.60 ± 0.31 | 0.95 | 32.57 ± 0.28 | 0.87 | 32.74 ± 0.39 | 1.18 | |
5 × 101 | 37.26 ± 0.40 | 1.07 | 37.50 ± 0.34 | 0.92 | 37.91 ± 0.22 | 0.58 | 38.03 ± 0.46 | 1.22 | |
Average CV, % | 0.63 | Average CV, % | 0.96 | Average CV, % | 1.05 | Average CV, % | 1.11 | ||
Prevacent PRRS nsp2 | 5 × 104 | 26.52 ± 0.13 | 0.49 | 26.39 ± 0.12 | 0.45 | 27.18 ± 0.27 | 1.00 | 27.49 ± 0.41 | 1.50 |
5 × 103 | 28.94 ± 0.45 | 1.57 | 28.57 ± 0.09 | 0.33 | 29.57 ± 0.12 | 0.42 | 29.66 ± 0.05 | 0.18 | |
5 × 102 | 31.67 ± 0.30 | 0.94 | 31.79 ± 0.24 | 0.74 | 32.98 ± 0.48 | 1.45 | 33.95 ± 0.19 | 0.55 | |
5 × 101 | 35.02 ± 0.27 | 0.78 | 35.09 ± 0.52 | 1.48 | 35.95 ± 0.82 | 2.27 | 36.03 ± 0.18 | 0.51 | |
Average CV, % | 0.95 | Average CV, % | 0.75 | Average CV, % | 1.29 | Average CV, % | 0.68 | ||
Prime Pac PRRS nsp2 | 5 × 104 | 25.51 ± 0.07 | 0.26 | 25.71 ± 0.10 | 0.38 | ||||
5 × 103 | 29.64 ± 0.11 | 0.38 | 29.52 ± 0.45 | 1.52 | |||||
5 × 102 | 32.80 ± 0.23 | 0.70 | 32.55 ± 0.36 | 1.12 | |||||
5 × 101 | 36.89 ± 0.63 | 1.70 | 36.72 ± 0.32 | 0.88 | |||||
Average CV, % | 0.76 | Average CV, % | 0.98 |
Reference PRRSV Screening PCR | ||||
---|---|---|---|---|
Pos | Neg | Total | ||
Ingelvac MLV singleplex PCR Assay 2 | Pos | 65 | 0 | 65 |
Neg | 1 | 114 | 115 | |
Total | 66 | 114 | 180 a | |
Sensitivity 98.48%; specificity 100%; agreement 99.44% | ||||
Ingelvac ATP singleplex PCR Assay 2 | Pos | 63 | 0 | 63 |
Neg | 1 | 107 | 108 | |
Total | 64 | 107 | 171 b | |
Sensitivity 98.44%; specificity 100%; agreement 99.42% | ||||
Fostera singleplex PCR | Pos | 75 | 0 | 75 |
Neg | 4 | 101 | 105 | |
Total | 79 | 101 | 180 c | |
Sensitivity 94.94%; specificity 100%; agreement 97.78% | ||||
Prevacent singleplex PCR | Pos | 73 | 0 | 73 |
Neg | 0 | 107 | 107 | |
Total | 73 | 107 | 180 d | |
Sensitivity 100%; specificity 100%; agreement 100% | ||||
Prime Pac singleplex PCR | Pos | 71 | 0 | 71 |
Neg | 4 | 105 | 109 | |
Total | 75 | 105 | 180 e | |
Sensitivity 94.67%; specificity 100%; agreement 97.78% | ||||
4-plex PCR—Ingelvac MLV | Pos | 65 | 0 | 65 |
Neg | 1 | 114 | 115 | |
Total | 66 | 114 | 180 a | |
Sensitivity 98.48%; specificity 100%; agreement 99.44% | ||||
4-plex PCR—Fostera | Pos | 75 | 0 | 75 |
Neg | 4 | 101 | 105 | |
Total | 79 | 101 | 180 c | |
Sensitivity 94.94%; specificity 100%; agreement 97.78% | ||||
4-plex PCR—Prevacent | Pos | 73 | 0 | 73 |
Neg | 0 | 107 | 107 | |
Total | 73 | 107 | 180 d | |
Sensitivity 100%; specificity 100%; agreement 100% |
Sample ID | Specimen | Reference PRRSV Screening PCR CT | Singleplex Vaccine-like PCR CT Value | 4-Plex PCR CT Value | ||||||
---|---|---|---|---|---|---|---|---|---|---|
Ingelvac MLV | Ingelvac ATP | Fostera | Prevacent | Prime Pac | Ingelvac MLV | Fostera | Prevacent | |||
Sample_#1 | Serum | 36.4 | ≥37 | ND | ND | ND | ND | ≥37 | ≥37 | ≥37 |
Sample_#2 | Serum | 34.9 | ND | ≥37 | ND | ND | ND | ND | ND | ND |
Sample_#3 | Serum | 35.8 | ND | ND | ≥37 | ND | ND | ≥37 | ≥37 | ≥37 |
Sample_#4 | Serum | 36.2 | ND | ND | ≥37 | ND | ND | ≥37 | ≥37 | ≥37 |
Sample_#5 | Serum | 35.7 | ND | ND | ≥37 | ND | ND | ≥37 | ≥37 | ≥37 |
Sample_#6 | Serum | 36.0 | ND | ND | ≥37 | ND | ND | ≥37 | ≥37 | ≥37 |
Sample_#7 | Serum | 36.9 | ND | ND | ND | ND | ≥37 | ND | ND | ND |
Sample_#8 | Serum | 36.2 | ND | ND | ND | ND | ≥37 | ND | ND | ND |
Sample_#9 | Serum | 35.0 | ND | ND | ND | ND | ≥37 | ND | ND | ND |
Sample_#10 | Serum | 35.6 | ND | ND | ND | ND | ≥37 | ND | ND | ND |
Manual Mix of Viruses | Concentration Ratio | Ingelvac MLV(ABY)/Fostera(VIC)/Prevacent(FAM)/XIPC(Cy5) 4-Plex PCR CT | Reference PRRSV Screening PCR † PRRSV-2 CT |
---|---|---|---|
Wild-type PRRSV isolate stock * | N/A | ≥40/≥40/≥40/29.2 | 16.1 |
Ingelvac PRRS MLV vaccine virus | N/A | 21.6/≥40/≥40/29.4 | 18.1 |
Fostera PRRS vaccine virus | N/A | ≥40/20.9/≥40/29.8 | 16.6 |
Prevacent PRRS vaccine virus | N/A | ≥40/≥40/15.0/29.2 | 15.1 |
Mix_1 (Ingelvac MLV + wild-type) | 1:1 | 22.4/≥40/≥40/29.5 | 16.8 |
Mix_2 (Ingelvac MLV + wild-type) | 10−1:1 | 26.3/≥40/≥40/29.7 | 17.2 |
Mix_3 (Ingelvac MLV + wild-type) | 10−2:1 | 29.7/≥40/≥40/30.1 | 17.6 |
Mix_4 (Ingelvac MLV + wild-type) | 10−3:1 | 32.6/≥40/≥40/29.9 | 17.7 |
Mix_5 (Ingelvac MLV + wild-type) | 10−4:1 | 36.3/≥40/≥40/30.2 | 17.9 |
Mix_6 (Ingelvac MLV + wild-type) | 10−5:1 | ≥40/≥40/≥40/29.5 | 17.6 |
Mix_7 (Ingelvac MLV + wild-type) | 10−6:1 | ≥40/≥40/≥40/29.8 | 17.6 |
Mix_8 (Ingelvac MLV + wild-type) | 10−7:1 | ≥40/≥40/≥40/29.8 | 17.8 |
Mix_9 (Fostera + wild-type) | 1:1 | ≥40/21.8/≥40/30.0 | 16.3 |
Mix_10 (Fostera + wild-type) | 10−1:1 | ≥40/25.2/≥40/30.6 | 17.1 |
Mix_11 (Fostera + wild-type) | 10−2:1 | ≥40/27.9/≥40/29.3 | 17.2 |
Mix_12 (Fostera + wild-type) | 10−3:1 | ≥40/31.6/≥40/29.6 | 17.3 |
Mix_13 (Fostera + wild-type) | 10−4:1 | ≥40/33.8/≥40/30.0 | 18.0 |
Mix_14 (Fostera + wild-type) | 10−5:1 | ≥40/≥40/≥40/29.5 | 17.6 |
Mix_15 (Fostera + wild-type) | 10−6:1 | ≥40/≥40/≥40/30.0 | 17.6 |
Mix_16 (Fostera + wild-type) | 10−7:1 | ≥40/≥40/≥40/29.9 | 17.5 |
Mix_17 (Prevacent + wild-type) | 1:1 | ≥40/≥40/16.0/30.8 | 15.0 |
Mix_18 (Prevacent + wild-type) | 10−1:1 | ≥40/≥40/19.8/29.3 | 16.8 |
Mix_19 (Prevacent + wild-type) | 10−2:1 | ≥40/≥40/22.9/30.0 | 17.5 |
Mix_20 (Prevacent + wild-type) | 10−3:1 | ≥40/≥40/26.5/29.3 | 17.3 |
Mix_21 (Prevacent + wild-type) | 10−4:1 | ≥40/≥40/29.7/30.2 | 17.3 |
Mix_22 (Prevacent + wild-type) | 10−5:1 | ≥40/≥40/34.4/30.1 | 18.0 |
Mix_23 (Prevacent + wild-type) | 10−6:1 | ≥40/≥40/37.0/30.6 | 18.2 |
Mix_24 (Prevacent + wild-type) | 10−7:1 | ≥40/≥40/≥40/29.6 | 17.4 |
Series No. | PRRSV-2 Isolates | ORF5-Based Lineage | ORF5-Based RFLP Typing | ORF5 nt Identity (%) to Ingelvac MLV | ORF5 nt Identity (%) to Ingelvac ATP | ORF5 nt Identity (%) to Fostera | ORF5 nt Identity (%) to Prevacent | ORF5 nt Identity (%) to Prime Pac | ORF5 nt Identity (%) to PRRSGard |
---|---|---|---|---|---|---|---|---|---|
#1 | USA/IA/79622-4/2019 | L1A | 1-6-2 | 88.9 | 87.6 | 88.9 | 89.4 | 88.6 | 88.9 |
#2 | USA/IN/65239GA/2014 | L1A | 1-7-4 | 87.7 | 86.4 | 86.4 | 88.9 | 87.9 | 90.4 |
#3 | USA/IA/14671GA/2016 | L1A | 1-4-4 | 88.6 | 88.1 | 88.1 | 89.9 | 88.7 | 90.7 |
#4 | USA/IA/23143-7/2017 | L1B | 1-18-2 | 84.4 | 85.1 | 84.4 | 84.9 | 83.9 | 86.9 |
#5 | Mexico/49783GB/2019 | L1B | 1-26-2 | 84.9 | 84.9 | 84.9 | 85.4 | 84.7 | 86.4 |
#6 | USA/IN/12110GA/2019 | L1C | 1-3-4 | 85.7 | 85.4 | 86.1 | 87.9 | 85.9 | 86.1 |
#7 | USA/IA/79039-3/2019 | L1C | 1-18-4 | 83.1 | 83.7 | 84.4 | 86.9 | 83.7 | 86.9 |
#8 | USA/NE/05828-3/2020 | L1C.1 | 1-4-4 | 85.1 | 84.4 | 84.9 | 87.2 | 85.4 | 88.6 |
#9 | USA/MN/01775GA/2021 | L1C.5 | 1-4-4 | 86.4 | 85.9 | 86.7 | 89.4 | 86.9 | 88.7 |
#10 * | USA/IA/104589-1/2021 | L1D | 1-8-4 | 86.6 | 85.4 | 86.2 | 99.3 | 86.7 | 89.7 |
#11 * | USA/IA/90715-5/2021 | L1D | 1-12-4 | 86.1 | 84.1 | 85.4 | 98.2 | 86.2 | 88.1 |
#12 * | USA/IN/04584GF/2022 | L1D | 1-8-4 | 86.1 | 84.2 | 85.4 | 96.7 | 86.7 | 87.6 |
#13 * | USA/IL/01810A/2012 | L1D | 1-12-4 | 87.2 | 85.4 | 86.7 | 94.5 | 87.9 | 88.4 |
#14 * | USA/AZ/74959GA/2020 | L1E | 1-3-2 | 86.2 | 84.9 | 87.7 | 85.6 | 86.1 | 84.6 |
#15 | USA/KY/71761/2015 | L1E | 1-22-2 | 86.2 | 86.1 | 86.7 | 86.1 | 86.1 | 86.4 |
#16 * | USA/IL/17142GA/2022 | L1F | 1-8-4 | 86.2 | 86.2 | 86.7 | 89.7 | 86.7 | 100.0 |
#17 * | USA/MN184 | L1F | 1-8-4 | 86.6 | 86.6 | 87.1 | 90.0 | 87.1 | 99.7 |
#18 | USA/MO/56050-3/2018 | L1F | 1-8-4 | 86.1 | 85.4 | 85.1 | 90.4 | 85.9 | 96.0 |
#19 | USA/IA/36983-3/2014 | L1F | 1-8-4 | 85.6 | 85.6 | 86.1 | 88.4 | 85.2 | 95.5 |
#20 | USA/IA/19170-2/2014 | L1F | 1-12-4 | 85.3 | 85.2 | 85.2 | 88.3 | 85.3 | 94.5 |
#21 | USA/IA/95000GA/2019 | L1H | 1-8-4 | 85.6 | 85.7 | 86.6 | 89.4 | 87.1 | 90.2 |
#22 | USA/81793-6/2019 | L1H | 1-4-4 | 84.7 | 85.6 | 85.4 | 88.4 | 85.9 | 88.4 |
#23 * | USA/IL/22102-2/2018 | L5A | 2-5-2 | 99.5 | 90.2 | 91.4 | 86.7 | 91.7 | 86.2 |
#24 | USA/KS/53881/2020 | L5A | 2-5-2 | 98.8 | 90.0 | 92.0 | 86.6 | 91.9 | 86.4 |
#25 | USA/IN/17168-1/2020 | L5A | 2-1-2 | 98.0 | 89.6 | 91.0 | 86.4 | 91.4 | 86.1 |
#26 * | USA/KY/47082-2/2020 | L5A | 2-6-2 | 97.7 | 89.4 | 91.0 | 86.2 | 91.2 | 86.1 |
#27 * | USA/PA/60596-1/2020 | L5A | 2-1-2 | 96.5 | 88.4 | 89.9 | 85.1 | 90.4 | 84.6 |
#28 * | USA/TN/45339-3/2021 | L5A | 2-5-4 | 94.2 | 88.6 | 89.7 | 84.4 | 89.4 | 84.6 |
#29 | USA/69077-1/2019 | L8A | 1-4-2 | 90.2 | 100.0 | 93.7 | 85.4 | 89.7 | 86.2 |
#30 | USA/IL/101561-52/2022 | L8A | 1-4-2 | 90.9 | 99.0 | 94.5 | 86.1 | 90.7 | 86.9 |
#31 | USA/OK/34563GB/2021 | L8A | 1-4-2 | 90.4 | 98.2 | 93.0 | 85.6 | 89.9 | 86.6 |
#32 * | USA/IN/57008/2013 | L8A | 1-7-4 | 90.4 | 97.7 | 93.0 | 85.6 | 90.9 | 86.2 |
#33 * | USA/IN/26125/2012 | L8A | 1-2-2 | 89.6 | 96.8 | 92.0 | 84.6 | 88.4 | 85.1 |
#34 | USA/SDSU73 | L8B | 1-4-4 | 89.9 | 92.0 | 94.3 | 85.9 | 91.8 | 87.6 |
#35 | USA/IA/24815/2018 | L8C | 1-3-2 | 91.5 | 93.5 | 99.7 | 86.6 | 93.0 | 86.7 |
#36 * | USA/IA/70388B/2018 | L8C | 1-3-2 | 91.2 | 93.4 | 99.5 | 86.8 | 92.9 | 86.6 |
#37 * | USA/IA/93743-1/2020 | L8C | 1-4-1 | 90.9 | 93.5 | 99.0 | 86.2 | 92.5 | 86.7 |
#38 | USA/UT/88120-4/2019 | L8C | 1-4-2 | 91.5 | 92.9 | 98.0 | 87.4 | 93.2 | 86.9 |
#39 | USA/UT/76106-4/2021 | L8C | 1-4-1 | 90.9 | 92.5 | 97.7 | 86.9 | 92.5 | 86.2 |
#40 | USA/UT/64317GA/2021 | L8C | 1-4-2 | 90.9 | 92.2 | 97.2 | 86.7 | 92.4 | 86.7 |
#41 | USA/UT/18316GA/2021 | L8C | 1-1-1 | 89.9 | 91.5 | 96.2 | 85.9 | 91.5 | 85.4 |
#42 * | USA/UT/34926-1/2021 | L8C | 1-3-1 | 89.4 | 90.7 | 95.4 | 85.4 | 91.0 | 85.2 |
#43 | Mexico/22470-1/2019 | L8D | 1-7-3 | 84.1 | 85.9 | 86.9 | 83.3 | 84.7 | 83.6 |
#44 | USA/16572/2017 | L9 | 1-13-2 | 88.6 | 87.7 | 90.9 | 84.6 | 90.5 | 84.2 |
#45 | USA/KY/71236GA/2020 | L9A | 1-2-4 | 86.6 | 88.2 | 90.5 | 85.9 | 89.1 | 83.9 |
Series No. | PRRSV-2 Isolates | Singleplex PCR CT | IngelvacMLV/Fostera/Prevacent/XIPC 4-Plex PCR CT | Reference Screening PCR CT (PRRSV-2) | |||||
---|---|---|---|---|---|---|---|---|---|
Ingelvac MLV Assay 2 | Ingelvac ATP Assay 2 | Fostera | Preva cent | Prime Pac | PRRS Gard | ||||
#1 | USA/IA/79622-4/2019 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.5 | 17.1 |
#2 | USA/IN/65239GA/2014 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.4 | 14.2 |
#3 | USA/IA/14671GA/2016 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.3 | 15.8 |
#4 | USA/IA/23143-7/2017 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.4 | 12.1 |
#5 | Mexico/49783GB/2019 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.4 | 23.1 |
#6 | USA/IN/12110GA/2019 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.4 | 18.5 |
#7 | USA/IA/79039-3/2019 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.3 | 14.0 |
#8 | USA/NE/05828-3/2020 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.4 | 14.6 |
#9 | USA/MN/01775GA/2021 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.4 | 13.7 |
#10 | USA/IA/104589-1/2021 | ≥40 | ≥40 | ≥40 | 10.8 | ≥40 | ≥40 | ≥40/≥40/11.1/22.4 | 11.9 |
#11 | USA/IA/90715-5/2021 | ≥40 | ≥40 | ≥40 | 13.5 | ≥40 | ≥40 | ≥40/≥40/13.5/22.4 | 12.4 |
#12 | USA/IN/04584GF/2022 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.3 | 13.4 |
#13 | USA/IL/01810A/2012 | ≥40 | ≥40 | ≥40 | 24.3 | ≥40 | ≥40 | ≥40/≥40/24.9/22.5 | 20.1 |
#14 | USA/AZ/74959GA/2020 | ≥40 | ≥40 | 20.1 | ≥40 | ≥40 | ≥40 | ≥40/20.6/≥40/22.4 | 20.6 |
#15 | USA/KY/71761/2015 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.5 | 15.0 |
#16 | USA/IL/17142GA/2022 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.4 | 14.0 |
#17 | USA/MN184 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.5 | 13.1 |
#18 | USA/MO/56050-3/2018 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.3 | 17.5 |
#19 | USA/IA/36983-3/2014 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.4 | 15.1 |
#20 | USA/IA/19170-2/2014 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.4 | 27.2 |
#21 | USA/IA/95000GA/2019 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.4 | 21.4 |
#22 | USA/81793-6/2019 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.4 | 20.6 |
#23 | USA/IL/22102-2/2018 | 13.7 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | 15.7/≥40/≥40/22.3 | 13.0 |
#24 | USA/KS/53881/2020 | 16.5 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | 20.1/≥40/≥40/22.3 | 13.8 |
#25 | USA/IN/17168-1/2020 | 18.2 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | 19.6/≥40/≥40/22.5 | 17.1 |
#26 | USA/KY/47082-2/2020 | 21.2 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | 21.5/≥40/≥40/22.3 | 10.3 |
#27 | USA/PA/60596-1/2020 | 25.7 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | 27.0/≥40/≥40/22.4 | 15.8 |
#28 | USA/TN/45339-3/2021 | 13.7 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | 13.9/≥40/≥40/22.4 | 13.2 |
#29 | USA/69077-1/2019 | ≥40 | 14.6 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.5 | 12.3 |
#30 | USA/IL/101561-52/2022 | ≥40 | 14.6 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.5 | 13.2 |
#31 | USA/OK/34563GB/2021 | ≥40 | 18.1 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.4 | 16.2 |
#32 | USA/IN/57008/2013 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.4 | 17.0 |
#33 | USA/IN/26125/2012 | ≥40 | 22.2 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.3 | 11.9 |
#34 | USA/SDSU73 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.4 | 14.0 |
#35 | USA/IA/24815/2018 | ≥40 | ≥40 | 29.4 | ≥40 | ≥40 | ≥40 | ≥40/30.6/≥40/22.4 | 27.1 |
#36 | USA/IA/70388B/2018 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.4 | 13.2 |
#37 | USA/IA/93743-1/2020 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.4 | 14.9 |
#38 | USA/UT/88120-4/2019 | ≥40 | ≥40 | 17.0 | ≥40 | ≥40 | ≥40 | ≥40/17.3/≥40/22.4 | 14.8 |
#39 | USA/UT/76106-4/2021 | ≥40 | ≥40 | 27.1 | ≥40 | ≥40 | ≥40 | ≥40/27.1/≥40/22.3 | 24.1 |
#40 | USA/UT/64317GA/2021 | ≥40 | ≥40 | 15.8 | ≥40 | ≥40 | ≥40 | ≥40/15.4/≥40/22.5 | 12.1 |
#41 | USA/UT/18316GA/2021 | ≥40 | ≥40 | 21.5 | ≥40 | ≥40 | ≥40 | ≥40/21.5/≥40/22.3 | 17.3 |
#42 | USA/UT/34926-1/2021 | ≥40 | ≥40 | 25.7 | ≥40 | ≥40 | ≥40 | ≥40/25.5/≥40/22.3 | 16.9 |
#43 | Mexico/22470-1/2019 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.4 | 15.2 |
#44 | USA/16572/2017 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.4 | 17.6 |
#45 | USA/KY/71236GA/2020 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40 | ≥40/≥40/≥40/22.5 | 23.1 |
Isolate#, Name, and Genome Length | nsp2 Genomic Positions | ORF5 Genomic Positions | Breakpoint Positions and Sequence Characteristics |
---|---|---|---|
#36 USA/IA/70388B/2018 (14,987 nucleotides) | 1316–4510 | 13,372–13,974 | nt 29–6177: wild-type (79.71% nt identity to the Fostera vaccine virus) |
nt 6178–14,987: Fostera vaccine-like (99.64% nt identity to the Fostera vaccine virus) | |||
#37 USA/IA/93743-1/2020 (15,011 nucleotides) | 1340–4534 | 13,396–13,998 | nt 1–4853: wild-type (80.87% nt identity to the Fostera vaccine virus) |
nt 4854–9074: Fostera vaccine-like (99.88% nt identity to the Fostera vaccine virus) | |||
nt 9075–10,541: wild-type (86.77% nt identity to the Fostera vaccine virus) | |||
nt 10,542–15,011: Fostera vaccine-derived (96.36% nt identity to the Fostera vaccine virus) | |||
#14 USA/AZ/74959GA/2020 (15,386 nucleotides) | 1340–4909 | 13,771–14,373 | nt 1–684: wild-type (91.66% nt identity to the Fostera vaccine virus) |
nt 685–12,189: Fostera vaccine-derived (97.34% nt identity to the Fostera vaccine virus) | |||
nt 12,190–15,386: wild-type (90.24% nt identity to the Fostera vaccine virus) | |||
#12 USA/IN/04584GF/2022 (14,970 nucleotides) | 1338–4529 | 13,391–13,993 | nt 1–13,485: wild-type (82.76% nt identity to the Prevacent vaccine virus) |
nt 13,486–14,970: Prevacent vaccine-like (98.18% nt identity to the Prevacent vaccine virus |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rawal, G.; Krueger, K.M.; Yim-im, W.; Li, G.; Gauger, P.C.; Almeida, M.N.; Aljets, E.K.; Zhang, J. Development, Evaluation, and Clinical Application of PRRSV-2 Vaccine-like Real-Time RT-PCR Assays. Viruses 2023, 15, 2240. https://doi.org/10.3390/v15112240
Rawal G, Krueger KM, Yim-im W, Li G, Gauger PC, Almeida MN, Aljets EK, Zhang J. Development, Evaluation, and Clinical Application of PRRSV-2 Vaccine-like Real-Time RT-PCR Assays. Viruses. 2023; 15(11):2240. https://doi.org/10.3390/v15112240
Chicago/Turabian StyleRawal, Gaurav, Karen M. Krueger, Wannarat Yim-im, Ganwu Li, Phillip C. Gauger, Marcelo N. Almeida, Ethan K. Aljets, and Jianqiang Zhang. 2023. "Development, Evaluation, and Clinical Application of PRRSV-2 Vaccine-like Real-Time RT-PCR Assays" Viruses 15, no. 11: 2240. https://doi.org/10.3390/v15112240