Next Article in Journal
Patterns of Diversity and Community Assembly and Their Environmental Explanation across Different Types of Shrublands in the Western Loess Plateau
Next Article in Special Issue
Detection of Viruses in Special Stands of Common Ash Reveals Insights into the Virome of Fraxinus excelsior
Previous Article in Journal
Two Centuries of Winter Temperature Variability Inferred from Betula ermanii Ring Widths near the Forests/Tundra Ecotone in the Changbai Mountain, China
Previous Article in Special Issue
Identifying the Biological Characteristics of Anthracnose Pathogens of Blueberries (Vaccinium corymbosum L.) in China
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterization of Fomes fomentarius s.s. and F. inzengae in Belgian Beech Forests

1
Walloon Agricultural Research Centre, Life Science Department, Rue de Liroux, 4, B-5030 Gembloux, Belgium
2
Walloon Agricultural Research Centre, Knowledge and Valorization of Agricultural Products Department, Avenue Maréchal Juin, 23, B-5030 Gembloux, Belgium
*
Author to whom correspondence should be addressed.
Forests 2024, 15(2), 221; https://doi.org/10.3390/f15020221
Submission received: 14 December 2023 / Revised: 12 January 2024 / Accepted: 16 January 2024 / Published: 23 January 2024
(This article belongs to the Special Issue Forest Diseases and Pests: Recent Scientific Findings)

Abstract

Real-time PCRs were developed to characterize Fomes fomentarius lineages occurring in the beech forests of the Ardennes (southern Belgium). A collection of F. fomentarius sensu lato isolates was built up in 2020 and 2021 from basidiocarps developing on beech trunks, stumps, or logs. Two of the 148 isolates tested (monokaryotic and dikaryotic) belonged to the species Fomes inzengae, while the other isolates corresponded to the species Fomes fomentarius sensu stricto. As far as we know, this is the first record of Fomes inzengae in Belgium. This fungus was also found in a mature tree not showing any signs of decay. This demonstrates its endophytic nature. Growth tests at different temperatures, as well as wood degradation tests in accordance with standard NBN EN113 showed different behavior between both species. Passive sticky traps were installed during two growing seasons at the two sites where F. inzengae had been reported. Spores were detected at all collection times between April and July, using the specific molecular test developed. Moreover, in 2023, the DNA concentrations measured were 100 times higher than in 2022. The implications of this new species in Belgium is discussed in the context of climate change.

1. Introduction

With a potential distribution range of over 200 million hectares of woodlands, European beech (Fagus sylvatica L.) is one of the most prevalent forest tree species in Europe [1,2]. In Belgium, it is the second most prevalent deciduous tree species after oak, with which it is often mixed. More than two-thirds of pure beech stands are concentrated in the bioclimatic area of the Ardennes [3]. The European beech is sensitive to drought [4] and summer heat waves [5]. Over the past few years, due to climate change, European beech forests have shown a loss of vitality notably in Belgium [6,7] but also in other parts of Europe [8,9,10]. Under such conditions, beech stands may become increasingly susceptible to infection by secondary pathogens [11] and especially by wood decaying fungi with an endophytic phase which are common in beech sapwood [12].
Fomes fomentarius (L.) Kickx Fr (Polyporales, Agaromycetes, Basidiomycota) is a wood decaying fungus which causes white rot on a large number of wood species, mainly on broad-leaved trees. When present on tree stumps and dead trees, F. fomentarius behaves as a saprophytic agent with an important ecological role. Indeed, by decomposing wood, it participates in nutrient recycling. By eliminating dead wood, it also frees up space in the forest [13]. However, under stress conditions, F. fomentarius can behave as a pathogen by infecting standing trees [14], leading to a reduction in timber quality and trunk breakage in the event of windstorms. F. fomentarius is an endophytic species [15]. The transition from a latent to an active state in wood is not well understood yet. As indicated by Boddy and Rayner [16], it might be triggered by particular environmental conditions that interfere with the normal functioning of sapwood, notably a decrease in moisture content associated with an increase in aeration.
Fomes fomentarius is present in diverse continents. Several phylogenetic studies using isolates from different geographical areas have shown that F. fomentarius is a species complex with several (cryptic) lineages [17,18,19,20,21]. Currently, four lineages have been identified: Fomes sp. from North America, F. fomentarius sensu stricto (s.s.) from Northern Europe, Fomes sp. from Asia and F. inzengae [21]. The lineage F. inzengae (Ces. & De Not.) Cooke is more prevalent in the Mediterranean region [22,23] and has been considered as a new cryptic species [21]. It differs from F. fomentarius s.s. in its hosts range, but also in growth characteristics and volatile compounds [21]. F. fomentarius s.s. and F. inzengae also show micro-morphological differences, but these are not easily identifiable in the field [24].
There were several objectives in this study. Firstly, the development of rapid molecular tools based on qPCR for the detection of lineages other than F. fomentarius s.s and the application of these tests on wood and fungal isolates collected in Belgian beech forests. Secondly, the use of the qPCR method in detecting F. inzengae on spores collected on spore traps to study the release period of this fungal species in Belgium. Thirdly, a comparison of the behavior of the lineages identified in terms of growth temperature and beech wood degradation capacity.

2. Materials and Methods

2.1. Collection of Fungal Isolates

A total of 15 beech stands of different ages were selected in southern Belgium in the bioclimatic zone of the Ardennes [25] where European beech (Fagus sylvatica) is one of the main hardwood species (Figure 1).
Monokaryotic (n = 46) and dikaryotic (n = 102) isolates of F. fomentarius s.l. were collected from basidiocarps on living trees as well as on broken trees or stumps (Table 1). Monokaryotic isolates were obtained by collecting spores released in spring (end of April to mid-May) in sterile 1.5 mL tubes. Spores were suspended in sterile distilled water, and spread onto 2% Malt Extract Agar (MEA: 15 g/L agar and 20 g/L malt extract) containing streptomycin sulphate (80 mg/L). Plates were incubated at 25 °C in the dark. Single colonies were transferred onto 2% MEA. Regarding dikaryotic strains, pieces of basidiocarp context tissue (~2 cm × 2 cm) were sterilized for 1 min in a NaClO solution (0.6% active chlorine), cut into small pieces (~2 mm × 3 mm), plated onto 2% MEA supplemented with streptomycin sulphate and incubated at 25 °C in the dark. Pure cultures were transferred onto 2% MEA. All the isolates were subcultured on MEA supplemented with beech wood sawdust (10 g/L) every three months and preserved at 4 °C on MEA under paraffin oil.

2.2. Wood Material

Three mature beeches (circumference at breast height >100 cm) and nine saplings (circumference at breast height ~50 cm) were sampled at three additional forest sites in the same bioclimatic area (Figure 1), representing a total of 36 trees. The trees did not show any sporocarp on the trunk. Selected at random in the stand, they were felled during the winter, outside the period of F. fomentarius sporulation. Five-cm-thick wood disks were collected at two heights in two replicates (two disks at approximately 50 cm from the collar base, and two others at the base of the crown). The samples collected did not reveal any wood discoloration or decaying process. Within 24 h after the felling, the 144 wood disks were surface-disinfected with 70 percent alcohol and wrapped in polyethylene film with a few 1–2 mm holes as described by Baum et al. [15]. The disks were then placed at 20 °C for 24 weeks. At the end of the incubation period, the wood disks were cleared of the fungi growing on the surface, planed and then surface-disinfected with a blowtorch. Using a disinfected drill flamed between two samples, sawdust was gathered at 5 points at a depth of 2 cm in the wood. The 144 samples of sawdust were stored at −20 °C until processing.
One more tree was cut to provide green beech wood specimens of 50 × 25 × 15 mm to test the wood durability.

2.3. Spore Trapping Experiments

In 2022 and 2023, passive spore traps (Figure 2). were used to determine the sporulation period of F. inzengae. The collection unit (52 × 74 mm for easy transport in a Petri dish) consisted of a tape (Tesa, Double-Sided Tape Universal, Brussels, Belgium) with one side glued to a rigid plastic sheet and the other side ready to be exposed to the air after removing the protective film. It was pinned onto a piece of expanded polystyrene fixed on a wooden support at 1 m from the ground. Spore traps (3 per site) were installed in the two sites known to be infected by F. inzengae (site 2, Louette-Saint-Pierre and site 7, Spa, Figure 1). In Spa, several basidiocarps of F. inzengae were present on a living tree and the spore traps were placed around this tree (in 3 directions, at ~0.5 m from the trunk) for the two years of trapping. In Louette-Saint-Pierre, in 2022, spore traps were placed around a log bearing basidiocarps and laying on the ground after trunk breaking. Unfortunately, the infected log was removed by forest managers during the winter of 2022–2023. Therefore, in 2023, the spore traps were placed around the remaining base of the broken tree. Spore trapping experiments were carried out from April to July of each year. The tapes were replaced every two weeks. At the end of each collection period, the tapes were collected in separate sterile Petri dishes and stored at −20 °C until further processing.

2.4. DNA Extraction

Mycelium plugs were placed on cellophane laid on an MEA 2% medium. After ~10 days at 25 °C, ~100 mg of mycelium was collected in a 2 mL tube and ground with 5 mm stainless steel beads in a Retch mixer mill MM200 (Verder Scientific Benelux, Aartselaar, Belgium) (30 Hz, 1 min). Context tissues from basidiocarps were ground in liquid nitrogen. DNA extraction was performed from ground mycelium or basidiocarp and from wood sawdust using the NucleoSpin Plant II kit (Macherey–Nagel, Düren, Germany) according to the manufacturer’s instructions. DNA concentration and purity were estimated by measuring absorbance at 260 and 280 nm using a Biospectrometer (Eppendorf, Hamburg, Germany).
In order to extract DNA from spore traps, 8 mL TE 4× [Tris 40 mM pH 8.0, EDTA 4 mM] heated to 65 °C were placed in the Petri dish containing the collection unit as recommended by Garbelotto et al. [26]. The spores were recovered by scrapping the sticky paper with a spatula. The spore suspension was collected in a 50 mL Falcon tube. The operation was repeated with 8 mL TE 4×. After centrifugation (4000× g, 1 h), 14 mL of supernatant was removed and the pellet was resuspended in the remaining 2 mL of TE 4×. The suspension was divided into two 1.5 mL tubes and centrifuged for 5 min at 15,500× g. The pellets were resuspended in 200 µL of TEX lysis buffer [100 mM Tris pH 8.0, 20 mM EDTA, 1.4 mM NaCl, 2% CTAB, 2% PVPP-K30] pre-warmed at 65 °C. The contents of the two tubes (400 µL) were transferred into one tube. DNA extraction was performed using the High Pure PCR Template Preparation kit (Roche Diagnostics, Mannheim, Germany) after a lysis step for 90 min at 65 °C with 10 µL proteinase K from the extraction kit.

2.5. Real-Time PCR and Conventional PCR

Polymorphic DNA regions for F. fomentarius detection were identified after alignment of ITS sequences of the 4 lineages described by Peintner et al. [21] (accession numbers JX290073, MH114657, EU273503, GQ184602, KM360129, MG719676, JX183719, HM584810, KC505546, GU203514, JQ901966 and JF927720) as well as ITS sequences from closely related fungal species in the Polyporales order (Fomes fasciatus, Trametes versicolor, Ganoderma applanatum and Fomitopsis pinicola). Using Primer3Plus software (https://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi, accession date: 28 January 2021), primers and dual-labelled probes were then selected in these polymorphic regions to detect all lineages (test 1) or the lineages Fomes sp. from Asia and the species F. inzengae (test 2) (Table 2). The in silico specificity of the primers and probes selected was verified against the universal GenBank database.
Real-time PCRs were performed in a total volume of 20 µL on an ABI7000 thermocycler (Life Technologies, Merelbeke, Belgium) using the FastGen Probe 2XqPCR Universal (Nippon Genetics Europe, Düren, Germany). The reaction mixture contained 1× reaction buffer, primers and probe at 0.25 µM and the fluorophore Rox (0.5 µM). The thermal regime consisted of a denaturation at 95 °C for 3 min followed by 40 cycles of denaturation at 94 °C for 15 s and hybridization at 64 °C (test 1) or 56 °C (test 2) for 1 min. The fluorescence threshold line was adjusted manually at 0.3 in each PCR run. The limit of detection of the two qPCR methods was determined from serial dilutions (from 1 ng to 1 fg) of fungal DNA (two isolates of F. fomentarius s.s. and two isolates of F. inzengae) considering 3 replicates for each DNA concentration level. To assess the specificity of the molecular tests developed, the qPCRs were carried out on DNA from pure cultures of F. fomentarius s.s. and F. inzengae as well as from DNA of other fungal species extracted from pure cultures or basidiocarps (Table 3)
Nested conventional PCRs using the first set of primers ITS1F/ITS4 [28,29] (Table 2) and the second set of primers FfomF and FfomR developed by Parfitt et al. [27] for the detection of F. fomentarius s.l. (Table 2) were conducted on sawdust collected from beech wood. Conventional PCRs with the primers ITS5 and ITS4 [29] (Table 2) were carried out on DNA from fungal pure cultures. The PCR mixture contained 1× GoTaq Flexi buffer (Promega Madison, Madison, MI, USA), 1.5 mM MgCl2, 0.2 mM dNTPs, 0.2 µM of the forward and reverse primers, 1 U Taq DNA polymerase and 3 µL genomic DNA. For the PCR with primers FfomF/FfomR, the amplification products from the first PCR were diluted 10 times prior to the second PCR. Amplifications were performed on a T100 thermocycler (Bio-Rad, Nazareth, Belgium) in a total volume of 50 µL. The thermocycler profile consisted in a denaturation for 5 min at 95 °C, 40× (30 s at 94 °C, 30 s at the annealing temperature, 1 min at 72 °C) and a final extension at 72 °C for 10 min. The annealing temperatures were 55 °C for ITS1F/ITS4, 52 °C for ITS5/ITS4 and 60 °C for FfomF/FfomR, respectively. The PCR products were sequenced in both directions at Eurofins Genomics (France). The sequences were assembled with BioEdit v 7.1.3.0 [30] The sequences generated with primers ITS5 and ITS4 from F. inzengae pure cultures (isolates 5704 and 5711) were deposited in GenBank (GenBank accessions numbers OR473259 and OR473260).

2.6. Growth Rates at Different Temperatures

For each species (F. fomentarius s.s. and F. inzengae), one monokaryotic and one dikaryotic isolate were used (respectively F. fomentarius s.s. isolate 5705 from site 5 and 5706 from site 10, and F. inzengae isolate 5711 from site 2 and 5704 from site 7). The four isolates were first grown on 2% MEA with sawdust (10 g/L) to maintain their decaying capacities. Mycelium plugs (6 mm) were taken at the margin of one-week old culture, transferred onto MEA 2% and placed at 25 °C. After three days, this period being required to observe growth for all isolates, the Petri dishes were placed at eight different temperatures (10, 15, 20, 25, 30, 32, 35 and 37 °C). There were five replicates per treatment (isolate/temperature). Mean growth rate was measured every day using two predefined directions on the Petri dish.

2.7. Wood Degradation

The entire wood degradation test is based on NBN EN-113-2 [31] using mass losses as an expression of the virulence of the fungus. The same strains as those used for the growth test at different temperatures were selected. Trametes versicolor (L.) Lloyd (EN-standard wood decay fungus—CTB 863 A strain) was used as a control. All isolates were maintained on 2% MEA with sawdust. Beech wood specimens (50 × 25 × 15 mm) were made from a freshly cut beech tree. They were compared to beech specimens stored during 10 years at 2–4 °C. Twelve specimens of both types were used for each fungal isolate. They were oven dried at 103 ± 3 °C for 24 h, weighed (M1) and stored in a conditioning chamber (25 ± 2 °C and 65 ± 5% relative humidity (RH) for 4 weeks. During the conditioning period of the wood specimens, mycelium plugs of the different fungi were placed on 50 mL of MEA 2% in Kolle flasks (approximate container capacity of 605 mL). When the mycelium had completely covered the surface of the medium, wood specimens sterilized twice at 24 h of interval for 20 min at 121 °C were placed in the Kolle flask on a thin glass support to avoid direct contact with the medium. All the specimens were incubated at 25 ± 2 °C and 65 ± 5% RH for 16 weeks. At the end of the incubation time, the wood specimens were weighted (Mw), cleaned of the mycelium that had proliferated on the surface and dried at 103 °C for 24 h. They were then weighed (M2). The mass loss (ML) and moisture content (MC) were calculated using the following equations:
ML (%) = ((M1 − M2)/M1) × 100
MC (%) = ((Mw − M2)/M2) × 100

2.8. Statistical Analysis

All the analyses were carried out with R software (version 4.2.1) [32] with the packages dplyr [33], DescTools [34], car [35], multcomp [36], ARTool [37] and ggplot2 [38]. When descriptive statistics are presented, they are always expressed as means ± standard deviations. The significance level α = 0.05 was used for all the tests. Statistical assumptions were verified. The difference in colony growth of F. fomentarius and F. inzengae at different temperatures were analyzed using a one-way ANOVA and a Tukey’s test. Concerning the beech wood decaying test, non-parametric tests (Aligned ranks transformation ANOVA in the initial model and Kruskal–Wallis one-way analysis of variance supported by pairwise comparisons for the second one) were used to highlight differences between the two variables (type of wood and biological activity of the different isolates).

3. Results

3.1. Design of Primers and Dual-Labelled Probes for the Detection of F. fomentarius s.l. and F. inzengae/Fomes sp. from Asia and Survey in Belgian Beech Forests

Primers and dual-labelled probes were designed from sequences of F. fomentarius s.l (test 1) and F. inzengae/Fomes sp. from Asia (test 2) available in public DNA databases. The two qPCRs were applied on DNA from the 148 Fomes fomentarius s.l. isolates available (46 monokaryotic isolates, and 102 dikaryotic isolates) collected in 12 Belgian beech forests. All the samples were positive with test 1. Two results were positive with test 2, one corresponding to a monokaryotic isolate originating from a trunk on the ground in Louette-Saint-Pierre (site 2, isolate 5711), and one dikaryotic isolate originating from a standing tree in Spa (site 7, isolate 5704). By sequencing the amplification products generated with primers ITS5 and ITS4 from these two isolates, the sequences corresponded to F. inzengae.
Molecular tests (test 1 and test 2) were carried out on the five F. fomentarius basidiocarps present on the trunk of the tree from which dikaryotic strain 5704 had been isolated in Spa. Only three of the 5 basidiocarps were positive with test 2, demonstrating F. fomentarius s.s. and F. inzengae were present on the same tree.

3.2. Performance of the qPCR Methods Developed for the Detection of F. fomentarius s.l. and the Lineages F. inzengae/Fomes sp. from Asia

Pure cultures of F. fomentarius s.s. and F. inzengae obtained from the survey carried out in Belgian beech forests were used to evaluate the performance of the two qPCR methods. Standard curves from 10-fold dilution series were generated using DNA from isolates 5705 and 5706 (F. fomentarius s.s.) and from isolates 5704 and 5711 (F. inzengae). As shown in Table 4, the tests were linear over 6 logs. The limit of detection corresponding to the smallest concentration of DNA detected in all replicates was 10 fg per PCR for the two tests. There was no clear difference in Cq values between F. fomentarius s.s. and F. inzengae with the test targeting all lineages of F. fomentarius (test 1). The test targeting the lineages Fomes sp. from Asia and F. inzengae (test 2) did not detect the European isolates of F. fomentarius (lineage F. fomentarius s.s.). The two tests were specific (no amplification from DNA of other fungal species listed in Table 3)).

3.3. Identification of Fomes inzengae as an Endophyte in Belgian Beech Forests

Wood disks (n = 144) collected from 36 standing beech trees that did not display any wood discoloration, sporocarps, nor decay in the wood at the time of harvest were analyzed with the qPCR methods developed after an incubation of 24 weeks at 20–22 °C. F. fomentarius s.l. was detected in 22 samples out of the 144 analyzed. These samples belonged to 16 of the 36 beech trees. There were two positive trees in Beauraing, six in La Roche, and eight in Saint-Hubert. Among the positive trees, 12 corresponded to saplings. Positive results were obtained from wood disks collected at the base of the tree, at the base of the crown or at both positions. The qPCR targeting the lineages Fomes sp. Asia and F. inzengae (test 2) revealed one positive result. The corresponding sample was also positive with test 1 and originated from a mature tree in Saint-Hubert. The Cq value generated with the test targeting F. fomentarius s.l. (test 1) for this sample was very low (Cq = 22.04) compared to the Cq values generated for the other samples (Cq values ranging from 33.03 to 39.12). This difference in Cq values corresponds to a DNA concentration of approximately 3–4 orders of magnitude. As the amplification product generated with primers FinzF3/FinzR3 on this DNA sample was too short for Sanger Sequencing, and was not in a polymorphic region, a nested conventional PCR with the primers ITS1F/ITS4 and FfomF/FfomR was carried out to find out if the identified lineage corresponded to F. inzengae or to Fomes sp. Asia. The sequence of the amplification product corresponded to F. inzengae.

3.4. Periods of Spore Release

Spore traps were installed in 2022 and 2023 in the two beech stands where F. inzengae had been isolated. As shown in Figure 3, differences were observed in 2022 between the two sites with a peak in May in Louette-Saint-Pierre, and a peak in June in Spa. Spores were detected during each collection period. However, the release of spores was very low in April and at the beginning of May 2022 for both sites. In 2023, the source of inoculum in Louette-Saint-Pierre was unfortunately removed and there was no detection. In Spa, the peak of spore release was observed in June as in 2022. However, the mean amount of DNA detected in 2023 was around 100 times higher than that detected in 2022. Very large variations in the amount of DNA detected on the various spore traps were observed for all the collection periods.

3.5. Growth at Different Temperatures for F. inzengae and F. fomentarius s.s.

All the isolates were incubated for 3 days at 25 °C to allow growth to resume on the culture medium before incubation at the various test temperatures. After four days at 32 °C (corresponding to 7 days on the medium), the mycelium of F. inzengae isolate 5711 had reached the edge of the Petri dish. The growth measurements were therefore interrupted after three days for all the treatments. As shown on Figure 4, significant differences (p-value < 0.001) were observed between the two fungal species after 3 days in culture, with the F. inzengae isolates growing faster than F. fomentarius s.s. isolates at 35 and 37 °C while the F. fomentarius s.s. isolates grew faster than isolates of the other species at 10 °C. The situation was less contrasted between 15 and 32 °C. Although there was no significant difference between species, some differences existed between isolates from the same species. The F. fomentarius s.s. dikaryotic isolate (5706) generally grew faster than the monokaryotic isolate (5705), with significant differences at 30, 32 and 35 °C (p-value < 0.001). The opposite trend was observed for F. inzengae, with the monokaryotic isolate (5711) growing faster from 15 to 30 °C (p-value < 0.001) but showing similar growth values at 32, 35, and 37 °C. From 15 to 30 °C, the F. inzengae monokaryotic isolate 5711 displayed a higher growth rate than the three other isolates. Optimum growth temperature for all strains was 32 °C.

3.6. Wood Degradation

After 16 weeks of incubation, the mycelium of the two F. fomentarius lineages had covered the wood specimen in all the Kolle flasks, without contamination of other species (Figure 5). Three wood samples had moisture contents that were considered abnormal according to the NBN EN-113 protocol (<25% or >100% of MC). These were one sample of isolate 5704 (118.73% of MC) and two samples of isolate 5711 (21.85% and 22.2% of MC). They were removed from the data set for the statistical analysis. The mean mass loss for the reference isolate T. versicolor was 29.35 ± 2.81% when the norm requires more than 20%. The average density of the wood specimens tested was 703 ± 31.95 kg/m3.
As there was no significant difference between green and old wood material as well as no interaction between the variables “type of wood” and “fungal isolates” (p-value > 0.05), the replicates from the two types of material were combined for the analysis. Significant differences in mass loss were observed between the different fungal isolates (p-value < 0.001) (Figure 6). The monokaryotic isolate of F. fomentarius induced the lowest mass loss (9.39 ± 4.74%, p-value < 0.001) while the dikaryotic isolate of F. inzengae induced the highest mass loss (38.81 ± 10.72%, p-value < 0.01). The other isolates did not differ significantly regarding mass loss (F. inzengae monokaryotic isolate: 29.18 ± 7.88%; T. versicolor, 29.35 ± 2.81% and F. fomentarius dikaryotic isolate: 31.09 ± 3.53%). An important variability was observed between replicates of the two isolates of F. inzengae (monokaryotic and dikaryotic). Such a variability was not observed for the F. fomentarius s.s. isolates nor for the reference isolate T. versicolor. There was no correlation between the density of the wood samples used and the mass loss measured (r = −0.06), indicating that the nature of the wood is not involved.

4. Discussion

4.1. Rapid Detection Tools for Two Species of the F. fomentarius s.l. Complex

Cryptic fungal species are common among forest pathogens [21,39,40]. These species are difficult to distinguish based on macroscopic morphological characteristics. They may therefore go unnoticed during monitoring based on visual observations in the forest. In the case of invasive pathogens, their similarity to native species can delay their detection or allow them to be introduced into a new geographical area [41,42]. As an example, the exotic species Heterobasidion irregulare originating from North America and detected in Italy [43] is very similar to the native species Heterobasidion annosum. However, the two species have different ecological characteristics [44] which led EPPO to place H. irregulare on its alert list in 2013, and then on its A2 list in 2015.
The F. fomentarius species complex comprises two lineages, known as genotype A and genotype B and, for each of these lineages, two sublineages (A1 and A2, and B1 and B2) [45]. As part of a phylogenetic study of a large number of ITS sequences from isolates from various geographical origins, two of these sublineages were renamed: F. fomentarius s.s. corresponds to sublineage A2 while F. inzengae corresponds to sublineage B2 [21]. Although they have different micro-morphological characteristics, distinguishing lineages A and B on a visual basis is difficult [24]. Polymorphisms in the ITS sequence make it possible to identify them, but sequencing the ITS zone requires the isolation of a pure strain if specific PCR primers are not available, which is time-consuming and not always possible, particularly when the fungus is in a latent form in the wood. Direct observation of spores under the microscope is also inappropriate method to detect airborne basidiospores using spore traps as spores of different fungi are present in a mixture making detection based on a non-specific method unreliable. In this study, two qPCR tests were developed, one to detect all the lineages of the F. fomentarius complex (genotypes A and B), and the other to detect the lineage Fomes sp. from Asia and F. inzengae (genotype B only). The benefit of these two tests is that they are very rapid and can be applied to wood and basidiocarps, as well as to environmental DNA samples, notably from spore traps. They are therefore suitable for surveillance in forests. Both tests are highly sensitive (detection limit at 10 fg/PCR), which means they can be used for early detection.

4.2. Fomes inzengae Is Present in Beech Wood in Belgian Forests

Using the molecular tools developed, monitoring has been conducted in Belgium in the Ardennes area where beech is broadly distributed, particularly in the form of pure forest stands. Although not very common, F. inzengae has been identified from basidiocarps collected from living beech trees, but also from broken beeches (trunk). To our knowledge, this is the first report of this species in Belgium. This fungus has been reported in Europe, notably in England, Italy, Latvia, Slovakia and Slovenia [46], Spain [47] and the Czech Republic [24]. It is capable of infecting various hardwood species, but rarely infects beech trees, unlike F. fomentarius s.s. which is prevalent on beeches [21]. Our work confirms this result, since only two of the 148 isolates tested (monokaryotic and dikaryotic) belong to the species F. inzengae, the others (N = 146) corresponding to the species F. fomentarius s.s.. However, the two isolates of F. inzengae were found in two different sites out of the twelve selected and in contrasting geographical areas (Figure 1). Interestingly, basidiocarps of both species were sometimes present on the same tree, demonstrating their co-existence on the same substrate.
Like F. fomentarius s.s. [15], F. inzengae behaves like an endophyte. However, unlike F. fomentarius s.s., it was not identified in undecayed wood from young trees in our study. This result may be due to the low number of trees tested (36 trees) limiting the probability of identifying this fungus given its infrequent occurrence on beech. Its identification in the wood of a mature tree suggests that it might had been present in the wood for several years.

4.3. Aerial Inoculum of F. inzengae Varies Greatly from Year to Year

Passive spore traps consisting of double-sided adhesive tape (gravity sampling) have already been described, notably for pollen sampling [48]. These spore traps are inexpensive. They can therefore be deployed in large numbers on forest sites, which is not possible with Burkard samplers. They are also very simple to install in the forest, meaning that they can be manipulated by people with no specific experience of handling spore traps, like foresters. Moreover, the film protecting the adhesive being removed in the forest at the time of trapping, the risk of contamination is limited. They are therefore easier to use than horizontal slides or membranes coated with a sticky compound. They are also very resistant to humid conditions in contrast to filter papers which can show physical degradation when dampened [26]. Finally, they can be maintained on a site for several days (15 days in our experiment), which is not possible with rotorods, which generally operate for one or two days [49]. Essentially relying on gravity sampling, they are less efficient than impaction spore traps and not suitable for accurate quantitative detection. However, the objective of the experiment was to characterize the period of spore release of F. inzengae in forest sites where the species had already been detected. Moreover, the spore traps were placed near the inoculum source (basidiocarps), to insure an inoculum level sufficient to be detected by a very simple trapping device. This hypothesis was confirmed as F. inzengae DNA was detected at different periods of the growing season, in variable concentrations depending on the collection dates, the site location and the position of the spore trap. DNA concentrations were extremely variable among sampling points, suggesting that several replicates have to be used to detect an airborne inoculum. Unlike 2022, no detection occurred in 2023 in Louette-Saint-Pierre. The removal of the main source of inoculum during the winter of 2022–2023 probably explains this result and suggests that most of the spores collected on the spore traps were from the infected material located near the spore trap, and not from spores originating from other sources of inoculum.

4.4. Fomes inzengae and F. fomentarius s.s. Display Different Ecological Characteristics

The tests on growth at different temperatures, and on wood degradation, were conducted on only two F. inzengae isolates because these isolates were the only ones identified on beech in Belgium as part of the surveillance programme.
In terms of growth characteristics, our results are consistent with those of Peintner et al. [21]. F. fomentarius s.s. grows much better at low temperatures (10 °C in our case), whereas F. inzengae displays a higher growth rate at temperatures ranging from 30 to 35 °C.
In terms of wood degradation, the NBN EN-113 was followed as it is the standard usually used to evaluate the degradation capacity of wood decay fungi [50]. The results obtained with the reference strain of T. versicolor (20% minimum of mass loss) indicate that the test was carried out correctly and that the data are reliable.
Both F. inzengae isolates showed contrasting behavior, and it was not possible to demonstrate any significant difference in mass loss between the two species (F. fomentarius s.s. and F. inzengae). Our results are consistent with those of Cristini et al. [47] even though a different experimental protocol was followed, particularly with regard to the size of the wood samples and the incubation period. However, a difference between species appeared in terms of response repeatability. Indeed, both F. inzengae isolates showed large variations in mass loss depending on the replicate considered, whereas this phenomenon was not observed in F. fomentarius s.s. and T. versicolor. The maximum values of wood degradation were also the highest for the two F. inzengae isolates (45.5 and 55.5% respectively compared to 32.4 and 38.8% for F. fomentarius s.s.), suggesting that F. inzengae might degrade beech wood more actively. This hypothesis is reinforced by the results of the experiment aiming to evaluate the presence of F. inzengae as an endophyte where wood disks infected with F. inzengae were found to be highly concentrated in DNA from this fungal species while wood disks infected with F. fomentarius s.s. displayed a very low concentration of F. fomentarius s.s. DNA. As both species are detected with the same efficiency with the qPCR test 1, this result suggests that the F. inzengae isolate naturally present in wood disks was more active in colonizing beech wood than that of F. fomentarius s.s..

5. Conclusions

The native species F. fomentarius s.s. and the Mediterranean species F. inzengae were found in the same environment (pure stands of European beech) indicating that there is potentially direct competition between both species. Currently, the Mediterranean species is not frequent in the beech forests of the Ardennes, and the number of isolates per site remains limited, suggesting that it behaves as a non-invasive colonizer. However, this situation could change in the future in the context of climate change as F. inzengae is more adapted to higher temperatures. Moreover, these higher temperatures might at the same time increase vulnerability of beech and favor a switching from endophytic to pathogenic behavior. This could lead to the replacement of the native species by F. inzengae. Future studies should clarify the potential increase of F. inzengae occurrence in European beeches as well as in other forest species and its impact on wood degradation in standing trees.

Author Contributions

Conceptualization: A.C.; Methodology: A.C, B.J., S.P., S.S.; Formal analysis: S.P., F.T., V.G., C.V.; Investigation: S.P., F.T.; Writing-original draft preparation: S.P.; Writing-review & editing: C.V., J.-M.H., A.C.; Supervision: A.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was carried out within the framework of the “Forest Health in Wallonia” project (funding numbers = C1U03.MLDO 02, C1U03.MLDO 03, C1U3.MLDO 04 & C1U03.MLDO 05) funded by the Public Service of Wallonia (Belgium).

Data Availability Statement

The data are available upon request from the corresponding author.

Acknowledgments

The authors are grateful to the Walloon Observatory of Forest Health (Walloon Public Service) for its support.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Bolte, A.; Czajkowski, T.; Kompa, T. The north-eastern distribution range of European beech—A review. Forestry 2007, 80, 413–429. [Google Scholar] [CrossRef]
  2. Caudullo, G.; Welk, E.; San-Miguel-Ayanz, J. Chorological maps for the main European woody species. Data Brief 2017, 12, 662–666. [Google Scholar] [CrossRef] [PubMed]
  3. Alderweireld, M.; Burnay, F.; Pitchugin, M.; Lecomte, H. Inventaire Forestier Wallon—Résultats 1994–2012; SPW: Jambes, Belgium, 2015; pp. 48–61. ISBN 978-2-8056-0171-2. [Google Scholar]
  4. Scharnweber, T.; Manthey, M.; Criegee, C.; Bauwe, A.; Schröder, C.; Wilmking, M. Drought matters—Declining precipitation influences growth of Fagus sylvatica L. and Quercus robur L. in north-eastern Germany. For. Ecol. Manag. 2011, 262, 947–961. [Google Scholar] [CrossRef]
  5. Latte, N.; Lebourgeois, F.; Claessens, H. Growth partitioning within beech trees (Fagus sylvatica L.) varies in response to summer heat waves and related droughts. Trees 2016, 30, 189–201. [Google Scholar] [CrossRef]
  6. Latte, N.; Perin, J.; Kint, V.; Lebourgeois, F.; Claessens, H. Major Changes in Growth Rate and Growth Variability of Beech (Fagus sylvatica L.) Related to Soil Alteration and Climate Change in Belgium. Forests 2016, 7, 174. [Google Scholar] [CrossRef]
  7. Pirronitto, S.; Teng, F.; Chandelier, A. Le dépérissement du hêtre en Ardenne: Résultat d’une étude menée de 2019 à 2022. Forêt.Nature 2023, 164, 35–42. [Google Scholar]
  8. Zimmermann, J.; Hauck, M.; Dulamsuren, C.; Leuschner, C. Climate Warming-Related Growth Decline Affects Fagus sylvatica, But Not Other Broad-Leaved Tree Species in Central European Mixed Forests. Ecosystems 2015, 18, 560–572. [Google Scholar] [CrossRef]
  9. Arend, M.; Link, R.M.; Zahnd, C.; Hoch, G.; Schuldt, B.; Kahmen, A. Lack of hydraulic recovery as a cause of post-drought foliage reduction and canopy decline in European beech. New Phytol. 2022, 234, 1195–1205. [Google Scholar] [CrossRef]
  10. Langer, G.J.; Buβkamp, J. Vitality loss of beech: A serious threat to Fagus sylvatica in Germany in the context of global warming. J. Plant Dis. Prot. 2023, 130, 1101–1115. [Google Scholar] [CrossRef]
  11. Neycken, A.; Scheggia, M.; Lévesque, M. Long term growth decline precedes sudden crown dieback of European beech. Agric. For. Meteorol. 2022, 324, 109103. [Google Scholar] [CrossRef]
  12. Gilmartin, E.C.; Jusino, M.A.; Pyne, E.J.; Banik, M.T.; Lindner, D.L.; Boddy, L. Fungal Endophytes and Origins of Decay in Beech (Fagus Sylvatica) Sapwood. Fungal Ecol. 2022, 59, 101161. [Google Scholar] [CrossRef]
  13. Srivastava, S.; Kumar, R.; Singh, V.P. Wood Decaying Fungi; Lambert Academic Publishing: Saarbrücken, Germany, 2013; p. 76. ISBN 978-3659326370. [Google Scholar]
  14. Phillips, D.H.; Burdekin, D.A. Diseases beech (Fagus sylvatica). In Diseases of Forest and Ornamental Trees; Phillips, D.H., Burdekin, D.A., Eds.; The Macmillan Press Ltd.: London, UK; Basingstoke, UK, 1992; pp. 259–271. ISBN 978-1-349-10955-5. [Google Scholar]
  15. Baum, S.; Sieber, T.N.; Schwarze, F.W.M.R.; Fink, S. Latent infections of Fomes fomentarius in the xylem of European beech (Fagus sylvatica). Mycol. Prog. 2003, 2, 141–148. [Google Scholar] [CrossRef]
  16. Boddy, L.; Rayner, A.D.M. Origins of decay in living deciduous trees: The role of moisture content and a re-appraisal of the expanded concept of tree decay. New Phytol. 1983, 94, 623–641. [Google Scholar] [CrossRef]
  17. Judova, J.; Dubikova, K.; Gaperova, S.; Gaper, J.; Pristas, P. The occurrence and rapid discrimination of Fomes fomentarius genotypes by ITS-RFLP analysis. Fungal Biol. 2012, 116, 155–160. [Google Scholar] [CrossRef] [PubMed]
  18. McCormick, M.A.; Grand, L.F.; Post, J.B.; Cubeta, M.A. Phylogenetic and Phenotypic Characterization of Fomes Fasciatus and Fomes Fomentarius in the United States. Mycologia 2013, 105, 1524–1534. [Google Scholar] [CrossRef] [PubMed]
  19. Pristas, P.; Gaperova, S.; Gaper, J.; Judova, J. Genetic variability in Fomes fomentarius reconfirmed by translation elongation factor 1-α DNA sequences and 25S LSU rRNA sequences. Biologia 2013, 68, 816–820. [Google Scholar] [CrossRef]
  20. Dresch, P.; D’Aguanno, M.N.; Rosam, K.; Grienke, U.; Rollinger, J.M.; Peintner, U. Fungal strain matters: Colony growth and bioactivity of the European medicinal polypores Fomes fomentarius, Fomitopsis pinicola and Piptoporus betulinus. AMB Express 2015, 5, 4. [Google Scholar] [CrossRef]
  21. Peintner, U.; Kuhnert-Finkernagel, R.; Wille, V.; Biasioli, F.; Shiryaev, A.; Perini, C. How to resolve cryptic species of polypores: An example in Fomes. IMA Fungus 2019, 10, 17. [Google Scholar] [CrossRef]
  22. Garrido-Benavent, I.; Velasco-Santos, J.M.; Perez-de-Gregoria, M.A.; Pasaban, P.M. Fomes inzengae (Ces. & De Not.) Cooke en la Península Ibérica. Butll. Soc. Micol. Valencia 2020, 24, 151–170. [Google Scholar]
  23. Náplavová, K.; Gáper, J.; Gáperová, S.; Beck, T.; Pristaš, P.; Soares, C.; Lima, N. Genetic and plant host differences of Fomes fomentarius in selected parts of Southern Europe. Plant Biosyst. 2020, 154, 125–127. [Google Scholar] [CrossRef]
  24. Tomṡovsky, M.; Kaeochulsri, S.; Kudláček, T.; Dálya, L.B. Ecological, morphological and phylogenetic survey of Fomes fomentarius and F. inzengae (Agaricomycetes, Polyporaceae) co-occuring in the same geographic area in Central Europe. Mycol. Prog. 2023, 22, 79. [Google Scholar] [CrossRef]
  25. Van der Perre, R.; Bythell, S.; Bogaert, P.; Claessens, H.; Ridremont, F.; Tricot, C.; Vincke, C.; Ponette, Q. La carte bioclimatique de Wallonie: Un nouveau découpage écologique du territoire pour le choix des essences forestières. Forêt. Nature 2015, 135, 47–58. [Google Scholar]
  26. Garbelotto, M.; Smith, T.; Schweigkofler, W. Variation in Rates of Spore Deposition of Fusarium circinatum, the Causal Agent of Pine Pitch Canker, over a 12-Month-Period at Two Locations in Northern California. Phytopathology 2008, 98, 137–143. [Google Scholar] [CrossRef] [PubMed]
  27. Parfitt, D.; Hunt, J.; Dockrell, D.; Rogers, H.; Boddy, L. Do all trees carry the seeds of their own destruction? PCR reveals numerous wood decay fungi latently present in sapwood of a wide range of angiosperm trees. Fungal Ecol. 2010, 3, 338–346. [Google Scholar] [CrossRef]
  28. Gardes, M.; Bruns, T.D. ITS primers with enhanced specificity for basidiomycetes: Application to the identification of mycorrhizae and rusts. Mol. Ecol. 1993, 2, 113–118. [Google Scholar] [CrossRef]
  29. White, T.J.; Bruns, T.D.; Lee, S.B.; Taylor, J.W. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: Cambridge, MA, USA, 1990; pp. 315–322. ISBN 978-0-12-372180-8. [Google Scholar]
  30. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  31. NBN EN 113-2; Durability of Wood and Wood-Based Products—Test Method Against Wood Destroying Basidiomycetes—Part 2: Assessment of Inherent or Enhanced Durability. European Committee for Standardization: Brussels, Belgium, 2021.
  32. R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2021; Available online: https://www.R-project.org/ (accessed on 2 February 2023).
  33. Wickham, H.; François, R.; Henry, L.; Müller, K. dplyr: A Grammar of Data Manipulation. R Package Version 0.8.0.1. 2019. Available online: https://CRAN.R-project.org/package=dplyr (accessed on 2 February 2023).
  34. Signorell, A. DescTools: Tools for Descriptive Statistics. Available online: https://cran.r-project.org/web/packages/DescTools/index.html (accessed on 2 February 2023).
  35. Fox, J.; Weisberg, S.; Price, B. Car: Companion to Applied Regression. Available online: https://cran.r-project.org/web/packages/car/index.html (accessed on 2 February 2023).
  36. Hothorn, T.; Bretz, F.; Westfall, P. Simultaneous Inference in General Parametric Models. Biom. J. 2008, 50, 346–363. [Google Scholar] [CrossRef]
  37. Kay, M.; Elkin, L.A.; Higgins, J.J.; Wobbrock, J.O. mjskay/ARTool: ARTool 0.11.0 (v0.11.0). Available online: https://zenodo.org/records/4721941 (accessed on 2 February 2023).
  38. Wickham, H. ggplot2: Elegant Graphics for Data Analysis, 2nd ed.; Springer: New York, NY, USA, 2016; p. 260. ISBN 978-3-319-24277-4. Available online: https://ggplot2.tidyverse.org (accessed on 2 February 2023).
  39. Faticov, M.; Desprez-Loustau, M.L.; Levente, K.; Massot, M.; Faivre d’Acier, J.; Mutz, J.; Nemeth, M.Z.; Roslin, T.; Tack, A.J.M. Niche differentiation within a cryptic pathogen complex: Climatic drivers and hyperparasitism at multiple spatial scales. Ecography 2022, 2, e06062. [Google Scholar] [CrossRef]
  40. Wang, R.; Tsui, C.K.M.; You, C. Cryptic species diversity and phylogenetic relationship in the rust Genus Chrysomyxa from China. J. Fungi 2022, 8, 83. [Google Scholar] [CrossRef]
  41. Sakalidid, M.L.; Slippers, B.; Wingfield, B.D.; Hardy, G.E.S.J.; Burgess, T.I. The challenge of understanding the origin, pathways and extent of fungal invasions: Global populations of the Neofusicoccum parvum-N. ribis species complex. Divers. Distrib. 2013, 19, 873–883. [Google Scholar] [CrossRef]
  42. Ghelardini, L.; Pepori, A.L.; Luchi, N.; Capretti, P.; Santini, A. Drivers of Emerging Fungal Diseases of Forest Trees. For. Ecol. Manag. 2016, 381, 235–246. [Google Scholar] [CrossRef]
  43. Gonthier, P.; Nicolotti, G.; Linzer, R.; Guglielmo, F.; Garbelotto, M. Invasion of European pine stands by a North American forest pathogen and its hybridization with a native interfertile taxon. Mol. Ecol. 2007, 16, 1389–1400. [Google Scholar] [CrossRef] [PubMed]
  44. Gonthier, P.; Guglielmo, L.; Giordano, L.; Garbelotto, M. The American forest pathogen Heterobasidion irregulare colonizes unexpected habitats after its introduction in Italy. Ecol. Appl. 2012, 22, 2135–2143. [Google Scholar] [CrossRef] [PubMed]
  45. Badalyan, S.; Zhuykova, E.; Mukhin, V. The Phylogenetic Analysis of Armenian Collections of Medicinal Tinder Polypore Fomes Fomentarius (Agaricomycetes, Polyporaceae). Ital. J. Mycol. 2022, 51, 23–33. [Google Scholar] [CrossRef]
  46. Badalyan, S.; Zhuykova, E.; Mukhin, V. Genetic variability of the medicinal tinder bracket polypore, Fomes fomentarius (Agaricomycetes), from the Asian part of Russia. Int. J. Med. Mushrooms 2018, 20, 561–568. [Google Scholar]
  47. Cristini, V.; Nop, P.; Zlámal, J.; Vand, M.H.; Šeda, V.; Tippner, J. Fomes Fomentarius and F. inzengae—A Comparison of Their Decay Patterns on Beech Wood. Microorganisms 2023, 11, 679. [Google Scholar] [CrossRef]
  48. Alcazar, P.; Galan, C.; Carinanos, P.; Dominguez-Vilches, E. A new adhesive for airborne pollen sampling in Spain. Aerobiologia 2003, 19, 57–61. [Google Scholar] [CrossRef]
  49. Chandelier, A.; Helson, M.; Dvorak, M.; Gischer, F. Detection and quantification of airborne inoculum of Hymenoscyphus pseudoalbidus using real-time PCR assays. Plant Pathol. 2014, 63, 1296–1305. [Google Scholar] [CrossRef]
  50. Bari, E.; Taghiyari, H.R.; Mohebby, B.; Clausen, C.A.; Schmidt, O.; Tajick Ghanbary, M.A.; Vaseghi, M.J. Mechanical properties and chemical composition of beech wood exposed for 30 and 120 days to white-rot fungi. Holzforschung 2015, 69, 587–593. [Google Scholar] [CrossRef]
Figure 1. Location of the 12 beech stands where F. fomentarius isolates were collected from basidiocarps (numbers from 1 to 12) and of the three additional stands from which wood samples were collected to evaluate the presence of F. fomentarius as an endophyte (letters A, B and C). The bioclimatic area of the Ardennes in Belgium is in green.
Figure 1. Location of the 12 beech stands where F. fomentarius isolates were collected from basidiocarps (numbers from 1 to 12) and of the three additional stands from which wood samples were collected to evaluate the presence of F. fomentarius as an endophyte (letters A, B and C). The bioclimatic area of the Ardennes in Belgium is in green.
Forests 15 00221 g001
Figure 2. Passive spore traps used for the collection of spores of Fomes inzengae in beech stands.
Figure 2. Passive spore traps used for the collection of spores of Fomes inzengae in beech stands.
Forests 15 00221 g002
Figure 3. Spore trapping for the detection of F. inzengae in two beech stands in southern Belgium. The test was conducted in two beech forests (Louette-Saint-Pierre and Spa). Spores were collected at different periods, from April to July, in 2022 and 2023. Collection period = 2 weeks. Each date represents the date the traps were recovered from the sites.
Figure 3. Spore trapping for the detection of F. inzengae in two beech stands in southern Belgium. The test was conducted in two beech forests (Louette-Saint-Pierre and Spa). Spores were collected at different periods, from April to July, in 2022 and 2023. Collection period = 2 weeks. Each date represents the date the traps were recovered from the sites.
Forests 15 00221 g003
Figure 4. Average growth (in mm) after 3 days at different temperatures. The green bars represent the strains of F. fomentarius s.s., while the blue bars represent the strains of F. inzengae. Modalities with the same letters are not significantly different.
Figure 4. Average growth (in mm) after 3 days at different temperatures. The green bars represent the strains of F. fomentarius s.s., while the blue bars represent the strains of F. inzengae. Modalities with the same letters are not significantly different.
Forests 15 00221 g004
Figure 5. (a) Experiment in Kolle flasks to evaluate the wood decaying capacity of two isolates of F. fomentarius s.s. and two isolates of F. inzengae; (b) wood specimen covered with mycelium after 16 weeks of incubation.
Figure 5. (a) Experiment in Kolle flasks to evaluate the wood decaying capacity of two isolates of F. fomentarius s.s. and two isolates of F. inzengae; (b) wood specimen covered with mycelium after 16 weeks of incubation.
Forests 15 00221 g005
Figure 6. Violin plot showing the average mass loss (%) of beech wood specimen (24 replicates per treatment) after 16 weeks of incubation with different wood-decay fungi at 25 °C. The grey dots represent the values observed; the black dots and their error bars represent the mean and standard deviation for each strain. The green, blue and red lines are the density curves for F. fomentarius s.s., F. inzengae and the reference strain T. versicolor, respectively. Modalities with the same letters are not significantly different.
Figure 6. Violin plot showing the average mass loss (%) of beech wood specimen (24 replicates per treatment) after 16 weeks of incubation with different wood-decay fungi at 25 °C. The grey dots represent the values observed; the black dots and their error bars represent the mean and standard deviation for each strain. The green, blue and red lines are the density curves for F. fomentarius s.s., F. inzengae and the reference strain T. versicolor, respectively. Modalities with the same letters are not significantly different.
Forests 15 00221 g006
Table 1. Collection of F. fomentarius s.l. isolates from Belgian beech stands. Numbers in brackets represent locations within the surveillance network. Each isolate was collected from a basidiocarp on a different tree.
Table 1. Collection of F. fomentarius s.l. isolates from Belgian beech stands. Numbers in brackets represent locations within the surveillance network. Each isolate was collected from a basidiocarp on a different tree.
Type of MaterialLocation (Stand Nr)Number of IsolatesCollection Period
MonokaryoticLouette-Saint-Pierre (2)6 aApril 2020
MonokaryoticSéviscourt (3)6April 2020
MonokaryoticSainte-Cécile (4)2April 2020
MonokaryoticNassogne (5)10 bApril 2020
MonokaryoticCarlsbourg (6)2April 2020
MonokaryoticSpa (7)9April 2020
MonokaryoticElsenborn (8)1April 2020
MonokaryoticMogimont (11)1April 2020
MonokaryoticBullange (12)9April 2020
DikaryoticSéviscourt (3)10March 2021
DikaryoticNassogne (5)31March 2021
DikaryoticSpa (7)29 cMarch 2021
DikaryoticVielsalm (9)2March 2021
DikaryoticVaux-Sur-Sure (10)30 dMarch 2021
a,c = F. inzengae & b,d = F. fomentarius s.s. isolates used for qPCR validations, growth rates at different temperatures and test of wood degradation.
Table 2. List of primers and probes used in the study.
Table 2. List of primers and probes used in the study.
TargetPrimer NameSequenceReference
F. fomentarius s.l. (test 1)FomesF55′ ggatgttggaggcttttgct 3′This study
FomesP26-FAM-5′ atcggctgtcggtgtgat 3′-BHQ1
FomesR35′ agctgtctctgacgagaccat 3′
F. inzengae & Fomes sp. (Asia) (test 2)FinzF35′ cgaatctttgaacgcacctt 3′This study
FinzP6-FAM-5′ gccctcgtttgagtcagc 3′-BHQ1
FinzR35′ gcaaggaaccaagctaatgc 3′
F. fomentarius s.l.FfomF5′ gggttgtagctggccttc 3′[27]
FfomR5′ ccagcaaaagcctccaatc 3′
ITS of fungiITS1F5′cttggtcatttagaggaagtaa 3′[28]
ITS55′ ggaagtaaaagtcgtaacaagg 3′[29]
ITS45′ tcctccgcttattgatatgc 3′
Table 3. List of fungal isolates /fungal DNA used to evaluate the specificity of the qPCR methods.
Table 3. List of fungal isolates /fungal DNA used to evaluate the specificity of the qPCR methods.
Fungal SpeciesMaterial
for DNA
Extraction
Collection
Code
Country of
Origin
Collection
Period
Armillaria gallicaMycelium3342France *1993
Bjerkandera adustaMycelium2523Belgium2003
Daedaleopsis confragosaBasidiocarp Belgium2010
Fomes fomentarius s.s.
(monokaryotic)
Mycelium5705Belgium2010
Fomes fomentarius s.s.
(dikaryotic)
Mycelium5706Belgium2021
F. inzengae
(dikaryotic)
Mycelium5704Belgium2021
F. inzengae
(monokaryotic)
Mycelium5711Belgium2021
Fomitopsis pinicolaBasidiocarp Belgium2019
Fusarium solaniMycelium5733Belgium2022
Ganoderma adspersumBasidiocarp Belgium2010
Ganoderma applanatumBasidiocarp Belgium2010
Phytophthroa x cambivoraMyceliumP3398Belgium2005
Picipes badiusBasidiocarp Belgium2010
Trametes versicolorBasidiocarp Belgium2018
Trametes hirsutaBasidiocarp Belgium2018
Trametes versicolorMycelium3561Belgium2018
* Collection INRAE, UMR Biogeco (France).
Table 4. Performances of the 2 qPCR methods developed. LOD = Limit of detection (in fg/PCR).
Table 4. Performances of the 2 qPCR methods developed. LOD = Limit of detection (in fg/PCR).
TestTargetSlopeConstantR2LogLOD
1Fomes fomentarius s.l.−3.36837.3720.999610
2Fomes sp. Asia &
F. inzengae
−3.50640.0980.999610
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Pirronitto, S.; Teng, F.; Verheyen, C.; Gaucet, V.; Henin, J.-M.; Jourez, B.; Schmitz, S.; Chandelier, A. Characterization of Fomes fomentarius s.s. and F. inzengae in Belgian Beech Forests. Forests 2024, 15, 221. https://doi.org/10.3390/f15020221

AMA Style

Pirronitto S, Teng F, Verheyen C, Gaucet V, Henin J-M, Jourez B, Schmitz S, Chandelier A. Characterization of Fomes fomentarius s.s. and F. inzengae in Belgian Beech Forests. Forests. 2024; 15(2):221. https://doi.org/10.3390/f15020221

Chicago/Turabian Style

Pirronitto, Salvatore, Felix Teng, Cécile Verheyen, Vincent Gaucet, Jean-Marc Henin, Benoit Jourez, Sophie Schmitz, and Anne Chandelier. 2024. "Characterization of Fomes fomentarius s.s. and F. inzengae in Belgian Beech Forests" Forests 15, no. 2: 221. https://doi.org/10.3390/f15020221

APA Style

Pirronitto, S., Teng, F., Verheyen, C., Gaucet, V., Henin, J.-M., Jourez, B., Schmitz, S., & Chandelier, A. (2024). Characterization of Fomes fomentarius s.s. and F. inzengae in Belgian Beech Forests. Forests, 15(2), 221. https://doi.org/10.3390/f15020221

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop