Next Article in Journal
Molecular Epidemiology of HIV-1 in Eastern Europe and Russia
Next Article in Special Issue
Phylodynamics of Highly Pathogenic Avian Influenza A(H5N1) Virus Circulating in Indonesian Poultry
Previous Article in Journal
Indirect Protection from Vaccinating Children against Influenza A Virus Infection in Households
Previous Article in Special Issue
Pathogenicity of Avian Polyomaviruses and Prospect of Vaccine Development
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Correction

Correction: Mase et al. Genetic Analysis of the Complete S1 Gene in Japanese Infectious Bronchitis Virus Strains. Viruses 2022, 14, 716

1
National Institute of Animal Health, National Agriculture and Food Research Organization, 3-1-5 Kannondai, Tsukuba 305-0856, Japan
2
United Graduate School of Veterinary Sciences, Gifu University, 1-1 Yanagido, Gifu 501-1193, Japan
3
Graduate School of Life and Environmental Sciences, Osaka Prefecture University, Izumisano 598-8531, Japan
4
Oita Livestock Hygiene Service Center of Oita Prefecture, 442 Onozuru, Oita 870-1153, Japan
*
Author to whom correspondence should be addressed.
Viruses 2022, 14(10), 2098; https://doi.org/10.3390/v14102098
Submission received: 14 September 2022 / Accepted: 20 September 2022 / Published: 22 September 2022
(This article belongs to the Special Issue State-of-the-Art Avian Viruses Research in Asia)

Error in Table

In the original publication [1], there was a mistake in “Table 2. List of RT-PCR primers” as published. The primers in Table 2 are not for infectious bronchitis virus, and the sequence of avian reovirus amplification is mistakenly listed. The corrected Table 2 appears below. The authors state that the scientific conclusions are unaffected. This correction was approved by the Academic Editor. The original publication has also been updated.

Reference

  1. Mase, M.; Hiramatsu, K.; Watanabe, S.; Iseki, H. Genetic Analysis of the Complete S1 Gene in Japanese Infectious Bronchitis Virus Strains. Viruses 2022, 14, 716. [Google Scholar] [CrossRef]
Table 2. List of RT-PCR primers.
Table 2. List of RT-PCR primers.
Name Sequence (5’-3’)Position aLength (bp)Reference
ForwardReverse
15F AGGAATGGTAAGTTRCTRGTWAGAG20343–20367671Mase et al., 2004 [11]
26RmGCGCAGTACCRTTRAYAAAATAAGC21013–20989 Mase et al., 2004 [11]
19F GCAGTGTTTGTTACGCATTG20689–207081333in this study
1RCATAACTAACATAAGGGCAA22021–22002 in this study
a Position is given for the S1 gene of strain Beadette42 (Acc.No.NC001451).
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Mase, M.; Hiramatsu, K.; Watanabe, S.; Iseki, H. Correction: Mase et al. Genetic Analysis of the Complete S1 Gene in Japanese Infectious Bronchitis Virus Strains. Viruses 2022, 14, 716. Viruses 2022, 14, 2098. https://doi.org/10.3390/v14102098

AMA Style

Mase M, Hiramatsu K, Watanabe S, Iseki H. Correction: Mase et al. Genetic Analysis of the Complete S1 Gene in Japanese Infectious Bronchitis Virus Strains. Viruses 2022, 14, 716. Viruses. 2022; 14(10):2098. https://doi.org/10.3390/v14102098

Chicago/Turabian Style

Mase, Masaji, Kanae Hiramatsu, Satoko Watanabe, and Hiroshi Iseki. 2022. "Correction: Mase et al. Genetic Analysis of the Complete S1 Gene in Japanese Infectious Bronchitis Virus Strains. Viruses 2022, 14, 716" Viruses 14, no. 10: 2098. https://doi.org/10.3390/v14102098

APA Style

Mase, M., Hiramatsu, K., Watanabe, S., & Iseki, H. (2022). Correction: Mase et al. Genetic Analysis of the Complete S1 Gene in Japanese Infectious Bronchitis Virus Strains. Viruses 2022, 14, 716. Viruses, 14(10), 2098. https://doi.org/10.3390/v14102098

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop