Next Article in Journal
How Well Do Stakeholder-Defined Forest Management Scenarios Balance Economic and Ecological Forest Values?
Previous Article in Journal
Tensile and Impact Bending Properties of Chemically Modified Scots Pine
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Forests
Volume 11
Issue 1
10.3390/f11010085
forests-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Cloning and Functional Characterization of Bisabolene Synthetase (SaBS) Promoter from Santalum album

by
Haifeng Yan
1,
Yuping Xiong
2,
Jaime A. Teixeira da Silva
3,
Jinhui Pang
2,
Ting Zhang
2,
Xincheng Yu
2,
Xinhua Zhang
2,
Meiyun Niu
2 and
Guohua Ma
2,*
1
Sugarcane Research Institute, Guangxi Academy of Agricultural Sciences, Nanning 530007, China
2
Guangdong Provincial Key Laboratory of Applied Botany, South China Botanical Garden, the Chinese Academy of Sciences, Guangzhou 510650, China
3
Miki-cho Post Office, P.O. Box 7, Miki-cho, Ikenobe 3011-2, Kagawa-ken 761-0799, Japan
*
Author to whom correspondence should be addressed.
Forests 2020, 11(1), 85; https://doi.org/10.3390/f11010085
Submission received: 3 December 2019 / Revised: 3 January 2020 / Accepted: 7 January 2020 / Published: 9 January 2020
(This article belongs to the Section Forest Ecophysiology and Biology)
Browse Figures
Versions Notes

Abstract

:
Bisabolene-type sesquiterpenoids, which have multiple bioactivities, including anticancer activity, are one of the main groups of compounds in the essential oil extracted from Santalum album L. and other Santalum species. Bisabolene synthetase (SaBS) is a key enzyme for the synthesis of bisabolene in S. album, but the regulation of the SaBS gene’s expression is poorly understood. In this study, a 1390-bp promoter sequence of the SaBS gene was isolated from the leaves of six-year-old S. album. A bioinformatics analysis showed that certain environment stresses and phytohormone-activated cis-acting elements were distributed in different regions of the SaBS promoter (PSaBS). Transgenic Arabidopsis carrying full-length PSaBS had significantly higher β-glucuronidase (GUS) activity than the untreated control after treatment with salicylic acid (SA), suggesting that PSaBS is a SA-inducible promoter. Histochemical GUS staining and GUS fluorometric assays of transgenic Arabidopsis showed that the GUS activity directed by PSaBS was mainly expressed in stem tissue, followed by leaves and flowers. Moreover, different regions of PSaBS showed significantly different GUS activity. A 171-bp fragment upstream of the transcriptional initiation codon (ATG) is the core promoter region of PSaBS. Our results provide insight into and a greater understanding of the transcriptional regulation mechanism of the SaBS gene, which could serve as an alternative inducible promoter for transgenic plant breeding.

1. Introduction

Terpenes are the largest group of plant secondary metabolites with diversified structures and functions. Based on the number of isoprene units (C5), terpenes are divided into hemiterpenes (C5), monoterpenes (C10), sesquiterpenes (C15), and diterpenes (C20). Bisabolenes are a type of sesquiterpenoid with diverse bioactivities, including an anticonvulsant effect [1], inhibition of H2O2-induced apoptosis [2], and anticancer activity [3,4]. Many bisabolene-type sesquiterpenoids have been isolated and identified in various plants, such as β-bisabolenol and β-bisabolenal in Neocallitropsis pancheri [5], artaboterpenoids A and B in Artabotrys hexapetalus [6], and halichonic acid from a marine sponge Halichondria sp. [7]. In recent years, bisabolene and its hydroxylated product, bisabolenol, were extracted from Indian sandalwood, Santalum album L., which is famous for its essential oil, and is distributed in India, Indonesia, Malaysia, and Australia [8,9]. The gene encoding bisabolene synthetase is SaBS. It is a terpene synthase that can catalyze the rate-limiting step of converting farnesyl diphosphate into bisabolene in S. album [10]. However, the regulation of SaBS gene expression has not been defined.
A promoter is a DNA sequence located upstream from gene coding regions that can chiefly regulate gene expression at the transcriptional level [11]. Various cis-acting elements, which are distributed in different regions of a promoter, control gene expression by combining with transcription factors; thus, isolation and identification of a promoter and its regulatory elements are indispensable to understanding the molecular mechanism of gene expression [12,13]. Increasingly, promoters of genes that are associated with secondary metabolites have been isolated and characterized in numerous plants, such as the promoter of DcF3’H for synthesizing 3′-hydroxylated flavonoids in Dracaena cambodiana [14], promoters of genes involved in the biosynthesis of prenylflavonoid and bitter acids in Humulus lupulus [15], and the promoter of the TeLCYe gene involved in lutein synthesis in Tagetes erecta [16].
In this work, a 1390-bp promoter of the SaBS gene was isolated and analyzed. To characterize the function of the SaBS promoter, the full-length promoter and its four deletion fragments were transformed into Arabidopsis. The tissue-specific expression patterns, phytohormone induction activity, and core promoter regions were analyzed by histochemical β-glucuronidase (GUS) staining and GUS fluorometric assays. These results provide greater insight into the transcriptional regulation of the SaBS gene, which could serve as a novel promoter for transgenic plant research.

2. Materials and Methods

2.1. Isolation and Sequence Analysis of the SaBS Promoter

Genomic DNA was extracted from the leaves of a six-year-old Santalum album tree using the plant DNAout kit (Tiandz, Beijing, China), according to the manufacturer’s instructions. Using genomic DNA as a template, the SaBS promoter was isolated by thermal asymmetric interlaced PCR (tail-PCR) [17]. The gene-specific primers SaBStail1 to SaBStail3 were designed according to the 5’ flanking sequences of SaBS downloaded from the National Center for Biotechnology Information (NCBI). All of the primers that were used to isolate the promoter of SaBS are listed in Table 1.
Core regulatory cis-acting elements in isolated SaBS promoter sequences were analyzed using the PlantCARE online tool (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/).

2.2. Construction of GUS Plasmid and Deletion Segements

Based on the density of the cis-acting elements that were distributed in the SaBS promoter, the full-length SaBS promoter was truncated to create five different 5’-deletion segments by five forward primers (SaBSF for full-length, PSaBS-D1F for 978 bp, PSaBS-D2F for 404 bp, PSaBS-D3F for 262 bp, and PSaBS-D4F for 171 bp), with a Pst1 restriction site and one single reverse primer PSaBSR with a BamH1 restriction site (Table 1, Figure 1A). The full-length SaBS promoter and its four 5’-deletion derivatives were digested with Pst1/BamH1 and then inserted into pCAMBIA1391Z after digestion with Pst1/BamH1, respectively. The constructed SaBS promoter::GUS plasmids were transformed into Escherichia coli DH5a cells, and then sequenced to confirm the constructs.

2.3. Arabidopsis Transformation and Screening Positive Transgenic Lines

The confirmed recombinant plasmids and pCAMBIA1391Z empty vector (negative control) were transformed into Agrobacterium tumefaciens EHA105, and then introduced into Arabidopsis thaliana by the floral dip method [18]. Transformants were screened on half-strength Murashige and Skoog (MS) medium [19] containing 25 mg/L hygromycin to select and harvest each hygromycin-resistant transgenic line. Then, transgenic Arabidopsis plants (T3, homozygous, without segregation) were generated. PCR was performed using gene-specific primers (SaBSF/SaBSR for full-length, PSaBS-D1F/SaBSR for 978 bp, PSaBS-D2F/SaBSR for 404 bp, PSaBS-D3F/SaBSR for 262 bp, and PSaBS-D4F/SaBSR for 171 bp; Table 1), and genomic DNA as a template to confirm the existence of the full-length SaBS promoter and its truncated derivatives in transformed plants (Figure 1B). Three transgenic lines from the T3 homozygous generation confirmed by PCR were selected randomly for follow-up experiments.
Two-week-old T3 generation Arabidopsis transformant seedlings harboring the full-length SaBS promoter were transferred into half-strength liquid MS medium containing 100 mM salicylic acid (SA) gently for 12 h at 22 °C in the dark. In addition, T3 generation Arabidopsis transformant seedlings harboring the empty pCAMBIA1391Z vector were added into half-strength MS liquid medium and cultured in the same conditions as the control. At least 30 Arabidopsis transformant seedlings from three independent transgenic lines were sampled. Materials were collected and frozen immediately in liquid nitrogen and stored at −80 °C until use.

2.4. Histochemical GUS Staining and GUS Fluorometric Assays

Transgenic Arabidopsis seedlings and organs at the reproductive stage were harvested for histochemical GUS staining using a GUS histochemical assay kit (Real times, Beijing, China), according to the manufacturer’s protocol. The GUS staining was observed, and photographs were captured, with a stereo microscope (Leica S9, Leica, Solms, Germany).
The GUS fluorometric assays were performed using the method described by Jefferson et al. [20]. About 100 mg of transgenic plant materials were homogenized in liquid nitrogen and extracted in fresh GUS extraction buffer (50 mM potassium phosphate buffer (pH 7.0), 10 mM ethylene diamine tetraacetic acid (EDTA), 0.1% sodium lauroyl sarcosine, 0.1% Triton X-100, and 10 mM β-mercaptoethanol). The extract was centrifuged at 12,000 rpm and 4 °C for 10 min. The supernatants that were obtained were used to detect fluorescence by measuring the amount of 4-methylumbelliferone (4-MU) using 4-methyl-umbelliferyl-glucuronide (4-MUG) (Sigma-Aldrich, St. Louis, MI, USA) as a substrate. Fluorescence was determined with a multifunctional microplate reader (EnSpire, PerkinElmer, Waltham, MA, USA) at 365 nm (excitation) and 455 nm (emission). Protein concentration was determined by the Bradford method using bovine serum albumin (BSA) (Sigma-Aldrich) as the standard [21]. GUS fluorometric activity was normalized as nmol of 4-MU produced per minute per milligram of protein. Three independent experiments were conducted for each sample. Error bars indicate the mean ± standard error.

2.5. Statistical Analyses

All data were analyzed using SPSS 19.0 (IBM Corp., Armonk, NY, USA) with one-way analysis of variance (ANOVA) followed by Duncan’s multiple range test. Significance at p < 0.05 was considered a significant difference.

3. Results

3.1. Isolation and Sequence Analysis of the SaBS Promoter (PSaBS)

Tail-PCR was used to isolate the SaBS promoter by gene-specific primers, as well as random primers (Table 1) with genomic DNA extracted from S. album leaves as the template. A 1390-bp fragment upstream of the translational start codon (ATG) of the SaBS gene was isolated and sequenced. It was considered to be the putative SaBS promoter and was thus named PSaBS (GenBank accession number MG917673). The putative cis-acting elements were analyzed by the PlantCARE online tool. Bioinformatics analysis showed that PSaBS consists of abundant TATA and CAAT boxes, containing 75 TATA-box and 37 CAAT-box enhancer elements (Table 2). Moreover, there were a number of light-responsive elements in PSaBS, including ACE, Box 4, Box I, CATT-motif, GA-motif, GT1-motif, I-box, and LAMP-element. Some hormone-responsive elements were also found in PSaBS, such as an ethylene-responsive element (ERE), a gibberellin responsiveness element TATC-box, and two SA-responsive elements or TCA-elements. PSaBS either contains some environmental stress-inducible elements, such as ARE for anaerobic induction, MBS for drought-inducibility, and the WUN-motif for wound-responsiveness. In addition, some tissue-specific expression elements were found in PSaBS, such as the CCGTCC-box for meristem-specific activation of expression, the Skn-1 motif for endosperm-specific expression, and the as-2 box for shoot-specific expression (Table 1, Figure 2).

3.2. Spatiotemporal and Tissue-Specific Expression Patterns of PSaBS

To investigate the spatiotemporal and tissue-expression patterns of PSaBS, GUS activity was detected in homozygous T3 transgenic Arabidopsis plants harboring the full-length PSaBS during different plant developmental stages (from seedling to mature plant) and in various tissues (root, stem, leaf, flower, silique, and seed). High GUS expression, monitored by histochemical staining, was found in every part of two-week-old transgenic Arabidopsis seedlings, including leaves, stems, and roots. Intense GUS activity was also observed in leaves, stems, flowers, and siliques, but not seeds of mature transgenic plants. In contrast, the homozygous T3 transgenic control plants, which contained the empty 1391Z vector, did not exhibit any GUS staining in any tissue or at any developmental stage (Figure 3).
To clearly distinguish the strength of GUS activity in different tissues of mature plants, GUS activity was quantitatively determined in the leaves, stems, and flowers of four-week-old transgenic T3 Arabidopsis plants. Results of the GUS fluorometric assay indicate that GUS activity was significantly highest in the stems, followed by leaves then flowers (Figure 4).

3.3. SA Enhanced GUS Activity Directed by PSaBS

Since PSaBS contains several SA-responsive TCA-elements (Table 2, Figure 2), it was presumed that the activity of PSaBS was induced by exogenous SA treatment. To verify this hypothesis, we treated transgenic Arabidopsis plants harboring full-length PSaBS with 100 mM SA. GUS fluorometric assays showed that the GUS activity of SA-treated samples was 1.43-fold higher than control plants (Figure 5). These results demonstrate that the activity of PSaBS was regulated by SA treatment and that PSaBS is an SA-inducible promoter.

3.4. Deletion Analysis of PSaBS in Transgenic Arabidopsis

To identify the core promoter region that regulates the expression of the SaBS gene, the full-length PSaBS and its four deletion segments were separately transformed into Arabidopsis, then the resulting T3 homozygous transgenic plants were analyzed by histochemical staining. Strong GUS activity was observed in all four tissues of the plants harboring a full-length PSaBS GUS fusion, including the stems, leaves, flowers, and siliques. Compared with the full-length PSaBS, lower GUS staining intensity from PSaBS-D1 to PSaBS-D2 was observed in all four tissues, especially in PSaBS-D2, where weak GUS activity was only found in leaves. The GUS expression level increased from PSaBS-D3 to PSaBS-D4 compared to that in PSaBS-D1 and PSaBS-D2 in each of the four tissues. In PSaBS-D4, identical GUS staining with the full-length PSaBS in all four tissues was clearly observed (Figure 6).
To characterize the GUS expression level more precisely, the quantitative detection of GUS activity was performed in the leaves of transgenic plants carrying the full-length PSaBS and its series of deletion segments. GUS fluorometric assays showed that, compared with the full-length PSaBS, the average GUS activity of PSaBS-D1 was significantly reduced by 91.53%, or by 81.45% in PSaBS-D2, when compared with PSaBS-D1, which had the weakest GUS activity. However, the average GUS activity of PSaBS-D3 increased significantly, 55.89-fold more than PSaBS-D2, reaching 89.39% of the GUS activity of full-length PSaBS. The average activity of the PSaBS-D4 fusion GUS increased 0.38-fold more than PSaBS-D3, the transformed lines PSaBS-D4-5 and PSaBS-D4-8 with full-length PSaBS had statistically similar GUS expression levels, while the line PSaBS-D4-2 had significantly higher GUS activity than full-length PSaBS (Figure 7).
Therefore, the results of GUS fluorometric assays were consistent with those of histochemical staining.

4. Discussion

Cis-acting elements in a promoter play a key role in regulating gene expression at the transcriptional level [11,13,22]. A typical promoter not only possesses CAAT and a TATA-box for initiating gene transcription, but also possesses some other cis-acting elements that respond to stimuli in vitro or in vivo, and regulate the transcription of a particular gene [23,24,25]. SaBS is a pivotal gene for synthesizing bisabolene in S. album. To understand the transcriptional regulation of the SaBS gene, a 1390-bp promoter sequence upstream of the transcriptional start codon (ATG) was isolated. Bioinformatics analysis using the PlantCare online tool revealed that PSaBS contained many cis-acting elements of a typical promoter, including a TATA box, a CAAT box, and other environment- and stress-responsive cis-acting elements. Tissue-specific expression analysis in transgenic Arabidopsis harboring the full-length PSaBS showed that GUS activity was mainly observed in roots, stems, leaves, and flowers, but not in mature seeds (Figure 3). A GUS fluorometric assay indicated that GUS activity was significantly highest in the stems, followed by leaves then flowers. To explore the similarities and differences between heterologous expression of SaBS in Arabidopsis and its expression in its native host, expression was characterized in different tissues of S. album by RT-qPCR (Method S1). The expression level of the SaBS gene was highest in the stems, confirming, to some extent, the results in transgenic Arabidopsis containing the full-length PSaBS (Figure S1). However, the expression level of the SaBS gene in flowers was not statistically different to the level found in stems, whilst the level of expression in leaves was significantly lower than that in stems and flowers. This may be caused by heterologous expression [26,27], or the existence of other cis-acting elements besides the 1390-bp fragment, which may also regulate SaBS expression in S. album.
Analysis of the cis-acting elements of PSaBS with PlantCare showed that many light-responsive cis-acting elements exist in different regions of the promoter, such as in the promoter of PPRGRMZM2G129783 in maize [28], and the RPW8 promoter in Chinese wild grapevine (Vitis pseudoreticulata) [29], indicating that the expression of SaBS is regulated by light. Apart from this, ARE, MBS, and the WUN-motif were also found in PSaBS, suggesting that SaBS expression might also be regulated by the anaerobic environment, drought, and wounding stress, although these hypotheses need further studies.
Some phytohormone-responsive cis-acting elements were also found in PSaBS, the most frequent being the SA-responsive TCA element. GUS activity in SA-treated transgenic Arabidopsis plants containing the full-length PSaBS was 1.43-fold higher than in control plants. In S. album, SaBS expression was also significantly induced by SA treatment when it was detected by RT-qPCR (Method S2, Figure S2), thereby confirming that PSaBS is an SA-inducible promoter. Previous studies noted that SA performs an important role in inducing terpene accumulation and related gene expression [30,31,32], leading us to speculate that SA might induce the accumulation of bisabolene in S. album.
Different promoter regions play distinct and alternative functions in regulating gene expression [33,34,35]. To explore the core promoter regions that regulate expression of the SaBS gene, the full-length PSaBS and its four deletion derivatives were transformed into Arabidopsis. GUS histochemical staining and fluorometric assays showed that the GUS activity of PSaBS-D1 and PSaBS-D2 declined significantly compared with full-length PSaBS (Figure 6 and Figure 7). A 5′-UTR Py-rich stretch, A-box, Box-4, Box-I, CCGTCC-box, ERE, GT1-motif, LAMP-element, as-2 box, circadian elements, TCA element, Skn-1 motif, MBS, I-box, CATT-motif, ARE, and ACE-element were found between the full-length PSaBS and PSaBS-D2 region (−1390 bp to −404 bp), so one or more of these cis-acting elements may inhibit promoter activity. The GUS activity from PSaBS-D3 increased significantly relative to that in PSaBS-D2 and PSaBS-D1 (Figure 6 and Figure 7). A GA-motif, TCA-element, WUN-motif, A-box, and CCGTCC-box were discovered in the region between PSaBS-D2 and PSaBS-D4 (−404 bp to −171 bp); thus, one or more of these cis-acting elements may activate the promoter activity. The 171-bp fragment, i.e., PSaBS-D4, exhibited the same high GUS activity as the full-length PSaBS, indicating that the 171-bp fragment of PSaBS was a core promoter region that might sufficiently direct SaBS gene expression on its own. A GT1-motif and unnamed 4, as well as four CAAT and TATA-boxes, were found in this region, so these cis-acting elements may play an important role in regulating promoter activity. Similar findings were also reported in other plants, such as the 0.3 kb Arabidopsis thaliana translationally controlled tumor protein (AtTCTP) promoter [36], and a 262-bp MdHB-1 gene promoter from Malus × domestica [37]. It is well-known that a small promoter size is beneficial for transgenic technology [36], so the 171-bp PSaBS can be commercially utilized as an alternative promoter for transgene expression.

5. Conclusions

SaBS is a key enzyme for synthesizing bisabolene, one of the main components of essential oil in S. album. A 1390-bp putative promoter sequence of the SaBS gene was isolated and analyzed in this study. Histochemical GUS staining and GUS fluorometric assays from transgenic Arabidopsis showed that the full-length PSaBS was a SA-inducible promoter. The 171-bp fragment upstream of the transcriptional start codon (ATG) is the core promoter region of PSaBS. Our results offer some important information for understanding the transcriptional regulation mechanism of the SaBS gene and provide an alternative promoter resource for transgenic technology.

Supplementary Materials

The following are available online at https://www.mdpi.com/1999-4907/11/1/85/s1. Figure S1. Expression patterns of SaBS in different tissues of S. album. RT-qPCR data were acquired in a six-year-old S. album tree as three replicates. Figure S2. Transcript level of SaBS in callus of S. album after SA treatment. S. album callus was treated for 6 h with 100 mM SA and then collected for RT-qPCR determination. Error bars represent the SE of three replicates. Different letters denote significant differences at P < 0.05 according to Duncan’s multiple range test.

Author Contributions

G.M. conceived and designed the experiment. H.Y., Y.X., J.P., T.Z. and X.Y. performed the experiments. X.Z. and M.N. contributed to materials and statistical analysis of data. H.Y., Y.X. and J.A.T.d.S. wrote the manuscript. J.A.T.d.S. provided critical analysis of the design and data. All authors read and approved the final manuscript.

Funding

This work was financially supported by the National Natural Science Foundation of China (grant numbers 31870666, 31470685, and 31270720), the Natural Science Foundation of Guangdong Province (S2012010009025), the Guangdong Science and Technology project (2015B020231008), and the Guangxi Natural Science Foundation Project (2019GXNSFAA185005).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Orellana-Paucar, A.M.; Serruys, A.S.; Afrikanova, T.; Maes, J.; de Borggraeve, W.; Alen, J.; Leon-Tamariz, F.; Wilches-Arizabala, I.M.; Crawford, A.D.; de Witte, P.A.; et al. Anticonvulsant activity of bisabolene sesquiterpenoids of Curcuma longa in zebrafish and mouse seizure models. Epilepsy Behav. 2012, 24, 14–22. [Google Scholar] [CrossRef]
  2. Yu, Z.-L.; Peng, Y.-L.; Wang, C.; Cao, F.; Huo, X.-K.; Tian, X.-G.; Feng, L.; Ning, J.; Zhang, B.-J.; Sun, C.-P.; et al. Alismanoid A, an unprecedented 1,2-seco bisabolene from Alisma orientale, and its protective activity against H2O2-induced damage in SH-SY5Y cells. New J. Chem. 2017, 41, 12664–12670. [Google Scholar] [CrossRef]
  3. Jou, Y.J.; Hua, C.H.; Lin, C.S.; Wang, C.Y.; Wan, L.; Lin, Y.J.; Huang, S.H.; Lin, C.W. Anticancer activity of γ-bisabolene in human neuroblastoma cells via induction of p53-mediated mitochondrial apoptosis. Molecules 2016, 21, 601. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Yeo, S.K.; Ali, A.Y.; Hayward, O.A.; Turnham, D.; Jackson, T.; Bowen, I.D.; Clarkson, R. β-Bisabolene, a sesquiterpene from the essential oil extract of opoponax (Commiphora guidottii), exhibits cytotoxicity in breast cancer cell lines. Phytother. Res. 2016, 30, 418–425. [Google Scholar] [CrossRef] [PubMed]
  5. Raharivelomanana, P.; Cambon, A.; Azzaro, M.; Bianchini, J.-P.; Faure, R. β-Bisabolenol and β-bisabolenal, two new bisabolene sesquiterpenes from Neocallitropsis pancheri. J. Nat. Prod. 1993, 56, 272–274. [Google Scholar] [CrossRef]
  6. Xi, F.M.; Ma, S.G.; Liu, Y.B.; Li, L.; Yu, S.S. Artaboterpenoids A and B, bisabolene-derived sesquiterpenoids from Artabotrys hexapetalus. Org. Lett. 2016, 18, 3374–3377. [Google Scholar] [CrossRef]
  7. Raiju, K.; Hitora, Y.; Kato, H.; Ise, Y.; Angkouw, E.D.; Mangindaan, R.E.P.; Tsukamoto, S. Halichonic acid, a new rearranged bisabolene-type sesquiterpene from a marine sponge Halichondria sp. Tetrahedron Lett. 2019, 60, 1079–1081. [Google Scholar] [CrossRef]
  8. Baldovini, N.; Delasalle, C.; Joulain, D. Phytochemistry of the heartwood from fragrant Santalum species: A review. Flavour. Frag. J. 2011, 26, 7–26. [Google Scholar] [CrossRef]
  9. Jones, C.G.; Keeling, C.I.; Ghisalberti, E.L.; Barbour, E.L.; Plummer, J.A.; Bohlmann, J. Isolation of cDNAs and functional characterisation of two multi-product terpene synthase enzymes from sandalwood, Santalum album L. Arch. Biochem. Biophys. 2008, 477, 121–130. [Google Scholar] [CrossRef]
  10. Srivastava, P.L.; Daramwar, P.P.; Krithika, R.; Pandreka, A.; Shankar, S.S.; Thulasiram, H.V. Functional characterization of novel sesquiterpene synthases from Indian sandalwood, Santalum album. Sci. Rep. 2015, 5, 10095. [Google Scholar] [CrossRef] [Green Version]
  11. Hernandez-Garcia, C.M.; Finer, J.J. Identification and validation of promoters and cis-acting regulatory elements. Plant Sci. 2014, 217–218, 109–119. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Wang, J.Y.; Wang, J.P.; Yang, H.F. Identification and functional characterization of the NAC gene promoter from Populus euphratica. Planta 2016, 244, 417–427. [Google Scholar] [CrossRef] [PubMed]
  13. Dao, L.T.M.; Spicuglia, S. Transcriptional regulation by promoters with enhancer function. Transcription 2018, 9, 307–314. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Zhu, J.; Chen, P.; Guo, D.; Li, H.; Wang, Y.; Dai, H.; Mei, W.; Peng, S. Identification and functional characterization of the DcF3’H promoter from Dracaena cambodiana. Trop. Plant Biol. 2018, 11, 192–198. [Google Scholar] [CrossRef]
  15. Duraisamy, G.S.; Mishra, A.K.; Kocabek, T.; Matoušek, J. Identification and characterization of promoters and cis-regulatory elements of genes involved in secondary metabolites production in hop (Humulus lupulus L.). Comput. Biol. Chem. 2016, 64, 346–352. [Google Scholar] [CrossRef]
  16. Zhang, C.; Wang, Y.; Wang, W.; Cao, Z.; Fu, Q.; Bao, M.; He, Y. Functional analysis of the marigold (Tagetes erecta) lycopene ε-cyclase (TeLCYe) promoter in transgenic tobacco. Mol. Biotechnol. 2019, 61, 703–713. [Google Scholar] [CrossRef]
  17. Liu, Y.-G.; Mitsukawa, N.; Oosumi, T.; Whittier, R.F. Efficient isolation and mapping of Arabidopsis thaliana T-DNA insert junctions by thermal asymmetric interlaced PCR. Plant J. 1995, 8, 457–463. [Google Scholar] [CrossRef]
  18. Zhang, X.; Henriques, R.; Lin, S.S.; Niu, Q.W.; Chua, N.H. Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method. Nat. Protoc. 2006, 1, 641–646. [Google Scholar] [CrossRef]
  19. Murashige, T.; Skoog, F. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant 1962, 15, 473–497. [Google Scholar] [CrossRef]
  20. Jefferson, R.A.; Kavanagh, T.A.; Bevan, M.W. GUS fusion: Beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 1987, 6, 3901–3907. [Google Scholar] [CrossRef]
  21. Bradford, M.M. A rapid sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
  22. Zou, C.; Sun, K.; Mackaluso, J.D.; Seddon, A.E.; Jin, R.; Thomashow, M.F.; Shiu, S.H. Cis-regulatory code of stress-responsive transcription in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA 2011, 108, 14992–14997. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Shahmuradov, I.A.; Gammerman, A.J.; Hancock, J.M.; Bramley, P.M.; Solovyev, V.V. PlantProm: A database of plant promoter sequences. Nucleic Acids Res. 2003, 31, 114–117. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Cvetesic, N.; Lenhard, B. Core promoters across the genome. Nat. Biotechnol. 2017, 35, 123–124. [Google Scholar] [CrossRef] [PubMed]
  25. Haberle, V.; Stark, A. Eukaryotic core promoters and the functional basis of transcription initiation. Nat. Rev. Mol. Cell Biol. 2018, 19, 621–637. [Google Scholar] [CrossRef] [PubMed]
  26. Tian, X.; Xuan, L.; Liu, B.; Hu, T.; Wang, C.; Wang, X. Effects of heterologous expression of Populus euphratica brassinosteroids biosynthetic enzyme genes CPD (PeCPD) and DWF4 (PeDWF4) on tissue dedifferentiation and growth of Arabidopsis thaliana seedlings. Plant Cell Tissue Org. Cult. 2017, 132, 111–121. [Google Scholar] [CrossRef]
  27. Grishin, D.V.; Samoilenko, V.A.; Gladilina, Y.A.; Zhdanov, D.D.; Pokrovskaya, M.V.; Aleksandrova, S.S.; Pokrovsky, V.S.; Sokolov, N.N. Effect of heterologous expression of chemotaxis proteins from genus Thermotoga on the growth kinetics of Escherichia coli cells. Bull. Exp. Biol. Med. 2019, 167, 375–379. [Google Scholar] [CrossRef]
  28. Yu, H.; Khalid, M.H.B.; Lu, F.; Sun, F.; Qu, J.; Liu, B.; Li, W.; Fu, F. Isolation and identification of a vegetative organ-specific promoter from maize. Physiol. Mol. Biol. Plants 2019, 25, 277–287. [Google Scholar] [CrossRef]
  29. Lai, G.; Song, S.; Liu, Y.; Fu, P.; Xiang, J.; Lu, J. RPW8 promoter is involved in pathogen- and stress-inducible expression from Vitis pseudoreticulata. J. Phytopathol. 2019, 167, 65–74. [Google Scholar] [CrossRef]
  30. Zhang, M.; Liu, J.; Li, K.; Yu, D. Identification and characterization of a novel monoterpene synthase from soybean restricted to neryl diphosphate precursor. PLoS ONE 2013, 8, e75972. [Google Scholar] [CrossRef]
  31. De Costa, F.; Yendo, A.C.; Fleck, J.D.; Gosmann, G.; Fett-Neto, A.G. Accumulation of a bioactive triterpene saponin fraction of Quillaja brasiliensis leaves is associated with abiotic and biotic stresses. Plant Physiol. Biochem. 2013, 66, 56–62. [Google Scholar] [CrossRef] [PubMed]
  32. Yoon, S.J.; Sukweenadhi, J.; Khorolragchaa, A.; Mathiyalagan, R.; Subramaniyam, S.; Kim, Y.J.; Kim, H.B.; Kim, M.J.; Kim, Y.J.; Yang, D.C. Overexpression of Panax ginseng sesquiterpene synthase gene confers tolerance against Pseudomonas syringae pv. tomato in Arabidopsis thaliana. Physiol. Mol. Biol. Plants 2016, 22, 485–495. [Google Scholar] [CrossRef] [PubMed]
  33. Li, Y.; Sun, Y.; Yang, Q.; Kang, J.; Zhang, T.; Gruber, M.Y.; Fang, F. Cloning and function analysis of an alfalfa (Medicago sativa L.) zinc finger protein promoter MsZPP. Mol. Biol. Rep. 2012, 39, 8559–8569. [Google Scholar] [CrossRef] [PubMed]
  34. Lou, H.; Li, H.; Ho, K.J.; Cai, L.L.; Huang, A.S.; Shank, T.R.; Verneris, M.R.; Nickerson, M.L.; Dean, M.; Anderson, S.K. The human TET2 gene contains three distinct promoter regions with differing tissue and developmental specificities. Front Cell Dev. Biol. 2019, 7, 99. [Google Scholar] [CrossRef]
  35. Iqbal, A.; Tang, W.; Wang, T.; Wang, H. Identification and functional characterization of the promoter driving “xyloglucan endotransglucosylase/hydrolase gene (XET)” gene for root growth in the desert Populus euphratica. S. Afr. J. Bot. 2017, 112, 437–446. [Google Scholar] [CrossRef]
  36. Han, Y.J.; Kim, Y.M.; Hwang, O.J.; Kim, J.I. Characterization of a small constitutive promoter from Arabidopsis translationally controlled tumor protein (AtTCTP) gene for plant transformation. Plant Cell Rep. 2015, 34, 265–275. [Google Scholar] [CrossRef]
  37. Wang, H.-J.; Jiang, Y.-H.; Qi, Y.-W.; Dai, J.-Y.; Liu, Y.-L.; Zhu, X.-B.; Liu, C.-H.; LÜ, Y.-R.; Ren, X.-L. Identification and functional characterization of the MdHB-1 gene promoter sequence from Malus×domestica. J. Integr. Agric. 2017, 16, 1730–1741. [Google Scholar] [CrossRef] [Green Version]
Forests 11 00085 g001 550
Figure 1. A schematic diagram of the promoter reporter vector used for Arabidopsis transformation (A) and identification of T3 generation homozygote transgenic Arabidopsis plants (B). A. The full-length SaBS promoter (PSaBS), and its four deletion fragments (PSaBS-D1, PSaBS-D2, PSaBS-D3, and PSaBS-D4), were inserted into the pCAMBIA1391Z vector after digestion with Pst1/BamH1, respectively, then used for Arabidopsis transformation. B. Three lines of transgenic Arabidopsis plants harboring the full-length PSaBS and its four deletion fragments were selected and identified by PCR amplification with promoter-specific primers. All products were visualized by 2% agarose gel electrophoresis.
Figure 1. A schematic diagram of the promoter reporter vector used for Arabidopsis transformation (A) and identification of T3 generation homozygote transgenic Arabidopsis plants (B). A. The full-length SaBS promoter (PSaBS), and its four deletion fragments (PSaBS-D1, PSaBS-D2, PSaBS-D3, and PSaBS-D4), were inserted into the pCAMBIA1391Z vector after digestion with Pst1/BamH1, respectively, then used for Arabidopsis transformation. B. Three lines of transgenic Arabidopsis plants harboring the full-length PSaBS and its four deletion fragments were selected and identified by PCR amplification with promoter-specific primers. All products were visualized by 2% agarose gel electrophoresis.
Forests 11 00085 g001
Forests 11 00085 g002 550
Figure 2. Analysis of cis-acting elements in the PSaBS promoter. The putative promoter sequence (1390-bp) of the Bisabolene synthetase (SaBS) gene upstream of the transcriptional initiation codon (ATG) is shown with a ‘+’ sign and its complementary sequence with a ‘−’ sign. The different cis-acting elements are labelled with different colors, and illustrated on the right side. The TATA-box and CAAT-box are not shown.
Figure 2. Analysis of cis-acting elements in the PSaBS promoter. The putative promoter sequence (1390-bp) of the Bisabolene synthetase (SaBS) gene upstream of the transcriptional initiation codon (ATG) is shown with a ‘+’ sign and its complementary sequence with a ‘−’ sign. The different cis-acting elements are labelled with different colors, and illustrated on the right side. The TATA-box and CAAT-box are not shown.
Forests 11 00085 g002
Forests 11 00085 g003 550
Figure 3. Histochemical GUS staining in different tissues of transformants.
Figure 3. Histochemical GUS staining in different tissues of transformants.
Forests 11 00085 g003
Forests 11 00085 g004 550
Figure 4. Fluorometric GUS activity in different tissues of transgenic Arabidopsis harboring the full-length PSaBS:GUS and the pCAMBIA1391Z vector. Values are the average of three independent transgenic lines. Error bars represent the standard error (SE) of three replicates, and different letters above bars denote significant differences at p < 0.05 according to Duncan’s multiple range test.
Figure 4. Fluorometric GUS activity in different tissues of transgenic Arabidopsis harboring the full-length PSaBS:GUS and the pCAMBIA1391Z vector. Values are the average of three independent transgenic lines. Error bars represent the standard error (SE) of three replicates, and different letters above bars denote significant differences at p < 0.05 according to Duncan’s multiple range test.
Forests 11 00085 g004
Forests 11 00085 g005 550
Figure 5. GUS fluorometric assays to evaluate salicylic acid (SA) treatment on the GUS activity of transgenic Arabidopsis plants containing the full-length PSaBS and pCAMBIA1391Z. Values are the average of three independent transgenic lines. Error bars represent the SE of three replicates, and different letters above bars denote significant differences at p < 0.05 compared with the control plants according to Duncan’s multiple range test.
Figure 5. GUS fluorometric assays to evaluate salicylic acid (SA) treatment on the GUS activity of transgenic Arabidopsis plants containing the full-length PSaBS and pCAMBIA1391Z. Values are the average of three independent transgenic lines. Error bars represent the SE of three replicates, and different letters above bars denote significant differences at p < 0.05 compared with the control plants according to Duncan’s multiple range test.
Forests 11 00085 g005
Forests 11 00085 g006 550
Figure 6. A photo of different PSaBS deletion derivatives.
Figure 6. A photo of different PSaBS deletion derivatives.
Forests 11 00085 g006
Forests 11 00085 g007 550
Figure 7. GUS activity in different deletion derivatives. Error bars represented the SE of three replicates. Different letters above bars denote significant differences at p < 0.05 according to Duncan’s multiple range test.
Figure 7. GUS activity in different deletion derivatives. Error bars represented the SE of three replicates. Different letters above bars denote significant differences at p < 0.05 according to Duncan’s multiple range test.
Forests 11 00085 g007
Table
Table 1. The primer sequences that were used in this study.
Table 1. The primer sequences that were used in this study.
Primer NameSequence (5′–3′)
AD1NTCGASTWTSGWGTT
AD2NGTCGASWGANAWGAA
AD3WGTGNAGWANCANAGA
AD4TGWGNAGWANCASAGA
AD5AGWGNAGWANCAWAGG
SaBStail1GCTTCTACGACCAACCTGCC
SaBStail2TTCTTCGGGCACTCATACGC
SaBStail3CCTTTTCCTTGCCCTTGTCGTG
PSaBSFAACTGCAGGATTGCGAGTGACATGAAG
PSaBSRCGGGATCCGGCGAAATCAAGCAAAAAT
PSaBS-D1FAACTGCAGTTTTAAACTGAAGTAATAA
PSaBS-D2FAACTGCAGTGTGATGTAAATTCTAAAT
PSaBS-D3FAACTGCAGAAAACTTTGCATGGTTCAC
PSaBS-D4FAACTGCAGTAGTGGACTAAAAATAAAA
Table
Table 2. Main cis-acting elements of the SaBS promoter.
Table 2. Main cis-acting elements of the SaBS promoter.
ElementSequenceElement NumberFunction
A-boxCCGTCC2Regulatory element
ACECTAACGTATT1Element involved in light responsiveness
AREAAACCA2Essential for anaerobic induction
Box 4ATTAAT1Light responsiveness
Box ITTTCAAA2Light-responsive element
CAAT-boxCAAT37Enhancer regions
CATT-motifGCATCC1Part of a light-responsive element
CCGTCC-boxCCGTCC2Meristem-specific activation
EREATTTCAAA1Ethylene-responsive element
GA-motifAAGGAAGA1Part of a light-responsive element
GT1-motifATGGTGGTTGG
GGTTAA		2Light-responsive element
I-boxGATAAGGGT
AGATAAGG		2Part of a light-responsive element
LAMP-elementCTTTATCA1Part of a light-responsive element
MBSCAACTG1MYB binding site involved in drought-inducibility
Skn-1 motifGTCAT1Required for endosperm expression
TATC-boxTATCCCA1Gibberellin responsiveness
TCA-elementCCATCTTTTT2Salicylic acid responsiveness
WUN-motifAAATTTCCT1Wound-responsive element
as-2 boxGATAATGATG1Shoot-specific expression and light responsiveness
CircadianCAANNNNATC1Circadian control
TATA-boxTATA75Core promoter element around -30 of transcription start

Share and Cite

MDPI and ACS Style

Yan, H.; Xiong, Y.; Teixeira da Silva, J.A.; Pang, J.; Zhang, T.; Yu, X.; Zhang, X.; Niu, M.; Ma, G. Molecular Cloning and Functional Characterization of Bisabolene Synthetase (SaBS) Promoter from Santalum album. Forests 2020, 11, 85. https://doi.org/10.3390/f11010085

AMA Style

Yan H, Xiong Y, Teixeira da Silva JA, Pang J, Zhang T, Yu X, Zhang X, Niu M, Ma G. Molecular Cloning and Functional Characterization of Bisabolene Synthetase (SaBS) Promoter from Santalum album. Forests. 2020; 11(1):85. https://doi.org/10.3390/f11010085

Chicago/Turabian Style

Yan, Haifeng, Yuping Xiong, Jaime A. Teixeira da Silva, Jinhui Pang, Ting Zhang, Xincheng Yu, Xinhua Zhang, Meiyun Niu, and Guohua Ma. 2020. "Molecular Cloning and Functional Characterization of Bisabolene Synthetase (SaBS) Promoter from Santalum album" Forests 11, no. 1: 85. https://doi.org/10.3390/f11010085

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop