Long-Distance Finding of AOD-Related Bacteria in the Natural Environment: Risks to Quercus ilex (L.) in Italy
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling and Bacteria Isolation
2.2. Sample Sequencing and Phylogeny
2.3. Pathogenicity Test
3. Results
3.1. Sampling
3.2. Isolation, Sequencing and Phylogeny
3.3. Pathogenicity Tests
4. Discussion and Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Ruffner, B.; Schneider, S.; Meyer, J.B.; Queloz, V.; Rigling, D. First Report of Acute Oak Decline Disease of Native and Non-native Oaks in Switzerland. New Dis. Rep. 2020, 41, 18. [Google Scholar] [CrossRef]
- EPPO. Recent Studies on Acute Oak Decline, Involving Brenneria goodwinii and Other Bacteria. Available online: https://gd.eppo.int/reporting/article-7365 (accessed on 2 October 2024).
- Fernandes, C.; Duarte, L.; Naves, P.; Sousa, E.; Cruz, L. First Report of Brenneria goodwinii Causing Acute Oak Decline on Quercus suber in Portugal. J. Plant Pathol. 2022, 104, 837–838. [Google Scholar] [CrossRef]
- Zalkalns, O.; Celma, L. The Distribution of Bacteria Gibbsiella quercinecans and Brenneria goodwinii in Oak (Quercus robur L.) Stands in Latvia. IOP Conf. Ser. Earth Environ. Sci. 2021, 875, 012033. [Google Scholar] [CrossRef]
- González, A.J.; Ciordia, M. Brenneria goodwinii and Gibbsiella quercinecans Isolated from Weeping Cankers on Quercus robur L. in Spain. Eur. J. Plant Pathol. 2020, 156, 965–969. [Google Scholar] [CrossRef]
- Tkaczyk, M.; Celma, L.; Ruņģis, D.E.; Bokuma, G. First Report of Brenneria goodwinii and Gibbsiella quercinecans Bacteria, Detected on Weaken Oak Trees in Poland. Balt. For. 2021, 27, 166–169. [Google Scholar] [CrossRef]
- Ostfeld, R.S.; Keesing, F.; Jones, C.G.; Canham, C.D.; Lovett, G.M. Integrative Ecology and the Dynamics of Species in Oak Forests. Integr. Biol. Issues News Rev. 1998, 1, 178–186. [Google Scholar] [CrossRef]
- Parmain, G.; Bouget, C. Large Solitary Oaks as Keystone Structures for Saproxylic Beetles in European Agricultural Landscapes. Insect Conserv. Divers. 2018, 11, 100–115. [Google Scholar] [CrossRef]
- Mölder, A.; Meyer, P.; Nagel, R.-V. Integrative Management to Sustain Biodiversity and Ecological Continuity in Central European Temperate Oak (Quercus robur, Q. petraea) Forests: An Overview. For. Ecol. Manag. 2019, 437, 324–339. [Google Scholar] [CrossRef]
- Manion, P. Tree Disease Concepts, 2nd ed.; Prentice-Hall: Englewood Cliffs, NJ, USA, 1991. [Google Scholar]
- Carluccio, G.; Sabella, E.; Greco, D.; Vergine, M.; Delle Donne, A.G.; Nutricati, E.; Aprile, A.; De Bellis, L.; Luvisi, A. Acute and Chronic Oak Decline in Urban and Forest Ecosystems in Southern Italy. For. Int. J. For. Res. 2024, 97, 739–749. [Google Scholar] [CrossRef]
- Denman, S.; Brown, N.; Kirk, S.; Jeger, M.; Webber, J. A Description of the Symptoms of Acute Oak Decline in Britain and a Comparative Review on Causes of Similar Disorders on Oak in Europe. Forestry 2014, 87, 535–551. [Google Scholar] [CrossRef]
- Strouts, G.R.; Winter, T.G. Diagnosis of Ill-Health in Trees; HMSO: London, UK, 1994. [Google Scholar]
- Ragazzi, A.; Capretti, P.; Ghelardini, L.; Moricca, S. Malattie Delle Piante in Bosco, in Vivaio e Delle Alberature, 1st ed.; Patron: Bologna, Italy, 2020. [Google Scholar]
- Denman, S.; Brady, C.; Kirk, S.; Cleenwerck, I.; Venter, S.; Coutinho, T.; De Vos, P. Brenneria goodwinii sp. nov., Associated with Acute Oak Decline in the UK. Int. J. Syst. Evol. Microbiol. 2012, 62, 2451–2456. [Google Scholar] [CrossRef] [PubMed]
- Brady, C.; Denman, S.; Kirk, S.; Venter, S.; Rodríguez-Palenzuela, P.; Coutinho, T. Description of Gibbsiella quercinecans gen. nov., sp. nov., Associated with Acute Oak Decline. Syst. Appl. Microbiol. 2010, 33, 444–450. [Google Scholar] [CrossRef] [PubMed]
- Denman, S. Symptoms and Identification of Acute Oak Decline. Available online: https://www.forestresearch.gov.uk/tools-and-resources/fthr/pest-and-disease-resources/acute-oak-decline/symptoms-and-identification-of-acute-oak-decline/#:~:text=Acute%20oak%20decline%20is%20a,and%20death%20in%20most%20cases (accessed on 26 June 2024).
- Denman, S.; Kirk, S.; Webber, J. Managing Acute Oak Decline; Forestry Commission: Edinburgh, UK, 2010. [Google Scholar]
- Vansteenkiste, D.; Tirry, L.; Van Acker, J.; Stevens, M. Predispositions and Symptoms of Agrilus Borer Attack in Declining Oak Trees. Ann. For. Sci. 2004, 61, 815–823. [Google Scholar] [CrossRef]
- Brown, N.; Inward, D.J.G.; Jeger, M.; Denman, S. A Review of Agrilus biguttatus in UK Forests and Its Relationship with Acute Oak Decline. Forestry 2015, 88, 53–63. [Google Scholar] [CrossRef]
- Brown, N.; Vanguelova, E.; Parnell, S.; Broadmeadow, S.; Denman, S. Predisposition of Forests to Biotic Disturbance: Predicting the Distribution of Acute Oak Decline Using Environmental Factors. For. Ecol. Manag. 2018, 407, 145–154. [Google Scholar] [CrossRef]
- Brady, C.; Arnold, D.; McDonald, J.; Denman, S. Taxonomy and Identification of Bacteria Associated with Acute Oak Decline. World J. Microbiol. Biotechnol. 2017, 33, 143. [Google Scholar] [CrossRef]
- Maddock, D.; Brady, C.; Denman, S.; Arnold, D. Bacteria Associated with Acute Oak Decline: Where Did They Come from? We Know Where They Go. Microorganisms 2023, 11, 2789. [Google Scholar] [CrossRef]
- Denman, S.; Doonan, J.; Ransom-Jones, E.; Broberg, M.; Plummer, S.; Kirk, S.; Scarlett, K.; Griffiths, A.R.; Kaczmarek, M.; Forster, J.; et al. Microbiome and Infectivity Studies Reveal Complex Polyspecies Tree Disease in Acute Oak Decline. ISME J. 2018, 12, 386–399. [Google Scholar] [CrossRef]
- Tkaczyk, M.; Sikora, K.; Galko, J. First Report of Bacteria Causing Acute Oak Decline on Quercus robur in Slovakia. Eur. J. Plant Pathol. 2024, 169, 113–120. [Google Scholar] [CrossRef]
- Eichenlaub, L.; Denman, S.; Brady, C.; Maddock, D.; Robledo-Garcia, F.; Aubert, A.; Husson, C.; Robin, C. First Report of Brenneria goodwinii, Gibbsiella quercinecans and Rahnella victoriana in Declining Oaks in France. New Dis. Rep. 2024, 49, e12264. [Google Scholar] [CrossRef]
- Pernek, M.; Brady, C.; Lacković, N.; Dubravac, T.; Jukić, A.; Kovač, M. Acute Oak Decline (AOD) New Complex Disese on Holm Oak (Quercus ilex L.) and Possibilities of Spread on Other Oak Species in Croatia. Sumar. List 2022, 146, 439–445. [Google Scholar] [CrossRef]
- Doonan, J.; Denman, S.; Pachebat, J.A.; McDonald, J.E. Genomic Analysis of Bacteria in the Acute Oak Decline Pathobiome. Microb. Genom. 2019, 5, e000240. [Google Scholar] [CrossRef] [PubMed]
- Denman, S.; Plummer, S.; Kirk, S.; Peace, A.; McDonald, J.E. Isolation Studies Reveal a Shift in the Cultivable Microbiome of Oak Affected with Acute Oak Decline. Syst. Appl. Microbiol. 2016, 39, 484–490. [Google Scholar] [CrossRef] [PubMed]
- Crampton, B.G.; Plummer, S.J.; Kaczmarek, M.; McDonald, J.E.; Denman, S. A Multiplex Real-time PCR Assay Enables Simultaneous Rapid Detection and Quantification of Bacteria Associated with Acute Oak Decline. Plant Pathol. 2020, 69, 1301–1310. [Google Scholar] [CrossRef]
- Moradi-Amirabad, Y.; Rahimian, H.; Babaeizad, V.; Denman, S. Brenneria spp. and Rahnella victoriana Associated with Acute Oak Decline Symptoms on Oak and Hornbeam in Iran. For. Pathol. 2019, 49, e12535. [Google Scholar] [CrossRef]
- Pettifor, B. Survival of Brenneria goodwinii and Gibbsiella quercinecans, Associated with Lesion Formation in Acute Oak Decline, in Rainwater and Forest Soil. Master’s Thesis, Bangor University, Bangor, UK, 2019. [Google Scholar]
- Lane, D.J. 16S/23S RRNA Sequencing. In Nucleic Acid Techniques in Bacterial Systematic; Wiley: New York, NY, USA, 1991; pp. 115–175. [Google Scholar]
- Brady, C.; Cleenwerck, I.; Venter, S.; Vancanneyt, M.; Swings, J.; Coutinho, T. Phylogeny and Identification of Pantoea Species Associated with Plants, Humans and the Natural Environment Based on Multilocus Sequence Analysis (MLSA). Syst. Appl. Microbiol. 2008, 31, 447–460. [Google Scholar] [CrossRef]
- Guhathakurta, D.; Stromo, G.D. Finding Regulatory Elements in DNA Sequence. In Bioinformatics: Methods Express; Scion Publishing Ltd.: Rotorua, New Zealand, 2007; pp. 117–139. [Google Scholar]
- Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the Sensitivity of Progressive Multiple Sequence Alignment through Sequence Weighting, Position-Specific Gap Penalties and Weight Matrix Choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [PubMed]
- Lobo, I. Basic Local Alignment Search Tool (BLAST). Nat. Educ. 2008, 1, 215–399. [Google Scholar]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Tamura, K.; Nei, M. Estimation of the Number of Nucleotide Substitutions in the Control Region of Mitochondrial DNA in Humans and Chimpanzees. Mol. Biol. Evol. 1993, 10, 512–526. [Google Scholar] [CrossRef]
- National Center for Biotechnology Information (NCBI)[Internet] Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information. Available online: https://www.ncbi.nlm.nih.gov/nuccore/OR907136.1 (accessed on 9 September 2024).
- National Center for Biotechnology Information (NCBI)[Internet] Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information. Available online: https://www.ncbi.nlm.nih.gov/nuccore/OR907048.1 (accessed on 9 September 2024).
- Tremblay, J.; Singh, K.; Fern, A.; Kirton, E.S.; He, S.; Woyke, T.; Lee, J.; Chen, F.; Dangl, J.L.; Tringe, S.G. Primer and Platform Effects on 16S rRNA Tag Sequencing. Front. Microbiol. 2015, 6, 771. [Google Scholar] [CrossRef] [PubMed]
- Peplies, J.; Kottmann, R.; Ludwig, W.; Glöckner, F.O. A Standard Operating Procedure for Phylogenetic Inference (SOPPI) Using (RRNA) Marker Genes. Syst. Appl. Microbiol. 2008, 31, 251–257. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.-T.; Lee, F.-L.; Tai, C.-J.; Kasai, H. Comparison of gyrB Gene Sequences, 16S rRNA Gene Sequences and DNA–DNA Hybridization in the Bacillus subtilis Group. Int. J. Syst. Evol. Microbiol. 2007, 57, 1846–1850. [Google Scholar] [CrossRef] [PubMed]
- Delmas, J.; Breysse, F.; Devulder, G.; Flandrois, J.-P.; Chomarat, M. Rapid Identification of Enterobacteriaceae by Sequencing DNA Gyrase Subunit B Encoding Gene. Diagn. Microbiol. Infect. Dis. 2006, 55, 263–268. [Google Scholar] [CrossRef]
- Basavand, E.; Khodaygan, P.; Doonan, J.M.; Rahimian, H. Gibbsiella quercinecans as New Pathogen Involved in Bacterial Canker of Russian Olive. 3Biotech 2021, 11, 286. [Google Scholar] [CrossRef]
- Tóth, T.; Lakatos, T. Brenneria bubanii sp. nov., Isolated from Decaying Plant Tissues. Int. J. Syst. Evol. Microbiol. 2023, 73. [Google Scholar] [CrossRef]
- Li, Y.; Fang, W.; Xue, H.; Liang, W.; Wang, L.; Tian, G.; Wang, X.; Lin, C.; Li, X.; Piao, C. Brenneria populi sp. nov., Isolated from Symptomatic Bark of Populus×euramericana Canker. Int. J. Syst. Evol. Microbiol. 2015, 65, 432–437. [Google Scholar] [CrossRef]
- Sapp, M.; Lewis, E.; Moss, S.; Barrett, B.; Kirk, S.; Elphinstone, J.; Denman, S. Metabarcoding of Bacteria Associated with the Acute Oak Decline Syndrome in England. Forests 2016, 7, 95. [Google Scholar] [CrossRef]
- Karnosky, D.F. Dutch Elm Disease: A Review of the History, Environmental Implications, Control, and Research Needs. Environ. Conserv. 1979, 6, 311–322. [Google Scholar] [CrossRef]
- Sicard, A.; Saponari, M.; Vanhove, M.; Castillo, A.I.; Giampetruzzi, A.; Loconsole, G.; Saldarelli, P.; Boscia, D.; Neema, C.; Almeida, R.P.P. Introduction and Adaptation of an Emerging Pathogen to Olive Trees in Italy. Microb. Genom. 2021, 7, 000735. [Google Scholar] [CrossRef]
- Bonham, E. Potential Transmission Pathways of Two Bacteria Associated with Acute Oak Decline Brenneria goodwinii and Gibsiella quercinecans. Ph.D. Thesis, Harper Adams University, Newport, UK, 2021. [Google Scholar]
- Pettifor, B.J.; Doonan, J.; Denman, S.; McDonald, J.E. Survival of Brenneria goodwinii and Gibbsiella quercinecans, Associated with Acute Oak Decline, in Rainwater and Forest Soil. Syst. Appl. Microbiol. 2020, 43, 126052. [Google Scholar] [CrossRef] [PubMed]
- Araeinejhad, M.-H.; Charkhabi, N.F.; Brady, C.; Rahimian, H. Reliable and Specific Detection and Identification of Brenneria goodwinii, the Causal Agent of Oak and Oriental Beech Decline. Front. For. Glob. Chang. 2024, 7, 1325897. [Google Scholar] [CrossRef]
- Tkaczyk, M.; Sikora, K.; Plewa, R. Dieback of Small-leaved Lime Trees (Tilia cordata Mill.) Caused by Gibsiella quercinecans in Urban Areas in Poland. For. Pathol. 2024, 54, e12861. [Google Scholar] [CrossRef]
- National Center for Biotechnology Information (NCBI)[Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information. Available online: https://www.ncbi.nlm.nih.gov/nuccore/MZ503699 (accessed on 9 October 2024).
- National Center for Biotechnology Information (NCBI) Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information. Available online: https://www.ncbi.nlm.nih.gov/nuccore/LR735261.1 (accessed on 9 October 2024).
- National Center for Biotechnology Information (NCBI)[Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information. Available online: https://www.ncbi.nlm.nih.gov/nuccore/OP586670 (accessed on 9 October 2024).
- National Center for Biotechnology Information (NCBI)[Internet] Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information. Available online: https://www.ncbi.nlm.nih.gov/nuccore/OP616040.1/ (accessed on 9 September 2024).
- National Center for Biotechnology Information (NCBI)[Internet] Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information. 2022. Available online: https://www.ncbi.nlm.nih.gov/nuccore/OP586671.1 (accessed on 9 October 2024).
- National Center for Biotechnology Information (NCBI)[Internet] Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information. Available online: https://www.ncbi.nlm.nih.gov/nuccore/OP586675 (accessed on 9 September 2024).
- Biosca, E.G.; González, R.; López-López, M.J.; Soria, S.; Montón, C.; Pérez-Laorga, E.; López, M.M. Isolation and Characterization of Brenneria quercina, Causal Agent for Bark Canker and Drippy Nut of Quercus spp. in Spain. Phytopathology 2003, 93, 485–492. [Google Scholar] [CrossRef] [PubMed]
- Davis, E.E.; French, S.; Venette, R.C. Mini Risk Assessment Metallic Beetle: Agrilus biguttatus Fabricius [Coleoptera: Buprestidae]. 2004. Available online: https://citeseerx.ist.psu.edu/document?repid=rep1&type=pdf&doi=4d7415b17fa6c883e06e07d1abbc7136d8625f73 (accessed on 26 September 2024).
- Riziero, T.; Ragazzi, A.; Marianelli, L.; Sabbatini, P.; Roversi, P.F. Insects and Fungi Involved in Oak Decline in Italy. Int. Organ. Biol. Integr. Control. 2002, 25, 67–74. [Google Scholar]
- Curletti, G. L’entomocenosi Xilofaga Del Parco Della Mandria (Piemonte, Italy). Riv. Piem. St. Nat. 1996, 17, 151–165. [Google Scholar]
- Curletti, G. Considerazioni Su Alcune Specie Di Agrilus curtis Presenti in Italia e Su Alcuni Sottogeneri Proposti Di Recente. Fragmentaentomologica 2013, 45, 71–82. [Google Scholar]
- Solinas, M. Coroebus Florentinus (Herbst) (Coleoptera, Buprestidae) Biologia, danni, lotta. Entomologica 1974, 10, 141–193. [Google Scholar]
- Solinas, M. Considerazioni Ecologiche Sul Preoccupante Sviluppo Di Coroebus florentinus (Herbst) Nelle Leccete Del Gargano. Entomologica 1971, 7, 115–122. [Google Scholar]
- Curletti, G. Coleotteri Bupestridi Del Piemonte e Valle d’Aosta. Riv. Piem. St. Nat. 1980, 1, 69–104. [Google Scholar]
- Kalil, S.A.A.; Atta, H.A.E.; Aref, L.M. Increased Gum Arabic Production after Infestation of Acacia senegal with Aspergillus flavus and Pseudomonas pseudoalcaligenes Transmitted by Agrilus nubeculosus. Afr. J. Biotechnol. 2011, 10, 7166–7173. [Google Scholar]
- Rexrode, C.O. Tree-Wounding Insects as Vectors of the Oak Wilt Fungus. Forest science 1968, 14, 181–189. [Google Scholar]
- Mezencev, A.I. Swolovye Vrediteti i Openok v Ochagakh Usykhanija Duba. izv. Khar’k. Entom 1993, 1, 193–198. [Google Scholar]
- Dueñas-López, M.A. Agrilus biguttatus (Oak Splendour Beetle); CABI Compendium: Wallingford, UK, 2022. [Google Scholar]
- Poland, T.M.; McCullough, D.G. Emerald Ash Borer: Invasion of the Urban Forest and the Threat to North America’s Ash Resource. J. For. 2006, 104, 118–124. [Google Scholar] [CrossRef]
- Schans, J.; Schrader, G.; Delbianco, A.; Graziosi, I.; Vos, S. Pest Survey Card on Agrilus planipennis. EFSA Support. Publ. 2020, 17, 1945E. [Google Scholar] [CrossRef]
- EPPO. Pest Risk Analysis for Agrilus; EPPO: Paris, France, 2013. [Google Scholar]
- Flø, D.; Krokene, P.; Økland, B. Invasion Potential of Agrilus planipennis and Other Agrilus Beetles in Europe: Import Pathways of Deciduous Wood Chips and MaxEnt Analyses of Potential Distribution Areas. EPPO Bull. 2015, 45, 259–268. [Google Scholar] [CrossRef]
- Evans, H.F.; Williams, D.; Hoch, G.; Loomans, A.; Marzano, M. Developing a European Toolbox to Manage Potential Invasion by Emerald Ash Borer (Agrilus planipennis) and Bronze Birch Borer (Agrilus anxius), Important Pests of Ash and Birch. For. Int. J. For. Res. 2020, 93, 187–196. [Google Scholar] [CrossRef]
- Held, B.W.; Simeto, S.; Rajtar, N.N.; Cotton, A.J.; Showalter, D.N.; Bushley, K.E.; Blanchette, R.A. Fungi Associated with Galleries of the Emerald Ash Borer. Fungal Biol. 2021, 125, 551–559. [Google Scholar] [CrossRef]
- Rizzi, A.; Crotti, E.; Borruso, L.; Jucker, C.; Lupi, D.; Colombo, M.; Daffonchio, D. Characterization of the Bacterial Community Associated with Larvae and Adults of Anoplophora chinensis Collected in Italy by Culture and Culture-Independent Methods. Biomed. Res. Int. 2013, 2013, 420287. [Google Scholar] [CrossRef]
- Colman, D.R.; Toolson, E.C.; Takacs-Vesbach, C.D. Do Diet and Taxonomy Influence Insect Gut Bacterial Communities? Mol. Ecol. 2012, 21, 5124–5137. [Google Scholar] [CrossRef]
- Tkaczyk, M. Bioclimatic Variables and Their Impact on the Potential Distribution of Brenneria goodwinii in Europe. For. Pathol. 2023, 53, e12820. [Google Scholar] [CrossRef]
Bacteria | Primers and Probes | Sequence (5′–3′) |
---|---|---|
Brenneria goodwinii | Bg99F | CTGGCCGAGCCTGGAAAC |
Bg179R | AGTTCAGGAAGGAGAGTTCGC | |
Bg179P | CCAGAATCTCATATTCGAACTCCACCATGTT | |
Gibsiella quercinecans | Gq284F | GGCTTTGATAGTGGTGGCC |
Gq418R | CGTTCCGTTATCACCGTGG | |
Gq342P | AACAGTTCCAGCGCCATTTTCTTCG |
Gene | Primers | Sequence (5′–3′) |
---|---|---|
16S | EUB9F | GAGTTTGATCMTGGCTCAG |
EUB1492R | ACGGYTACCTTGTTACGACTT | |
gyrB | gyrB 01-F | TAARTTYGAYGAYAACTCYTAYAAAGT |
gyrB 02-R | CMCCYTCCACCARGTAMAGTT |
Host | Country | References | |
---|---|---|---|
European Countries | Q. robur | Britain | [12] |
Spain | [5] | ||
Switzerland | [1] | ||
Poland | [6] | ||
Latvia | [4] | ||
Slovakia | [25] | ||
France | [26] | ||
Hungary | [59] | ||
Q. petraea | Britain | [12] | |
Switzerland | [1] | ||
Hungary | [60] | ||
France | [26] | ||
Q. suber | Portugal | [3] | |
Q. ilex | Spain | [5] | |
Italy | [11] | ||
Q. cerris | Switzerland | [1] | |
Hungary | [61] | ||
Q. pubescens | Switzerland | [1] | |
Q. rubra | Switzerland | [1] | |
Q. pyrenaica | Spain | [5] | |
Q. ilex | Spain | [62] | |
Q. pyrenaica | Spain | [62] | |
Tilia cordata | Poland | [55] | |
Ulmus sp. | Hungary | [57] | |
Acer campestre | Hungary | [58] | |
Malus sp. | Switzerland | [56] | |
Non-European Countries | Carpinus sp. | Iran | [31] |
Elaeagnus sp | Iran | [46] | |
Fagus sp. | Turkmenistan | [54] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Carluccio, G.; Vergine, M.; Vita, F.; Sabella, E.; Delle Donne, A.; De Bellis, L.; Luvisi, A. Long-Distance Finding of AOD-Related Bacteria in the Natural Environment: Risks to Quercus ilex (L.) in Italy. Forests 2024, 15, 2055. https://doi.org/10.3390/f15122055
Carluccio G, Vergine M, Vita F, Sabella E, Delle Donne A, De Bellis L, Luvisi A. Long-Distance Finding of AOD-Related Bacteria in the Natural Environment: Risks to Quercus ilex (L.) in Italy. Forests. 2024; 15(12):2055. https://doi.org/10.3390/f15122055
Chicago/Turabian StyleCarluccio, Giambattista, Marzia Vergine, Federico Vita, Erika Sabella, Angelo Delle Donne, Luigi De Bellis, and Andrea Luvisi. 2024. "Long-Distance Finding of AOD-Related Bacteria in the Natural Environment: Risks to Quercus ilex (L.) in Italy" Forests 15, no. 12: 2055. https://doi.org/10.3390/f15122055
APA StyleCarluccio, G., Vergine, M., Vita, F., Sabella, E., Delle Donne, A., De Bellis, L., & Luvisi, A. (2024). Long-Distance Finding of AOD-Related Bacteria in the Natural Environment: Risks to Quercus ilex (L.) in Italy. Forests, 15(12), 2055. https://doi.org/10.3390/f15122055