Correction: Mase et al. Genetic Analysis of the Complete S1 Gene in Japanese Infectious Bronchitis Virus Strains. Viruses 2022, 14, 716
Error in Table
Reference
- Mase, M.; Hiramatsu, K.; Watanabe, S.; Iseki, H. Genetic Analysis of the Complete S1 Gene in Japanese Infectious Bronchitis Virus Strains. Viruses 2022, 14, 716. [Google Scholar] [CrossRef]
Name | Sequence (5’-3’) | Position a | Length (bp) | Reference | |
---|---|---|---|---|---|
Forward | Reverse | ||||
15F | AGGAATGGTAAGTTRCTRGTWAGAG | 20343–20367 | 671 | Mase et al., 2004 [11] | |
26Rm | GCGCAGTACCRTTRAYAAAATAAGC | 21013–20989 | Mase et al., 2004 [11] | ||
19F | GCAGTGTTTGTTACGCATTG | 20689–20708 | 1333 | in this study | |
1R | CATAACTAACATAAGGGCAA | 22021–22002 | in this study |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mase, M.; Hiramatsu, K.; Watanabe, S.; Iseki, H. Correction: Mase et al. Genetic Analysis of the Complete S1 Gene in Japanese Infectious Bronchitis Virus Strains. Viruses 2022, 14, 716. Viruses 2022, 14, 2098. https://doi.org/10.3390/v14102098
Mase M, Hiramatsu K, Watanabe S, Iseki H. Correction: Mase et al. Genetic Analysis of the Complete S1 Gene in Japanese Infectious Bronchitis Virus Strains. Viruses 2022, 14, 716. Viruses. 2022; 14(10):2098. https://doi.org/10.3390/v14102098
Chicago/Turabian StyleMase, Masaji, Kanae Hiramatsu, Satoko Watanabe, and Hiroshi Iseki. 2022. "Correction: Mase et al. Genetic Analysis of the Complete S1 Gene in Japanese Infectious Bronchitis Virus Strains. Viruses 2022, 14, 716" Viruses 14, no. 10: 2098. https://doi.org/10.3390/v14102098
APA StyleMase, M., Hiramatsu, K., Watanabe, S., & Iseki, H. (2022). Correction: Mase et al. Genetic Analysis of the Complete S1 Gene in Japanese Infectious Bronchitis Virus Strains. Viruses 2022, 14, 716. Viruses, 14(10), 2098. https://doi.org/10.3390/v14102098