Impact of Juglone, a PIN1 İnhibitor, on Oral Carcinogenesis Induced by 4-Nitroquinoline-1-Oxide (4NQO) in Rat Model
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Protocols
2.3. Determination of the Gene Expressions with rt-qPCR
2.4. Determination of Protein Expressions by Western Blot
2.5. Histochemical Staining
2.6. Statistical Analysis
3. Results
3.1. The Influences of Juglone in the mRNA Expressions of the Apoptosis
3.2. The Influences of Juglone in the Protein Expressions of the Apoptosis
3.3. The Influences of Juglone on Histological Parameters
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Can-cer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Balakittnen, J.; Weeramange, C.E.; Wallace, D.F.; Duijf, P.H.G.; Cristino, A.S.; Kenny, L.; Vasani, S.; Punyadeera, C. Noncoding RNAs in Oral Cancer. WIREs RNA 2023, 14, e1754. [Google Scholar] [CrossRef] [PubMed]
- Ma, Y.; Yu, Y.; Yin, Y.; Wang, L.; Yang, H.; Luo, S.; Zheng, Q.; Pan, Y.; Zhang, D. Potential Role of Epithelial–Mesenchymal Transition Induced by Periodontal Pathogens in Oral Cancer. J. Cell. Mol. Med. 2023, 28, e18064. [Google Scholar] [CrossRef] [PubMed]
- Rivera, C.; Venegas, B. Histological and Molecular Aspects of Oral Squamous Cell Carcinoma. Oncol. Lett. 2014, 8, 7–11. [Google Scholar] [CrossRef] [PubMed]
- Roi, A.; Boia, S.; Rusu, L.-C.; Roi, C.I.; Boia, E.R.; Riviș, M. Circulating MiRNA as a Biomarker in Oral Cancer Liquid Biopsy. Biomedicines 2023, 11, 965. [Google Scholar] [CrossRef] [PubMed]
- Sha, J.; Bai, Y.; Ngo, H.X.; Okui, T.; Kanno, T. Overview of Evidence-Based Chemotherapy for Oral Cancer: Focus on Drug Resistance Related to the Epithelial-Mesenchymal Transition. Biomolecules 2021, 11, 893. [Google Scholar] [CrossRef] [PubMed]
- Lechien, J.R.; Hans, S. Epidemiological, Clinical and Oncological Outcomes of Laryngeal Verrucous Carcinomas: A Systematic Review. J. Otolaryngol.-Head Neck Surg. 2023, 52, 81. [Google Scholar] [CrossRef] [PubMed]
- Mostaan, L.V.; Khorsandi, M.T.; Sharifian, S.-M.R.; Shandiz, F.H.; Mirashrafi, F.; Sabzari, H.; Badiee, R.; Borghei, H.; Yazdani, N. Correlation between E-Cadherin and CD44 Adhesion Molecules Expression and Cervical Lymph Node Metastasis in Oral Tongue SCC: Predictive Significance or Not. Pathol.-Res. Pract. 2011, 207, 448–451. [Google Scholar] [CrossRef] [PubMed]
- Brown, J.S.; Shaw, R.J.; Bekiroglu, F.; Rogers, S.N. Systematic Review of the Current Evidence in the Use of Postoperative Radiotherapy for Oral Squamous Cell Carcinoma. Br. J. Oral Maxillofac. Surg. 2012, 50, 481–489. [Google Scholar] [CrossRef]
- Crombie, A.K.; Farah, C.; Tripcony, L.; Dickie, G.; Batstone, M.D. Primary Chemoradiotherapy for Oral Cavity Squamous Cell Carcinoma. Oral Oncol. 2012, 48, 1014–1018. [Google Scholar] [CrossRef]
- Kitagawa, R.R.; Vilegas, W.; Carlos, I.Z.; Raddi, M.S.G. Antitumor and Immunomodulatory Effects of the Naphthoquinone 5-Methoxy-3,4-Dehydroxanthomegnin. Rev. Bras. Farmacogn. 2011, 21, 1084–1088. [Google Scholar] [CrossRef]
- Yu, J.H.; Im, C.Y.; Min, S.H. Function of PIN1 in Cancer Development and Its Inhibitors as Cancer Therapeutics. Front. Cell Dev. Biol. 2020, 8, 120. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Chang, D.; Yang, Z.; Qi, J.; Liu, R.; He, H.; Li, D.; Xiao, Z.X. Pin1 modulates p63α protein stability in regulation of cell survival, proliferation and tumor formation. Cell Death Dis. 2013, 4, e943. [Google Scholar] [CrossRef] [PubMed]
- Zavileyskiy, L.; Bunik, V. Regulation of P53 Function by Formation of Non-Nuclear Heterologous Protein Complexes. Biomolecules 2022, 12, 327. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.; Yu, X.; Qu, S.; Sui, D. Juglone, isolated from Juglans mandshurica Maxim induces apoptosis via down-regulation of AR expression in human prostate cancer LNCaP cells. Bioorg. Med. Chem. Lett. 2013, 23, 3631–3634. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Li, Y.; Deng, Z.; Zhu, X.; Zhang, Z.; Zhang, X.; Tian, J.; Li, W.; Zhao, P. Traditional Uses, Phytochemistry, Pharmacology and Clinical Applications of Cortex Juglandis Mandshuricae: A Com-prehensive Review. J. Ethnopharmacol. 2022, 285, 114887. [Google Scholar] [CrossRef] [PubMed]
- Bozkurt, E.; Atay, E.; Pektaş, G.; Ertekin, A.; Vurmaz, A.; Korkmaz, Ö.A.; Sadi, G.; Aslan, E.; Koca, O.H.; Pektaş, M.B. Potential Anti-Tumor Activity of Kefir-Induced Juglone and Resveratrol Fractions against Ehrlich Ascites Carcinoma-Bearing BALB/C Mice. Iran. J. Pharm. Res. IJPR 2020, 19, 358–369. [Google Scholar] [CrossRef] [PubMed]
- Pektas, M.B.; Turan, O.; Ozturk Bingol, G.; Sumlu, E.; Sadi, G.; Akar, F. High Glucose Causes Vas-cular Dysfunction through Akt/ENOS Pathway: Reciprocal Modulation by Juglone and Resveratrol. Can. J. Physiol. Pharmacol. 2018, 96, 757–764. [Google Scholar] [CrossRef] [PubMed]
- Shah, V.M.; Rizvi, S.; Smith, A.; Tsuda, M.; Krieger, M.; Pelz, C.; MacPherson, K.; Eng, J.; Chin, K.; Munks, M.W.; et al. Micelle-Formulated Juglone Effectively Targets Pancreatic Cancer and Remodels the Tumor Microenvironment. Pharmaceutics 2023, 15, 2651. [Google Scholar] [CrossRef]
- Hu, C.; Xu, H.; Li, Z.; Liu, D.; Zhang, S.; Fang, F.; Wang, L. Juglone Promotes Antitumor Activity against Prostate Cancer via Suppressing Glycolysis and Oxidative Phosphorylation. Phyther. Res. 2023, 37, 515–526. [Google Scholar] [CrossRef]
- Yue, W.; Qin, L.; Cai, J.; Mei, R.; Qian, H.; Zou, Z. Jug-PLGA-NPs, a New Form of Juglone with Enhanced Efficiency and Reduced Toxicity on Melanoma. Chin. J. Integr. Med. 2022, 28, 909–917. [Google Scholar] [CrossRef] [PubMed]
- Mao, J.; Bian, Y.; Zhang, Q.; Kong, L.; Shi, X.; Hu, J.; Yang, M.; Li, L.; Qian, H.; Liu, B.; et al. Antitumor Activity of IRGD-Modified Red Blood Cell Membrane Nanoparticles Loaded with Juglone and Oxaliplatin against Colorectal Cancer. J. Biomater. Appl. 2022, 36, 1301–1316. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Liu, K.; Wang, X.-F.; Sun, D.-J. Juglone Reduces Growth and Migration of U251 Glioblas-toma Cells and Disrupts Angiogenesis. Oncol. Rep. 2017, 38, 1959–1966. [Google Scholar] [CrossRef] [PubMed]
- Jin, X.; Zhang, Y.; Zhang, Z.; Che, D.; Lv, H. Juglone Loaded Poloxamer 188/Phospholipid Mixed Micelles Evaluated in Vitro and in Vivo in Breast Cancer. Int. J. Pharm. 2016, 515, 359–366. [Google Scholar] [CrossRef] [PubMed]
- Seetha, A.; Devaraj, H.; Sudhandiran, G. Effects of combined treatment with Indomethacin and Juglone on AOM/DSS induced colon carcinogenesis in Balb/c mice: Roles of inflammation and apoptosis. Life Sci. 2021, 264, 118657. [Google Scholar] [CrossRef] [PubMed]
- Lowry, O.; Rosebrough, N.; Farr, A.; Randall, R. Protein Measurement with the Folin Phenol Reagent. J. Biol. Chem. 1951, 193, 265–275. [Google Scholar] [CrossRef] [PubMed]
- Speight, P.M. Update on Oral Epithelial Dysplasia and Progression to Cancer. Head Neck Pathol. 2007, 1, 61–66. [Google Scholar] [CrossRef] [PubMed]
- Ross, R.; DiGiovanna, J.J.; Capaldi, L.; Argenyi, Z.; Fleckman, P.; Robinson-Bostom, L. Histopatho-logic Characterization of Epidermolytic Hyperkeratosis: A Systematic Review of Histology from the National Registry for Ichthyosis and Related Skin Disorders. J. Am. Acad. Dermatol. 2008, 59, 86–90. [Google Scholar] [CrossRef] [PubMed]
- Dwivedi, R.; Pandey, R.; Chandra, S.; Mehrotra, D. Apoptosis and Genes Involved in Oral Cancer—A Comprehensive Review. Oncol. Rev. 2020, 14, 472. [Google Scholar] [CrossRef]
- Ashkenazi, A.; Dixit, V.M. Death Receptors: Signaling and Modulation. Science 1998, 281, 1305–1308. [Google Scholar] [CrossRef]
- Jorge-Finnigan, A.; Gámez, A.; Pérez, B.; Ugarte, M.; Richard, E. Different Altered Pattern Expression of Genes Related to Apoptosis in Isolated Methylmalonic Aciduria CblB Type and Combined with Homocystinuria CblC Type. Biochim. Biophys. Acta-Mol. Basis Dis. 2010, 1802, 959–967. [Google Scholar] [CrossRef]
- Nakatsu, Y.; Yamamotoya, T.; Ueda, K.; Ono, H.; Inoue, M.-K.; Matsunaga, Y.; Kushiyama, A.; Sa-koda, H.; Fujishiro, M.; Matsubara, A.; et al. Prolyl Isomerase Pin1 in Metabolic Reprogramming of Cancer Cells. Cancer Lett. 2020, 470, 106–114. [Google Scholar] [CrossRef] [PubMed]
- He, S.; Li, L.; Jin, R.; Lu, X. Biological Function of Pin1 in Vivo and Its Inhibitors for Preclinical Study: Early Development, Current Strategies, and Future Directions. J. Med. Chem. 2023, 66, 9251–9277. [Google Scholar] [CrossRef]
- Cheng, C.-W.; Chow, A.K.M.; Pang, R.; Fok, E.W.S.; Kwong, Y.-L.; Tse, E. PIN1 Inhibits Apoptosis in Hepatocellular Carcinoma through Modulation of the Antiapoptotic Function of Survivin. Am. J. Pathol. 2013, 182, 765–775. [Google Scholar] [CrossRef] [PubMed]
- Huang, G.-L.; Liao, D.; Chen, H.; Lu, Y.; Chen, L.; Li, H.; Li, B.; Liu, W.; Ye, C.; Li, T.; et al. The Protein Level and Transcription Activity of Acti-vating Transcription Factor 1 Is Regulated by Prolyl Isomerase Pin1 in Nasopharyngeal Carcinoma Progression. Cell Death Dis. 2016, 7, e2571. [Google Scholar] [CrossRef] [PubMed]
- Yao, J.; Wang, J.-M.; Wang, Z.-L.; Wu, Y.-N. The Pin1 Gene Polymorphism and the Susceptibility of Oral Squamous Cell Carcinoma in East China. Cancer Biomarkers 2014, 14, 441–447. [Google Scholar] [CrossRef] [PubMed]
- Bouaoud, J.; De Souza, G.; Darido, C.; Tortereau, A.; Elkabets, M.; Bertolus, C.; Saintigny, P. The 4-NQO Mouse Model: An Update on a Well-Established in Vivo Model of Oral Carcinogenesis. Methods Cell Biol. 2021, 163, 197–229. [Google Scholar] [CrossRef]
- Ourique, F.; Kviecinski, M.R.; Zirbel, G.; Castro, L.S.E.P.W.; Gomes Castro, A.J.; Mena Barreto Silva, F.R.; Valderrama, J.A.; Rios, D.; Benites, J.; Calderon, P.B.; et al. In Vivo Inhibition of Tumor Progression by 5 Hydroxy-1,4-Naphthoquinone (Juglone) and 2-(4-Hydroxyanilino)-1,4-Naphthoquinone (Q7) in Combination with Ascorbate. Biochem. Biophys. Res. Commun. 2016, 477, 640–646. [Google Scholar] [CrossRef] [PubMed]
- Xu, M.; Cheung, C.C.-M.; Chow, C.; Lun, S.W.-M.; Cheung, S.-T.; Lo, K.-W. Overexpression of PIN1 Enhances Cancer Growth and Aggressiveness with Cyclin D1 Induction in EBV-Associated Na-sopharyngeal Carcinoma. PLoS ONE 2016, 11, e0156833. [Google Scholar] [CrossRef]
- Ahmad, T.; Khan, T.; Tabassum, T.; Alqahtani, Y.S.; Mahnashi, M.H.; Alyami, B.A.; Alqarni, A.O.; Alasmary, M.Y.; Almedhesh, S.A.; Shah, A.J. Juglone from Walnut Produces Cardioprotective Ef-fects against Isoproterenol-Induced Myocardial Injury in SD Rats. Curr. Issues Mol. Biol. 2022, 44, 3180–3193. [Google Scholar] [CrossRef]
- Erisen, S.; Arasoğlu, T.; Mansuroglu, B.; Kocacaliskan, İ.; Derman, S. Cytotoxic and Mutagenic Po-tential of Juglone: A Comparison of Free and Nano-Encapsulated Form. Arch. Ind. Hyg. Toxicol. 2020, 71, 69–77. [Google Scholar] [CrossRef]
Gene | Forward Primer Sequence (5′ → 3′) | Reverse Primer Sequence (3′ → 5′) |
---|---|---|
p53 | TCCCCTGAAGACTGGATAACT | TTCCTCTGGGCCTTCTAACA |
Bax | GCTCAGCTTCTTGGTGGATG | CCTTTTTGCTACAGGGTTTCAT |
Bcl-2 | TTCCTGCATCTCATGCCAAG | TACCAATAGCACTTCGCGTC |
Caspase-9 | ATGGTCTTTCTGCTCACCAC | GTCACGGCTTTGATGGAGAT |
Caspase-6 | GACCGACTAAAACAGGCCC | AATTACTGTGCGCAAATGCC |
GAPDH | TGATGACATCAAGAAGGTGGTGAAG | TCCTTGGAGGCCATGTGGGCCAT |
Morphology | Score | Cell Structure | Epithelial Structure |
---|---|---|---|
Normal epithelium | 0 | No change | No change |
Hyperplasia | 1 | No change | Although normal maturation, epithelial thickening and hyperkeratosis |
Mild dysplasia | 2 | Differentiation in cell and nucleus shapes in the lower 1/3 of the epithelium | Thickening in the lower 1/3 of the epithelium, disruption of cell orientations |
Moderate dysplasia | 3 | Differentiation in cell and nucleus shapes up to the middle 1/3 of the epithelium | Increase in the number of cells up to the middle 1/3 of the epithelium, thickening of the epithelium, complete disruption of cell orientation |
Severe dysplasia | 4 | Disruption of the full-thickness cell structure of the epithelium | Migration of atypical cells from the basal lamina to the lamina propria in addition to the disrupted epithelial structure |
Carcinoma in situ | 5 | All changes available | Full-layer structural changes and delamination |
Groups | Oral Epithelial Dysplasia | Hyperkeratinization | Vascular Dilatation |
---|---|---|---|
Control | 0 | 1 | 1 |
NQO | 3.57 ± 0.57 | 2.83 ± 0.17 | 2.67 ± 0.21 |
Juglone | 0.84 ± 0.31 | 1.16 ± 0.17 | 1 |
NQO+J | 1.33 ± 0.21 | 1 | 1.5 ± 0.22 |
NQO+J* | 1.67 ± 0.67 | 1.5 ± 0.34 | 1.33 ± 0.33 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Topal, O.; Topal, B.G.; Baş, Y.; Ongan, B.; Sadi, G.; Aslan, E.; Yavaş, B.D.; Pektaş, M.B. Impact of Juglone, a PIN1 İnhibitor, on Oral Carcinogenesis Induced by 4-Nitroquinoline-1-Oxide (4NQO) in Rat Model. Medicina 2024, 60, 1192. https://doi.org/10.3390/medicina60081192
Topal O, Topal BG, Baş Y, Ongan B, Sadi G, Aslan E, Yavaş BD, Pektaş MB. Impact of Juglone, a PIN1 İnhibitor, on Oral Carcinogenesis Induced by 4-Nitroquinoline-1-Oxide (4NQO) in Rat Model. Medicina. 2024; 60(8):1192. https://doi.org/10.3390/medicina60081192
Chicago/Turabian StyleTopal, Olgun, Burcu Güçyetmez Topal, Yunus Baş, Bünyamin Ongan, Gökhan Sadi, Esra Aslan, Betül Demirciler Yavaş, and Mehmet Bilgehan Pektaş. 2024. "Impact of Juglone, a PIN1 İnhibitor, on Oral Carcinogenesis Induced by 4-Nitroquinoline-1-Oxide (4NQO) in Rat Model" Medicina 60, no. 8: 1192. https://doi.org/10.3390/medicina60081192
APA StyleTopal, O., Topal, B. G., Baş, Y., Ongan, B., Sadi, G., Aslan, E., Yavaş, B. D., & Pektaş, M. B. (2024). Impact of Juglone, a PIN1 İnhibitor, on Oral Carcinogenesis Induced by 4-Nitroquinoline-1-Oxide (4NQO) in Rat Model. Medicina, 60(8), 1192. https://doi.org/10.3390/medicina60081192