Abstract
Soil microorganisms play pivotal roles in terrestrial ecological processes. However, how soil microbial biomass and community characteristics respond to changes in land utilization in karst regions remains largely unknown. The present study investigated the impacts of land-use change on soil chemical properties, microbial community structure, and biomass in a karst region of southwest China across four land-use types: shrubland (natural vegetation restoration), plantation forest (managed vegetation restoration), orchards, and croplands. Vegetation restoration increased microbial biomass carbon and microbial biomass nitrogen. Shrubland had the highest bacterial and fungal abundance and fungal diversity; in addition, the soil microbial community structure differed significantly among land-use types. The dominant bacterial phyla were Actinobacteria, Proteobacteria, Acidobacteria, and Chloroflexi, whereas Ascomycota was the predominant fungal phylum, with its abundance declining significantly following vegetation restoration. Soil properties, including soil organic matter and available phosphorus, were strongly associated with microbial community composition and diversity in karst areas. The findings of this study are essential for gaining a deeper understanding of how changes in land-use affect soil properties and microbial dynamics, and provide valuable insights for ecological restoration and agricultural management in karst regions.
1. Introduction
Karst landscapes cover approximately 36% of China’s landmass and are mainly distributed in southwest China. They provide an important role in maintaining ecosystem services by supporting biodiversity and food security, as well as storing carbon [1]. The karst landscape in southwest China is one of the largest and most contiguous karst regions in the world [2]. Owing to natural factors (e.g., rainfall and geological geomorphology) and anthropogenic activities (e.g., logging, grazing, and agriculture), land degradation and rocky desertification are major economic, social, and environmental issues in the karst areas of southwest China [3]. Numerous extensive ecological restoration projects have been undertaken in these regions to combat desertification and thereby improve ecosystem health. The largest of these is the Grain for Green Program, which involves the conversion of marginal land and degraded croplands to forests or grasslands. This land-use change primarily increases vegetation cover and has also led to alterations in soil properties and the soil microbial community. The soil microbial community refers to the populations of viruses, bacteria, actinomycetes, soil algae, and other microorganisms in a given area or volume of soil, shaped by the combined influence of both biotic and abiotic factors. Their composition, population density, and biological activity are closely linked to soil type, vegetation, climate, and other environmental factors. In this study, it specifically refers to the community of bacteria and fungi.
Microorganisms are ubiquitous within the soil, in which they play essential roles in nutrient cycling and terrestrial ecosystem function [4]. Local environmental conditions, including abiotic soil properties and nutrient availability, influence the characteristics and relationships among soil microbial communities [5]. Studies have shown that differences in land-use lead to variations in soil properties, which, in turn, influence the composition and diversity of soil microbial communities in regions such as Australia and the Loess Plateau. Soil microbial diversity refers to the variety of microbial species present in the soil ecosystem, their genetic makeup, and the extent of their interactions with the environment. In this study, it specifically refers to the diversity of bacteria and fungi [6,7]. Similarly, in the karst regions of Guizhou, phospholipid fatty acid (PLFA) analysis has revealed that, compared with farmland, natural regeneration and afforestation significantly increase the abundance of bacteria and fungi, altering the community composition [8]. Soil microbial biomass (which refers to the total amount of microorganisms in the soil with a volume smaller than 5 × 103 μm3 [9], an indicator of microbial activity) plays a critical role in soil nutrient accumulation and transformation [10]. It is highly sensitive to subtle environmental changes and can therefore serve as a key indicator of soil fertility [11], reflecting changes in soil quality and productivity [12]. Previous studies have also confirmed that land-use changes directly affect microbial biomass [13]. Although these studies have already been conducted, due to the high heterogeneity of karst soils, further systematic research is needed to understand how land-use changes influence the soil microbial community structure and biomass in the karst region of southwestern Guangxi. The findings of this study are also of great significance for selecting suitable land-use practices for ecological restoration in karst areas affected by rocky desertification.
In Pingguo City, natural and managed vegetation restoration are two key strategies for preventing desertification [14]. Additionally, to enhance local residents’ income while achieving ecological restoration (vegetation restoration and soil nutrient improvement in areas affected by rocky desertification), pitaya, a high-value economic crop was introduced. After nearly 20 years of the project’s implementation, it remains unclear how the soil properties, soil microbial communities, and microbial biomass respond to vegetation cover and agricultural activities under different land-use types. In light of this, the present study focuses on four land-use types: agricultural land (farmland and orchards), plantations (managed vegetation restoration), and natural shrublands (natural vegetation regeneration after cropland abandonment). The objectives were to explore: (i) the effects of land-use changes on the soil properties, soil microbial community structure, and microbial biomass; (ii) the differences in microbial community characteristics between cropland and restored vegetation areas; and (iii) the key soil properties driving microbial communities in karst regions. We hypothesize that: (i) forested land will have higher soil organic matter and microbial biomass compared with agricultural land; (ii) natural vegetation restoration will result in higher microbial diversity.
2. Materials and Methods
2.1. Site Description
The study was conducted in a rocky desertified area of Longhe Village, Pingguo District, Guangxi Province (23°22′–23°24′ N, 107°22′–107°24′ E). This area is distinguished by peak cluster depressions and characteristic karst peak–valley landforms. Karst mountains account for approximately 91% of the total land surface area at the site. The region has a typical subtropical monsoon climate, with an average annual temperature of approximately 21 °C and an annual rainfall of 1322 mm, mainly concentrated from June to September. The predominant bedrock consists of limestone, which results in brown limestone soil. Due to the area’s high stone content and low soil presence, combined with the development of fault fractures and strong water leakage, the permeability coefficient ranges from 0.5 to 0.7, resulting in very poor water and nutrient retention capacity. As a result, almost all of the agricultural land in the area is planted with drought-tolerant maize. Since 2003, due to the implementation of ecological engineering projects, some of the maize fields (CR) have been converted to pitaya orchards (OR). Starting the same year, other cropland areas have undergone ecological restoration through natural vegetation regeneration or plantation management. Among these, natural vegetation has undergone succession to shrublands (SH) dominated by species such as Cipadessa cinerascens (Pellegr.) Hand. Mazz., Rhapis excelsa (Thunb.) A. Henry., Alchornea trewioides (Benth.) Müll. Arg., and Pterolobium punctatum Hemsl. In addition, on some sites, plantation forests (PF) of Delavaya toxocarpa Franch have been established (Table 1).
Table 1.
Information on the plots used in this study.
2.2. Sample Collection and Property Analysis
Karst regions are characterized by extensive rock exposure and thin soil layers. In some areas on steep slopes, the soil is only 10 cm deep, so only the 0–10 cm soil layer was sampled. Before collecting the samples, all sampling tools were thoroughly cleaned, and personnel made every effort to avoid direct contact with the soil samples. Additionally, each land-use type had its own set of sampling tools to prevent cross-contamination. In June 2020, four subplots were established within each plot, and soil samples were collected in an S-shaped pattern (a method that helps minimize errors introduced by agricultural practices such as plowing and fertilization). Prior to sampling, surface vegetation was removed. Soil samples were collected using a soil auger 6 cm in diameter, following the principles of ‘randomization, equal proportions, and multi-point mixing.’ In total, 16 composite samples were collected (each weighing approximately 1 kg). The collected soil samples were stored under dry ice and promptly sent to the laboratory for analysis, including DNA analysis, soil microbial biomass determination, and physicochemical analysis.
Soil organic matter (SOM), total nitrogen (TN), available phosphorus (AP), available potassium (AK), and pH were quantified as described previously [15]. The specific methods were as follows. SOM content was assessed via the dichromate oxidation spectrophotometric method. TN content was analyzed using the semi-micro-Kjeldahl method, while AP was measured by reacting the soil with a molybdenum–antimony anti-coloring agent under alkaline conditions, and AK was determined using atomic absorption spectrometry after extraction with ammonium acetate. The pH was determined using a glass electrode and a soil-to-water ratio of 2.5:1. Soil microbial biomass C (MBC) and N (MBN) were measured using a chloroform fumigation extraction method [16,17]. Briefly, 10 g each of fumigated and nonfumigated soil samples was used for extraction with 0.5 M K2SO4. Total organic carbon and TN content in the extracts were quantified with a TOC analyzer (multi N/C 3100, Jena, France). The MBC and MBN contents were calculated using a kEC factor of 0.45 [18].
2.3. DNA Extraction, Quantitative Real-Time PCR, and High-Throughput Sequencing
Extraction of soil DNA, PCR amplification, and high-throughput sequencing were conducted by Shanghai Majorbio Bio-pharm Technology Co., Ltd. (Shanghai, China). DNA extraction was performed under sterile conditions, with external contamination being negligible. A CK group was set up during the PCR process. For eliminating non-specific amplification, (1) the CK group typically uses a reaction system that lacks template DNA for PCR amplification. This allows for the detection of contamination or non-specific amplification. If amplification bands appear in the CK group, it indicates contamination or non-specific amplification, and the experiment should be repeated to eliminate these interfering factors. (2) For confirming the effectiveness of experimental conditions, by observing the amplification results in the CK group, it is possible to confirm whether the components of the PCR reaction system (such as enzymes, buffers, primers, etc.) are in optimal working condition. If the CK group does not show amplification or the amplification is poor, it suggests that the experimental conditions may need to be adjusted.
2.3.1. DNA Extraction
A PowerSoilTM Total DNA isolation kit (Qiagen, Hilden, Germany) was used to extract total DNA from 0.5 g fresh soil samples, and the DNA was stored at −20 °C for downstream analysis. Its concentration and purity were quantified using a NanoDrop spectrophotometer. Total DNA quality was determined by 1% agarose gel electrophoresis.
2.3.2. PCR Amplification and Sequencing
The V3-V4 region of the 16S rRNA gene was used as the bacterial-specific fragment with the primers 338F (ACTCCTACGGGAGGCAGCAG)/806R (GGACTACHVGGGTWTCTAAT). The fungal ITS1 gene was amplified by the primer pair ITS1F (CTTGGTCATTTAGAGGAAGTAA)/ITS2 (GCTGCGTTCTTCATCGATGC) [19,20]. Sequencing of the amplicons was conducted on an Illumina MiSeq platform by Majorbio Bio-pharm Technology Company (Shanghai, China). The sequences were filtered and assigned to operational taxonomic units (OTUs) at a 97% similarity level. The abundances of bacterial and fungal genes were determined using quantitative real-time PCR (q-PCR). The PCR process of the 16S rRNA gene and ITS1 gene was performed as follows: initial denaturation at 95 °C for 5 min, followed by 35 cycles of denaturation at 95 °C and 98 °C for 30 s, annealing at 55 °C for 30 s, and elongation at 72 °C for 60 s. We submitted the raw microbial gene sequences to the Sequence Read Archive (SRA) database of the National Center for Biotechnology Information (NCBI) and obtained the accession numbers PRJNA902170 for bacteria and PRJNA902279 for fungi.
2.4. Data Processing
2.4.1. Sequencing Data Processing
The original sequences were quality controlled using fastp software version 0.19.6 (https://github.com/OpenGene/fastp, accessed on 1 July 2024), and then the original sequences were spliced using FLASH version 1.2.7 (http://www.cbcb.umd.edu/software/flash, accessed on 1 July 2024), and the validated sequences were obtained by OTU clustering of the sequences and elimination of chimeras based on 97% similarity using UPARSE software version 7.0.1090 (https://drive5.com/uparse/, accessed on 1 July 2024). The representative OTU sequences were compared with the species annotation database to determine the species origin of all sequences.
2.4.2. Statistical Analyses
Representative sequences of OTUs were selected for species annotation, and the taxonomic information obtained from the SILVA and UNITE databases was used for bacteria and fungi, respectively, to determine the community composition of each sample at the phylum, class, order, family, and genus levels. The alpha diversity indices of the samples, including Shannon’s and Chao’s indices, were calculated using MOTHUR (version v.1.30.2, https://mothur.org/wiki/calculators/, accessed on 3 July 2024) software. The measured data were preliminarily analyzed and processed in MS Excel (Microsoft Corp., Redmond, WA, USA, accessed on 10 July 2024), and significant differences in the soil physicochemical properties and microbial carbon and nitrogen were tested using IBM SPSS Statistics 25 (IBM Corp., Armonk, NY, USA, accessed on 13 July 2024). Prior to the statistical analysis of variance, the normality and equal variance of all datasets were tested. The 16S rRNA and ITS gene sequences were used for α diversity analysis, community composition analysis, principal component analysis, redundancy analysis, and heat map correlation analysis to compare differences in the bacterial and fungal species composition in soils under different land-use practices and the effects of environmental factors on soil microorganisms, using R v4.4.0 (https://www.r-project.org/, accessed on 20 July 2024. R Foundation for Statistical Computing, Vienna, Austria).
3. Results
3.1. Variations in Soil Properties
The soil pH values exhibited a range of 6.15 to 7.16 across the four land-use categories, demonstrating an increase with the conversion of CR to PF and SH. The SOM content in the PF and SH plots was markedly higher than those in the CR and OR plots. TN was the highest in PF soil. However, the AP and AK contents in OR and CR soils were greater than those in PF and SH soils (Table 2).
Table 2.
Soil properties.
3.2. Variations in Soil Microbial Biomass, Abundance, and Diversity
The MBC and MBN contents in SH and PF soils were markedly elevated compared with those in CR and OR soils, with no significant difference between SH and PF or between CR and OR (Figure 1A,B). Additionally, there were no notable differences in the ratios of MBC to MBN among the different samples (Figure 1C).
Figure 1.
Soil MBC (A) and MBN (B) contents and stoichiometry (C). CR, OR, PF, and SH represent cropland, orchard, plantation forest, and shrubland, respectively. MBC, microbial biomass carbon; MBN, microbial biomass nitrogen. Different lowercase letters (p < 0.05) in rows indicate significant differences among the treatments. Data are shown as the mean ± standard deviation (n = 4). Duncan’s least significant difference test (p = 0.05) was conducted to determine the variance and significant differences between treatment means.
The bacterial and fungal abundances in SH soil were found to be significantly disparate from those observed in the CR and OR soils, with notably elevated levels compared with those in PF soil (Figure 2A,B). Distinct variations in bacterial and fungal alpha diversities (Chao 1 and Shannon indices) were observed between the cultivated soils (CR, OR) and revegetated soils (PF, SH) (Figure 2C–F). Compared with those in the cultivated soils, the Chao1 and Shannon indices of fungi were significantly elevated in the revegetated soils (Figure 2D,F). Conversely, the Chao1 and Shannon indices of bacteria were lower in revegetated soils than in cultivated soils (Figure 2C,E). There were no meaningful variations in bacterial alpha diversity between CR and OR, or between PF and SH (Figure 2C,E). For fungi, the alpha diversity metrics in the SH plot were markedly higher than those in other plots (Figure 2D,F).
Figure 2.
Abundances (A,B) and alpha diversity indices (C–F) of soil microorganisms. CR, OR, PF, and SH represent cropland, orchard, plantation forest, and shrubland, respectively. Different lowercase letters (p < 0.05) in rows indicate significant differences among the treatments. Data are shown as the mean ± standard deviation (n = 4). Duncan’s least significant difference test (p = 0.05) was conducted to determine the variance and significant differences between treatment means.
The bacterial and fungal community structures of the four plots differed significantly (Figure 3). ADONIS analysis confirmed that land-use changes affected bacterial and fungal communities in karst areas (Table 3).
Figure 3.
Principal coordinate analysis (PCoA) of microbial communities: (A) bacterial; (B) fungal. CR, OR, PF, and SH represent cropland, orchard, plantation forest, and shrubland, respectively.
Table 3.
Results of ADONIS analysis of variance assessments of the impact of land-use changes on bacterial and fungal community structure in karst areas.
3.3. Variations in the Composition of Soil Microbial Communities
The dominant bacterial phyla detected in the assessed soils were Actinobacteria (28.57%–39.70%), Proteobacteria (13.76%–23.91%), Acidobacteria (15.77%–20.47%), and Chloroflexi (8.58%–14.86%). Compared with the CR and OR plots, the relative abundance of Actinobacteria rose markedly with the conversion to PF, and a similar trend was noted in SH for Proteobacteria. However, reductions in the relative abundances of Acidobacteria and Chloroflexi were detected in the soils of sites that had undergone vegetation restoration (both natural and managed) (Figure 4A).
Figure 4.
Relative abundances of soil microbial communities at the phylum level: (A) bacterial, (B) fungal. CR, OR, PF, and SH represent cropland, orchard, plantation forest, and shrubland, respectively.
The fungal sequences were predominated by Ascomycota (56.09%–85.28%), Mortierellomycota (8.44%–10.85%), and Basidiomycota (1.63%–7.11%). Among the soils collected from the four land-use types, Ascomycota was the dominant phylum, whereas Rozellomycota, Chytridiomycota, and Glomeromycota were less abundant. The relative abundance of Ascomycota was highest in OR soil, although abundance was found to decline markedly in response to the conversion of agricultural land. Furthermore, compared with OR soil and the soil at sites that had undergone both types of vegetation restoration, the relative abundance of Basidiomycota was notably lower in CR (Figure 4B).
3.4. Interactions Among Soil Microbial Biomass, Chemical Properties, and Microbial Community Structure
The RDA results revealed that the microbial composition was influenced to a considerable extent by soil chemical properties, MBC, and MBN. For bacteria, the RDA explained 47.5% of the variation in the first component and 23.9% in the second component, accounting for 71.4% of the overall variation (Figure 5A). For fungi, the first and second components explained 48.9% and 27% of the variation, respectively, accounting for 75.9% of the overall variation (Figure 5B). RDA1 differentiated cultivated soils (CR and OR) from revegetated soils (PF and SH), with AP and AK as the primary factors responsible for the separation (Figure 5). As revealed by Spearman’s correlation analysis, the phyla Chloroflexi, Gemmatimonadetes, and Ascomycota were highly inversely associated with soil pH, SOM, TN, MBC, and MBN, but strongly positively associated with AP and AK. MBC/MBN was rarely associated with any bacterial or fungal phyla, and no notable relationships were observed between soil parameters and the bacterial phyla Actinobacteria, Acidobacteria, and Planctomycetes, or the fungal phylum Mortierellomycota (Figure 6). Microbial abundance and diversity were found to be strongly correlated with soil chemical properties, including AP, AK, and MBN (Table 4).
Figure 5.
Redundancy analysis (RDA) of the relationships between microbial communities and selected soil properties: (A) bacterial; (B) fungal. Different colors represent different treatments. CR, OR, PF, and SH represent cropland, orchard, plantation forest, and shrubland, respectively.
Figure 6.
Spearman’s correlations between relative abundance of the dominant microbial phyla and soil properties: (A), bacterial; (B), fungal. ***, **, and * mean p < 0.001, p < 0.01, and p < 0.05, respectively. SOM, soil organic matter; TN, total nitrogen; AP, available phosphorus; AK, available potassium; MBC, microbial biomass carbon; MBC, microbial biomass nitrogen; MBC: MBN, the ratios of MBC and MBN.
Table 4.
Spearman’s correlations between microbial community characteristics and soil parameters.
4. Discussion
4.1. Impact of Land-Use Change on Soil Biochemical Properties
Soil provides plants with the nutrients required for growth and development, and changes in its microenvironment can also provide feedback to aboveground vegetation. In the present study, compared with agricultural land, shrubland and plantation forests promoted organic matter and total nitrogen accumulation, supporting our first hypothesis, which is consistent with the findings of Hu et al. (2023) in a karst region [21], where vegetation restoration increased organic matter and nitrogen content significantly. In karst areas, highly soluble carbonate rocks cannot produce much soil, resulting in thin and discontinuous soils [22], and intensive agricultural activities exacerbate the imbalance between soil formation and erosion in karst, resulting in rapid loss of soil organic matter and other nutrients [23], which can be reversed with vegetation restoration, litter increase, and root system development. In contrast to woodlands, agricultural lands have higher phosphorus and potassium levels, probably because of fertilizer application. In calcareous karst soils, the effectiveness of phosphorus may be one of the key factors affecting vegetation’s recovery due to the strong adsorption and precipitation of phosphorus by calcium, as well as the lack of quick-acting phosphorus in plants at a high pH [24,25]. Although soil TP and AP contents increase with vegetation recovery in karst ecosystems [25], the degree of P limitation of plants becomes more serious [26]. In summary, vegetation restoration can promote organic matter and total nitrogen accumulation; however, effective resolution of the phosphorus limitation problem in afforestation requires research attention.
In addition, both MBC and MBN increased significantly under both natural and plantation forest vegetation restoration compared with those under agricultural fields and orchards, supporting our first hypothesis. This may be explained by the fact that relatively high levels of litter provide a rich source of nutrients, which promote soil microbial colonization and activity [27,28]. Microbial biomass was higher in soils with higher organic carbon and nitrogen content [29], which is similar to our results. Irrational fertilizer use in agricultural land inhibits the growth of soil microorganisms, which ultimately leads to a decrease in microbial diversity and productivity [30]. Although the ratios of MBC and MBN did not differ significantly among land-use types, the relative stability of the carbon to nitrogen ratio of microbial biomass under each land-use type suggests a certain degree of adaptability and equilibrium of the microbial community under environmental change [31]. In conclusion, natural and artificial vegetation restoration could improve soil microbial biomass, while tillage and orchard management may negatively affect soil microbial communities; therefore, research evidence should be considered in the management of agricultural land to ensure soil health for sustainable agricultural development.
4.2. Impact of Land-Use Change on Soil Microbial Communities
The results of the present study demonstrated that the restoration of natural and plantation forest vegetation significantly decreased bacterial diversity and increased fungal diversity after 17 years of abandonment (Figure 2C–F), which did not fully support the second hypothesis. This could be attributed to bacterial diversity being negatively correlated with SOM accumulation, consistent with the results of Hu et al. (2023) in the southwest karst region [21]. Agricultural land has high bacterial diversity and low fungal diversity. Fertilizer applications can maintain soil bacterial diversity [32,33], whereas the destruction of the fungal mycelial network during tillage is detrimental to fungal habitats, with less effect on bacteria living within microaggregates [34]. However, the results of Cheng et al. (2023) are inconsistent with the findings above, with no significant difference in soil bacterial and fungal diversity among agricultural fields, natural regeneration, and afforestation [8], which may be due to the high degree of environmental heterogeneity in karst areas. In addition, the abundance and diversity of soil fungi under natural regeneration were significantly higher than those under artificial regeneration (Figure 2B,D,F). In general, naturally regenerated woodlands have higher plant diversity and less anthropogenic disturbance. Plant species influence microbial diversity [35], and microbial diversity is an important driver of plant diversity and productivity [36]. In conclusion, changes in land-use significantly affect soil microbial diversity, with natural and artificially restored woodlands providing favorable microenvironments for fungi with less disturbance than agricultural lands with frequent human activities.
There were significant differences in the soil microbial community structure across land-use types (Figure 3). In addition, 17 years after the change in land-use pattern, although the dominant bacterial and fungal phyla did not change, their relative abundances changed with vegetation restoration, such as a significant decrease in the Chloroflexi and Ascomycetes phyla (Figure 4). Cheng et al. (2023) attributed the significant decrease in the relative abundance of the phyla Ascomycetes to the high C/N under both the natural conditions and afforestation conditions [8]. This demonstrated the significant effect of land-use patterns on soil microorganisms, which can be attributed to factors such as vegetation composition and soil properties. Vegetation composition was completely inconsistent after the change in land-use patterns (Table 1), and studies have shown that even in the same soil type, the soil microbial community structure varies under different plant species [37]. However, some studies in the same karst region have reported that soil microbial composition is not affected by plant species but is affected by soil properties [38]. Numerous previous studies have confirmed the strong influence of soil physical and chemical properties on soil microorganisms [7,38]. Indeed, through litter degradation and nutrient production in root sediments, plants modify the physical, chemical, and biological properties of their soil environment [39,40]. In the present study, soil chemical properties differed significantly among different land-uses (Table 4). Therefore, it is hypothesized that differences in the soil microbial community structure may be influenced jointly by plant species and soil properties. More specific studies are required in future to better understand the effects of different plant species on the inter-root soil microbial community structure.
4.3. Edaphic Factors Influencing Microbial Communities in Soils Under Four Land Management Practices
In karst areas, carbonates are low in P, K, etc., and have high leaching rates, limiting the effectiveness of the nutrients. High agricultural intensification accelerates soil erosion (including organic carbon, N, and other nutrients). The application of inorganic fertilizers, in the short term, increases effective soil nutrients (P, K) and makes a key contribution to the soil microbial community composition in farmland and orchards (Figure 6), consistent with the results reported by Shen et al. (2019) [41]. However, in the long term, fertilization accelerates soil acidification and promotes carbonate dissolution, which exacerbates soil infertility [23] and leads to a decrease in soil microbial diversity. In contrast, after returning farmland to forest, species productivity and biomass increase and continue to increase with the enrichment of vegetation [42], in turn releasing more nutrients to the soil for microbial utilization and further increasing soil microbial biomass (Figure 1) [42]. In addition, vegetation diversity can indirectly affect the soil microbial community composition and diversity by regulating soil nutrients and pH [43]. Conversely, microbial secretion is a key source of soil carbon and nitrogen, and microorganisms with high abundance will decompose more apoplastic materials to release nutrients into the soil, which will improve the quality of karst soil and form a closed plant–microbe–soil loop. Moreover, the results of this study also indicate a significant correlation between soil microbial abundance and AP, and AK. Previous studies have shown that low AP significantly increases the abundance of soil fungi. In phosphorus-deficient environments, arbuscular mycorrhizal fungi drive biotic interactions between neighboring plants, expand the range of root absorption, activate the soil’s insoluble phosphates, and thereby effectively promote plant growth and phosphorus uptake [44]. The availability of potassium in the karst system of southwest China is restricted by the low carbonate content and high leaching rate under subtropical rainfall conditions [23]. Potassium in the soil not only directly impacts microorganisms but also indirectly influences them by promoting plant growth, which, in turn, affects the microbial community. Additionally, soil microorganisms can regulate the levels of phosphorus and potassium in the soil, thereby promoting plant growth and development [45]. Soil bacteria that have the ability to solubilize K, such as Firmicutes (Bacillus mucilaginosus, Bacillus edaphicus, Bacillus circulans, Paenibacillus spp.) and Protecobacteria (Acidothiobacillus ferrooxidans) [46], were found in this study to have a significant negative correlation with AK (Figure 6). In conclusion, in both agricultural land and forest land, soil environmental factors have a major influence on the microbial community structure and diversity, which support the ecological roles of microbial communities in the rocky desert ecosystem.
The present study was based on soil microorganisms under four land-use modes and it had some limitations. The study was conducted only with a yearly period when the land-use pattern was changed over 17 years, and it did not perform comparisons between different years. This limitation will be addressed in the future to provide a more robust scientific basis and technical support for rock desertification control and ecological restoration.
5. Conclusions
Collectively, our findings indicate that the conversion of agricultural land has the effect of altering soil parameters, which, in turn, influence soil microbial communities. Specifically, we found that vegetation restoration efficiently enhanced soil MBC and MBN contents following cropland abandonment. The abundance of bacteria and fungi was markedly greater in shrubland than in agricultural land and planted forests. Naturally restored vegetation was associated with lower levels of soil bacterial diversity and higher soil fungal diversity. Soil microbial community structures were found to differ in response to land-use conversion, and high levels of soil microbial community abundance and diversity can contribute to enhancing ecosystem services in the karst areas of southwest China. The findings of this study will contribute to enhancing our understanding of how changes in land management and vegetation restoration can influence the structure and composition of soil microbial communities, and will provide a basis for developing effective ecological engineering approaches for the restoration of karst ecosystems.
Author Contributions
Conceptualization, Z.Z.; project administration, Z.Z.; funding acquisition, Z.Z.; investigation, L.Z., X.L., Y.C. and S.T.; data analysis, Y.C., S.T. and Z.Z.; writing—original draft; Y.C., S.T. and Z.Z.; writing—review and editing, Z.Z., L.Z., X.L., Y.C. and S.T. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by the National Natural Science Foundation of China (32360322, 31960272; Z. Z.), the Basic Research Fund of Guangxi Academy of Sciences (CQZ-E-1909; Z. Z.), the Guangxi Scientific and Technological Project (Guike AB18126065; Z. Z.), and the Guangxi Key Laboratory of Plant Conservation and Restoration Ecology in Karst Terrain (22-035-26; S. T.).
Data Availability Statement
Data will be made available on request.
Acknowledgments
We acknowledge the constructive suggestions of the reviewers and the editor.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Shi, W.Y.; Xu, M.G.; He, X.H. Plant-microbe-soil interactions in a vulnerable ecosystem: Promising re-vegetation approaches to slow down rocky karst desertification. Plant Soil 2022, 475, 1–4. [Google Scholar] [CrossRef]
- Xiao, W.J.; Yang, Y.; Jiang, X.Y.; He, Z.L.; Zou, X.G.; You, X.H.; Yang, Y.Y.; Zeng, Z.Z.; Shi, W.Y. Different responses of ecohydrological processes in the re-vegetation area between the dip and anti-dip slope in a karst rocky desertification area in southwest China. Plant Soil 2022, 475, 25–43. [Google Scholar] [CrossRef]
- Yu, P.J.; Tang, H.Y.; Sun, X.Z.; Shi, W.Y.; Pan, J.J.; Liu, S.W.; Jia, H.T.; Ding, Z.; Tang, X.G.; Chen, M. Afforestation alters soil microbial community composition and reduces microbial network complexity in a karst region of Southwest China. Land Degrad. Dev. 2024, 35, 2926–2939. [Google Scholar] [CrossRef]
- Bardgett, R.D.; Van Der Putten, W.H. Belowground biodiversity and ecosystem functioning. Nature 2014, 515, 505–511. [Google Scholar] [CrossRef]
- Zhao, F.Z.; Bai, L.; Wang, J.Y.; Deng, J.; Ren, C.J.; Han, X.H.; Yang, G.H.; Wang, J. Change in soil bacterial community during secondary succession depend on plant and soil characteristics. Catena 2019, 173, 246–252. [Google Scholar] [CrossRef]
- Xue, P.P.; Minasny, B.; Mcbratney, B.A. Land-use affects soil microbial co-occurrence networks and their putative functions. Appl. Soil Ecol. 2022, 169, 104184. [Google Scholar] [CrossRef]
- Zhang, J.; Guo, X.Q.; Shan, Y.J.; Lu, X.; Cao, J.Q. Effects of land-use patterns on soil microbial diversity and composition in the Loess Plateau, China. J. Arid Land 2024, 16, 415–430. [Google Scholar] [CrossRef]
- Cheng, H.T.; Zhou, X.H.; Dong, R.S.; Wang, X.M.; Liu, G.D.; Li, Q.F. Natural vegetation regeneration facilitated soil organic carbon sequestration and microbial community stability in the degraded karst ecosystem. Catena 2023, 222, 106856. [Google Scholar] [CrossRef]
- Brookes, P.C. The use of microbial parameters in monitoring soil pollution by heavy metals. Biol. Fertil. Soils 1995, 4, 269–279. [Google Scholar] [CrossRef]
- Lundquist, E.J.; Jackson, L.E.; Scow, K.M.; Hsu, C. Changes in microbial biomass and community composition, and soil carbon and nitrogen pools after incorporation of rye into three California agricultural soils. Soil Biol. Biochem. 1999, 31, 221–236. [Google Scholar] [CrossRef]
- Gil-Sotres, F.; Trasar-Cepeda, C.; Leirós, M.C.; Seoane, S. Different approaches to evaluating soil quality using biochemical properties. Soil Biol. Biochem. 2005, 37, 877–887. [Google Scholar] [CrossRef]
- Tiwari, S.; Singh, C.; Boudh, S.; Rai, P.K.; Gupta, V.K.; Singh, J.S. Land use change: A key ecological disturbance declines soil microbial biomass in dry tropical uplands. J. Environ. Manag. 2019, 242, 1–10. [Google Scholar] [CrossRef]
- Dinesh, R.; Chaudhuri, S.G. Soil biochemical/microbial indices as ecological indicators of land use change in mangrove forests. Ecol. Indic. 2013, 32, 253–258. [Google Scholar] [CrossRef]
- Hu, P.L.; Zhang, W.; Chen, H.S.; Li, D.J.; Zhao, Y.; Zhao, J.; Xiao, J.; Wu, F.J.; He, X.Y.; Luo, Y.Q.; et al. Soil carbon accumulation with increasing temperature under both managed and natural vegetation restoration in calcareous soils. Sci. Total Environ. 2021, 767, 145298. [Google Scholar] [CrossRef] [PubMed]
- Bao, S.D. Soil and Agricultural Chemistry Analysis; Agriculture Publication: Beijing, China, 2000. [Google Scholar]
- Brookes, P.C.; Landman, A.; Pruden, G.; Jenkinson, D.S. Chloroform fumigation and the release of soil nitrogen: A rapid direct extraction method to measure microbial biomass nitrogen in soil—ScienceDirect. Soil Biol. Biochem. 1985, 17, 837–842. [Google Scholar] [CrossRef]
- Vance, E.D.; Brookes, P.C.; Jenkinson, D.S. An extraction method for measuring soil microbial biomass C. Soil Biol. Biochem. 1987, 19, 703–707. [Google Scholar] [CrossRef]
- Wu, J.; Joergensen, R.G.; Pommerening, B.; Chaussod, R.; Brookes, P.C. Measurement of soil microbial biomass C by fumigation-extraction—An automated procedure. Soil Biol. Biochem. 1990, 22, 1167–1169. [Google Scholar] [CrossRef]
- Xu, N.; Tan, G.; Wang, H.; Gai, X.P. Effect of biochar additions to soil on nitrogen leaching, microbial biomass and bacterial community structure. Eur. J. Soil Biol. 2016, 74, 1–8. [Google Scholar] [CrossRef]
- Adams, R.I.; Miletto, M.; Taylor, J.W.; Bruns, T.D. Dispersal in microbes: Fungi in indoor air are dominated by outdoor air and show dispersal limitation at short distances. ISME J. 2013, 7, 1262–1273. [Google Scholar] [CrossRef]
- Hu, P.; Zhang, W.; Kuzyakov, Y.; Xiao, L.M.; Xiao, D.; Xu, L.; Chen, H.S.; Zhao, J.; Wang, K.L. Linking bacterial life strategies with soil organic matter accrual by karst vegetation restoration. Soil Biol. Biochem. 2023, 177, 108925. [Google Scholar] [CrossRef]
- Jiang, Z.C.; Lian, Y.Q.; Qin, X.Q. Rocky desertification in Southwest China: Impacts, causes, and restoration. Earth-Sci. Rev. 2014, 132, 1–12. [Google Scholar] [CrossRef]
- Green, S.M.; Dungait, J.A.J.; Tu, C.L.; Buss, H.L.; Sanderson, N.; Hawkes, S.J.; Xing, K.X.; Yue, F.J.; Hussey, V.L.; Peng, J.; et al. Soil functions and ecosystem services research in the Chinese karst Critical Zone. Chem. Geol. 2019, 527, 119107. [Google Scholar] [CrossRef]
- Liang, Y.M.; Pan, F.J.; Wang, K.L.; Jin, Z.J.; Hu, L.N.; Huang, Y. Difference in Phosphorus Acquisition Strategies of N2-Fixing Plants in Shrubland and Primary Forest Soils of the Karst Regions. Pol. J. Environ. Stud. 2022, 31, 1161–1170. [Google Scholar] [CrossRef]
- Pan, F.J.; Yu, X.; Chen, M.; Liang, Y.M. Vegetation recovery reshapes the composition and enhances the network connectivity of phoD-harboring microorganisms to promote P availability in a karst ecosystem. Sci. Total Environ. 2024, 918, 170561. [Google Scholar] [CrossRef]
- Zhang, W.; Zhao, J.; Pan, F.; Li, D.; Chen, H.; Wang, K. Changes in nitrogen and phosphorus limitation during secondary succession in a karst region in southwest China. Plant Soil 2015, 391, 77–91. [Google Scholar] [CrossRef]
- Fierer, N.; Strickland, M.S.; Liptzin, D.; Bradford, M.A.; Cleveland, C. Global patterns in belowground communities. Ecol. Lett. 2009, 12, 1238–1249. [Google Scholar] [CrossRef] [PubMed]
- Eclesia, R.; Jobbágy, E.; Jackson, R.B.; Rizzotto, M.; Piñeiro, G. Stabilization of new carbon inputs rather than old carbon decomposition determines soil organic carbon shifts following woody or herbaceous vegetation transitions. Plant Soil 2016, 409, 99–116. [Google Scholar] [CrossRef]
- Babur, E.; Dindarolu, T.; Solaiman, Z.; Battaglia, M.L. Microbial respiration, microbial biomass and activity are highly sensitive to forest tree species and seasonal patterns in the Eastern Mediterranean Karst Ecosystems. Sci. Total Environ. 2021, 775, 145868. [Google Scholar] [CrossRef]
- Chen, X.P.; Cui, Z.L.; Fan, M.S.; Vitousek, P.; Zhao, M.; Ma, W.Q.; Wang, Z.L.; Zhang, W.J.; Yan, X.Y.; Yang, J.C.; et al. Producing more grain with lower environmental costs. Nature 2014, 514, 486–489. [Google Scholar] [CrossRef] [PubMed]
- Gao, D.C.; Bai, E.; Wang, S.Y.; Zong, S.W.; Liu, Z.P.; Fan, X.L.; Zhao, C.H.; Hagedorn, F. Three-dimensional mapping of carbon, nitrogen, and phosphorus in soil microbial biomass and their stoichiometry at the global scale. Glob. Chang. Biol. 2022, 28, 6728–6740. [Google Scholar] [CrossRef]
- Sun, R.B.; Zhang, X.X.; Guo, X.S.; Wang, D.Z.; Chu, H.Y. Bacterial diversity in soils subjected to long-term chemical fertilization can be more stably maintained with the addition of livestock manure than wheat straw. Sci. Found. China 2015, 88, 9–18. [Google Scholar] [CrossRef]
- Ai, C.; Zhang, S.Q.; Zhang, X.; Guo, D.D.; Zhou, W.; Huang, S.M. Distinct responses of soil bacterial and fungal communities to changes in fertilization regime and crop rotation. Geoderma 2018, 319, 156–166. [Google Scholar] [CrossRef]
- Young, I.M.; Ritz, K. Tillage, habitat space and function of soil microbes. Soil Tillage Res. 2000, 53, 201–213. [Google Scholar] [CrossRef]
- Ladygina, N.; Hedlund, K. Plant species influence microbial diversity and carbon allocation in the rhizosphere. Soil Biol. Biochem. 2010, 2010, 162–168. [Google Scholar] [CrossRef]
- Van der Heijden, M.G.A.; Bardgett, R.D.; van Straalen, N.M. The unseen majority: Soil microbes as drivers of plant diversity and productivity in terrestrial ecosystems. Ecol. Lett. 2008, 11, 296–310. [Google Scholar] [CrossRef] [PubMed]
- Uroz, S.; Oger, P.; Tisserand, E.; Cébron, A.; Turpault, M.P.; Buée, M.; De Boer, W.; Leveau, J.H.J.; Frey-Klett, P. Specific impacts of beech and Norway spruce on the structure and diversity of the rhizosphere and soil microbial communities. Sci. Rep. 2016, 6, 27756. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.F.; Du, H.; Zeng, F.P.; Song, T.Q.; Peng, W.X. Diminished rhizosphere and bulk soil microbial abundance and diversity across succession stages in Karst area, southwest China. Appl. Soil Ecol. 2021, 158, 103799. [Google Scholar] [CrossRef]
- Ayres, E.; Steltzer, H.; Berg, S.; Wallenstein, M.D.; Simmons, B.L.; Wall, D.H. Tree Species Traits Influence Soil Physical, Chemical, and Biological Properties in High Elevation Forests. PLoS ONE 2009, 4, e5964. [Google Scholar] [CrossRef] [PubMed]
- Cesarz, S.; Fender, A.C.; Beyer, F.; Valtanen, K.; Pfeiffer, B.; Gansert, D.; Hertel, D.; Polle, A.; Daniel, R.; Leuschner, C.; et al. Roots from beech (Fagus sylvatica L.) and ash (Fraxinus excelsior L.) differentially affect soil microorganisms and carbon dynamics. Soil Biol. Biochem. 2013, 61, 23–32. [Google Scholar] [CrossRef]
- Shen, F.F.; Wu, J.P.; Fan, H.B.; Liu, W.F.; Guo, X.M.; Duan, H.L.; Hu, L.; Lei, X.M.; Wei, X.H. Soil N/P and C/P ratio regulate the responses of soil microbial community composition and enzyme activities in a long-term nitrogen loaded Chinese fir forest. Plant Soil 2019, 436, 91–107. [Google Scholar] [CrossRef]
- Cardinale, B.J.; Wright, J.P.; Cadotte, M.W.; Carroll, I.T.; Hector, A.; Srivastava, D.S.; Loreau, M.; Weis, J.J. Impacts of plant diversity on biomass production increase through time because of species complementarity. Proc. Natl. Acad. Sci. USA 2007, 104, 18123–18128. [Google Scholar] [CrossRef] [PubMed]
- Thoms, C.; Gattinger, A.; Jacob, M.; Thomas, F.M.; Gleixner, G. Direct and indirect effects of tree diversity drive soil microbial diversity in temperate deciduous forest. Soil Biol. Biochem. 2010, 42, 1558–1565. [Google Scholar] [CrossRef]
- Ingraffia, R.; Amato, G.; Frenda, A.S.; Giambalvo, D. Impacts of arbuscular mycorrhizal fungi on nutrient uptake, N2 fixation, N transfer, and growth in a wheat/faba bean intercropping system. PLoS ONE 2019, 14, e0213672. [Google Scholar] [CrossRef] [PubMed]
- Gao, L.; Wang, W.H.; Liao, X.Y.; Tan, X.; Yue, J.X.; Zhang, W.; Wu, J.J.; Willison, J.H.M.; Tian, Q.L.; Liu, Y. Soil nutrients, enzyme activities, and bacterial communities in varied plant communities in karst rocky desertification regions in Wushan County, Southwest China. Front. Microbiol. 2023, 14, 1180562. [Google Scholar] [CrossRef] [PubMed]
- Meena, V.S.; Maurya, B.R.; Verma, J.P. Does a rhizospheric microorganism enhance K+ availability in agricultural soils? Microbiol. Res. 2014, 169, 337–347. [Google Scholar] [CrossRef] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).