Desmodesmus Extract as a Mitochondrion-Targeted Neuroprotective Agent in Parkinson’s Disease: An In Vitro Study
Abstract
:1. Introduction
2. Materials and Methods
2.1. Microalga Cultures
2.2. Preparation of the Extract (DaMe)
2.3. Quantification of the Total Lipid and Protein Contents of DaMe
2.4. The Fatty Acid Composition and the Elemental Content of DaMe
2.5. Cell Culture and In Vitro Model of PD
2.6. Intracellular ROS Production
2.7. Total Oxidant Status (TOS) and Total Antioxidant Status (TAS)
2.8. Mitochondrial Membrane Potential (ΔΨm)
2.9. Oxidative DNA Damage
2.10. RT-qPCR Analysis
2.11. Statistical Analysis
3. Results
3.1. Total Lipid and Protein Contents of DaMe
3.2. Fatty Acid Composition and Element Content of DaMe
3.3. Effect of DaMe on ROS Production in SH-SY5Y Cells Induced by 6-OHDA
3.4. Effect of DaMe on the Oxidative Stress in SH-SY5Y Cells Induced by 6-OHDA
3.5. Effect of DaMe on the Mitochondrial Membrane Potential of SH-SY5Y Cells Induced with 6-OHDA
3.6. Effect of DaMe on Oxidative DNA Damage in SH-SY5Y Cells Induced with 6-OHDA
3.7. Effect of the DaMe on Expressions of Parkinson’s Disease and Apoptosis-Related Genes in 6-OHDA-Induced SH-SY5Y Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kouli, A.; Torsney, K.M.; Kuan, W.-L. Parkinson’s Disease: Etiology, Neuropathology, and Pathogenesis. In Parkinson’s Disease: Pathogenesis and Clinical Aspects; Codon Publications: Singapore, 2018; pp. 3–26. [Google Scholar]
- Dorszewska, J.; Kowalska, M.; Prendecki, M.; Piekut, T.; Kozłowska, J.; Kozubski, W. Oxidative stress factors in Parkinson’s disease. Neural Regen. Res. 2021, 16, 1383–1391. [Google Scholar] [CrossRef] [PubMed]
- Chang, K.-H.; Chen, C.-M. The Role of Oxidative Stress in Parkinson’s Disease. Antioxidants 2020, 9, 597. [Google Scholar] [CrossRef] [PubMed]
- Alam, Z.I.; Jenner, A.; Daniel, S.E.; Lees, A.J.; Cairns, N.; Marsden, C.D.; Jenner, P.; Halliwell, B. Oxidative DNA Damage in the Parkinsonian Brain: An Apparent Selective Increase in 8-Hydroxyguanine Levels in Substantia Nigra. J. Neurochem. 1997, 69, 1196–1203. [Google Scholar] [CrossRef] [PubMed]
- Gmitterová, K.; Heinemann, U.; Gawinecka, J.; Varges, D.; Ciesielczyk, B.; Valkovic, P.; Benetin, J.; Zerr, I. 8-OHdG in Cerebrospinal Fluid as a Marker of Oxidative Stress in Various Neurodegenerative Diseases. Neurodegener. Dis. 2009, 6, 263–269. [Google Scholar] [CrossRef] [PubMed]
- Henrich, M.T.; Oertel, W.H.; Surmeier, D.J.; Geibl, F.F. Mitochondrial dysfunction in Parkinson’s disease—A key disease hallmark with therapeutic potential. Mol. Neurodegener. 2023, 18, 83. [Google Scholar] [CrossRef]
- Lansbury, P.T. Back to the future: The ‘old-fashioned’ way to new medications for neurodegeneration. Nat. Med. 2004, 10, S51–S57. [Google Scholar] [CrossRef]
- Houghton, P.J.; Howes, M.-J. Natural Products and Derivatives Affecting Neurotransmission Relevant to Alzheimer’s and Parkinson’s Disease. Neurosignals 2005, 14, 6–22. [Google Scholar] [CrossRef]
- Murakami, H.; Shiraishi, T.; Umehara, T.; Omoto, S.; Iguchi, Y. Recent Advances in Drug Therapy for Parkinson’s Disease. Intern. Med. 2023, 62, 33–42. [Google Scholar] [CrossRef]
- Cichoński, J.; Chrzanowski, G. Microalgae as a Source of Valuable Phenolic Compounds and Carotenoids. Molecules 2022, 27, 8852. [Google Scholar] [CrossRef]
- Demura, M.; Noma, S.; Hayashi, N. Species and Fatty Acid Diversity of Desmodesmus (Chlorophyta) in a Local Japanese Area and Identification of New Docosahexaenoic Acid-Producing Species. Biomass 2021, 1, 105–118. [Google Scholar] [CrossRef]
- Premaratne, M.; Liyanaarachchi, V.C.; Nishshanka, G.K.S.H.; Nimarshana, P.; Ariyadasa, T.U. Nitrogen-limited cultivation of locally isolated Desmodesmus sp. for sequestration of CO2 from simulated cement flue gas and generation of feedstock for biofuel production. J. Environ. Chem. Eng. 2021, 9, 105765. [Google Scholar] [CrossRef]
- Moreno-García, L.; Adjallé, K.; Barnabé, S.; Raghavan, G.S.V. Microalgae biomass production for a biorefinery system: Recent advances and the way towards sustainability. Renew. Sustain. Energy Rev. 2017, 76, 493–506. [Google Scholar] [CrossRef]
- Derya-Andeden, M.; Andeden, E.E.; Cucer, N. Neuroprotective Effects of Microalga Desmodesmus arthrodesmiformis EM13 on 6-OHDA Induced Cell Model of Parkinson’s Disease. Neurochem. J. 2024, 18, 800–812. [Google Scholar]
- Mishra, S.K.; Suh, W.I.; Farooq, W.; Moon, M.; Shrivastav, A.; Park, M.S.; Yang, J.-W. Rapid quantification of microalgal lipids in aqueous medium by a simple colorimetric method. Bioresour. Technol. 2014, 155, 330–333. [Google Scholar] [CrossRef]
- Slocombe, S.P.; Ross, M.; Thomas, N.; McNeill, S.; Stanley, M.S. A rapid and general method for measurement of protein in micro-algal biomass. Bioresour. Technol. 2013, 129, 51–57. [Google Scholar] [CrossRef]
- Price, C. A membrane method for determination of total protein in dilute algal suspensions. Anal. Biochem. 1965, 12, 213–218. [Google Scholar] [CrossRef]
- Janion, K.; Strzelczyk, J.K.; Walkiewicz, K.W.; Biernacki, K.; Copija, A.; Szczepańska, E.; Nowakowska-Zajdel, E. Evaluation of Malondialdehyde Level, Total Oxidant/Antioxidant Status and Oxidative Stress Index in Colorectal Cancer Patients. Metabolites 2022, 12, 1118. [Google Scholar] [CrossRef]
- Rao, X.; Huang, X.; Zhou, Z.; Lin, X. An improvement of the 2ˆ (–delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. Biostat. Bioinforma. Biomath. 2013, 3, 71. [Google Scholar]
- Xu, D.-C.; Chen, Y.; Xu, Y.; ShenTu, C.-Y.; Peng, L.-H. Signaling pathways in Parkinson’s disease: Molecular mechanisms and therapeutic interventions. Signal Transduct. Target. Ther. 2023, 8, 73. [Google Scholar] [CrossRef]
- Leathem, A.; Ortiz-Cerda, T.; Dennis, J.M.; Witting, P.K. Evidence for Oxidative Pathways in the Pathogenesis of PD: Are Antioxidants Candidate Drugs to Ameliorate Disease Progression? Int. J. Mol. Sci. 2022, 23, 6923. [Google Scholar] [CrossRef]
- Singh, A.; Kukreti, R.; Saso, L.; Kukreti, S. Oxidative Stress: A Key Modulator in Neurodegenerative Diseases. Molecules 2019, 24, 1583. [Google Scholar] [CrossRef] [PubMed]
- Redza-Dutordoir, M.; Averill-Bates, D.A. Activation of apoptosis signalling pathways by reactive oxygen species. Biochim. Biophys. Acta Mol. Cell Res. 2016, 1863, 2977–2992. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Sun, C.; Mao, L.; Ma, P.; Liu, F.; Yang, J.; Gao, Y. The biological activities, chemical stability, metabolism and delivery systems of quercetin: A review. Trends Food Sci. Technol. 2016, 56, 21–38. [Google Scholar] [CrossRef]
- Haoujar, I.; Cacciola, F.; Abrini, J.; Mangraviti, D.; Giuffrida, D.; El Majdoub, Y.O.; Kounnoun, A.; Miceli, N.; Taviano, M.F.; Mondello, L.; et al. The Contribution of Carotenoids, Phenolic Compounds, and Flavonoids to the Antioxidative Properties of Marine Microalgae Isolated from Mediterranean Morocco. Molecules 2019, 24, 4037. [Google Scholar] [CrossRef]
- Bulut, O.; Akın, D.; Sönmez, Ç.; Öktem, A.; Yücel, M.; Öktem, H.A. Phenolic compounds, carotenoids, and antioxidant capacities of a thermo-tolerant Scenedesmus sp. (Chlorophyta) extracted with different solvents. J. Appl. Phycol. 2019, 31, 1675–1683. [Google Scholar] [CrossRef]
- Darendelioglu, E. Neuroprotective Effects of Chrysin on Diclofenac-Induced Apoptosis in SH-SY5Y Cells. Neurochem. Res. 2020, 45, 1064–1071. [Google Scholar] [CrossRef]
- Pande, S.; Patel, C.; Sarkar, D.; Acharya, S. Lactobacillus Rhamnosus UBLR-58 and Diclofenac Potentiate the Anti- Alzheimer Activity of Curcumin in Mice. Curr. Enzym. Inhib. 2021, 17, 49–56. [Google Scholar] [CrossRef]
- Huot, P.; Johnston, T.H.; Lewis, K.D.; Koprich, J.B.; Reyes, M.G.; Fox, S.H.; Piggott, M.J.; Brotchie, J.M. UWA-121, a mixed dopamine and serotonin re-uptake inhibitor, enhances l-DOPA anti-parkinsonian action without worsening dyskinesia or psychosis-like behaviours in the MPTP-lesioned common marmoset. Neuropharmacology 2014, 82, 76–87. [Google Scholar] [CrossRef]
- Johnston, T.H.; Millar, Z.; Huot, P.; Wagg, K.; Thiele, S.; Salomonczyk, D.; Yong-Kee, C.J.; Gandy, M.N.; McIldowie, M.; Lewis, K.D.; et al. A novel MDMA analogue, UWA-101, that lacks psychoactivity and cytotoxicity, enhances l -DOPA benefit in parkinsonian primates. FASEB J. 2012, 26, 2154–2163. [Google Scholar] [CrossRef]
- Costa, G.; Gołembiowska, K. Neurotoxicity of MDMA: Main effects and mechanisms. Exp. Neurol. 2022, 347, 113894. [Google Scholar] [CrossRef]
- Gallego, R.; Valdés, A.; Suárez-Montenegro, Z.J.; Sánchez-Martínez, J.D.; Cifuentes, A.; Ibáñez, E.; Herrero, M. Anti-inflammatory and neuroprotective evaluation of diverse microalgae extracts enriched in carotenoids. Algal Res. 2022, 67, 102830. [Google Scholar] [CrossRef]
- Silva, M.; Kamberovic, F.; Uota, S.T.; Kovan, I.-M.; Viegas, C.S.B.; Simes, D.C.; Gangadhar, K.N.; Varela, J.; Barreira, L. Microalgae as Potential Sources of Bioactive Compounds for Functional Foods and Pharmaceuticals. Appl. Sci. 2022, 12, 5877. [Google Scholar] [CrossRef]
- Eze, C.N.; Onyejiaka, C.K.; Ihim, S.A.; Ayoka, T.O.; Aduba, C.C.; Ndukwe, J.K.; Nwaiwu, O.; Onyeaka, H. Bioactive compounds by microalgae and potentials for the management of some human disease conditions. AIMS Microbiol. 2023, 9, 55–74. [Google Scholar] [CrossRef] [PubMed]
- Martins, B.; Vieira, M.; Delerue-Matos, C.; Grosso, C.; Soares, C. Biological Potential, Gastrointestinal Digestion, Absorption, and Bioavailability of Algae-Derived Compounds with Neuroprotective Activity: A Comprehensive Review. Mar. Drugs 2022, 20, 362. [Google Scholar] [CrossRef] [PubMed]
- Kangwa, T.S.; Hiss, D.C.; Hussein, A.A.; Ekpo, O.E.; Omoruyi, S.I. In vitro neuroprotective effects of Boophone disticha, Brunsvigia bosmaniae and Strumaria truncata extracts in SH-SY5Y cells. S. Afr. J. Bot. 2024, 166, 512–524. [Google Scholar] [CrossRef]
- Lepule, K.; Cordier, W.; Steenkamp, P.; Nell, M.; Steenkamp, V. The ability of three African herbal remedies to offer protection against an in vitro model of Parkinson’s disease. S. Afr. J. Bot. 2019, 126, 121–131. [Google Scholar] [CrossRef]
- He, T.; Lin, X.; Su, A.; Zhang, Y.; Xing, Z.; Mi, L.; Wei, T.; Li, Z.; Wu, W. Mitochondrial dysfunction-targeting therapeutics of natural products in Parkinson’s disease. Front. Pharmacol. 2023, 14, 1117337. [Google Scholar] [CrossRef]
- Kopalli, S.R.; Koppula, S.; Shin, K.Y.; Noh, S.-J.; Jin, Q.; Hwang, B.Y.; Suh, Y.-H. SF-6 attenuates 6-hydroxydopamine-induced neurotoxicity: An in vitro and in vivo investigation in experimental models of Parkinson’s disease. J. Ethnopharmacol. 2012, 143, 686–694. [Google Scholar] [CrossRef]
- Zorova, L.D.; Popkov, V.A.; Plotnikov, E.Y.; Silachev, D.N.; Pevzner, I.B.; Jankauskas, S.S.; Babenko, V.A.; Zorov, S.D.; Balakireva, A.V.; Juhaszova, M.; et al. Mitochondrial membrane potential. Anal. Biochem. 2018, 552, 50–59. [Google Scholar] [CrossRef]
- Bitmez, B.; Gultekin, S.K.; Albayrak, I.G.; Deveci, Y.; Sicak, Y.; Akalin, E.; Pirhan, A.F.; Gurer, U.; Arslan, B.A. Effects of Hypericum perforatum extract on 6-hydroxydopamine neurotoxicity in differentiated SH-SY5Y cells. Egypt. Pharm. J. 2023, 22, 188–191. [Google Scholar] [CrossRef]
- Yeni, Y.; Hacımüftüoğlu, A. The SH-SY5Y Human Cell Line: Hawthorne Berry (Crataegus spp.) Protects against 6-OHDA Induced Neurotoxicity In Vitro Model of Parkinson’s Disease. İstanbul Gelişim Üniversitesi Sağlık Bilim. Derg. 2024, 21, 881–889. [Google Scholar] [CrossRef]
- Klein, C.; Westenberger, A. Genetics of Parkinson’s Disease. Cold Spring Harb. Perspect. Med. 2012, 2, a008888. [Google Scholar] [CrossRef] [PubMed]
- Song, J.-X.; Lu, J.-H.; Liu, L.-F.; Chen, L.-L.; Durairajan, S.S.K.; Yue, Z.; Zhang, H.-Q.; Li, M. HMGB1 is involved in autophagy inhibition caused by SNCA/α-synuclein overexpression: A process modulated by the natural autophagy inducer corynoxine B. Autophagy 2013, 10, 144–154. [Google Scholar] [CrossRef] [PubMed]
- Settembre, C.; Fraldi, A.; Jahreiss, L.; Spampanato, C.; Venturi, C.; Medina, D.; de Pablo, R.; Tacchetti, C.; Rubinsztein, D.C.; Ballabio, A. A block of autophagy in lysosomal storage disorders. Hum. Mol. Genet. 2007, 17, 119–129. [Google Scholar] [CrossRef]
- Cheng, F.; Li, X.; Li, Y.; Wang, C.; Wang, T.; Liu, G.; Baskys, A.; Uéda, K.; Chan, P.; Yu, S. α-Synuclein promotes clathrin-mediated NMDA receptor endocytosis and attenuates NMDA-induced dopaminergic cell death. J. Neurochem. 2011, 119, 815–825. [Google Scholar] [CrossRef]
- Wu, K.-M.; Xu, Q.-H.; Liu, Y.-Q.; Feng, Y.-W.; Han, S.-D.; Zhang, Y.-R.; Chen, S.-D.; Guo, Y.; Wu, B.-S.; Ma, L.-Z.; et al. Neuronal FAM171A2 mediates α-synuclein fibril uptake and drives Parkinson’s disease. Science 2025, 387, 892–900. [Google Scholar] [CrossRef]
- Usmani, A.; Shavarebi, F.; Hiniker, A. The Cell Biology of LRRK2 in Parkinson’s Disease. Mol. Cell. Biol. 2021, 41, e00660-20. [Google Scholar] [CrossRef]
- Mitsumoto, A.; Nakagawa, Y. DJ-1 is an indicator for endogenous reactive oxygen species elicited by endotoxin. Free Radic. Res. 2001, 35, 885–893. [Google Scholar] [CrossRef]
- Taira, T.; Saito, Y.; Niki, T.; Iguchi-Ariga, S.M.M.; Takahashi, K.; Ariga, H. DJ-1 has a role in antioxidative stress to prevent cell death. Embo Rep. 2004, 5, 213–218. [Google Scholar] [CrossRef]
- Yang, G.; Li, J.; Cai, Y.; Yang, Z.; Li, R.; Fu, W. Glycyrrhizic Acid Alleviates 6-Hydroxydopamine and Corticosterone-Induced Neurotoxicity in SH-SY5Y Cells Through Modulating Autophagy. Neurochem. Res. 2018, 43, 1914–1926. [Google Scholar] [CrossRef]
- Lin, C.-Y.; Tsai, C.-W. Carnosic acid protects SH-SY5Y cells against 6-hydroxydopamine-induced cell death through upregulation of parkin pathway. Neuropharmacology 2016, 110, 109–117. [Google Scholar] [CrossRef] [PubMed]
- Cirmi, S.; Maugeri, A.; Lombardo, G.E.; Russo, C.; Musumeci, L.; Gangemi, S.; Calapai, G.; Barreca, D.; Navarra, M. A Flavonoid-Rich Extract of Mandarin Juice Counteracts 6-OHDA-Induced Oxidative Stress in SH-SY5Y Cells and Modulates Parkinson-Related Genes. Antioxidants 2021, 10, 539. [Google Scholar] [CrossRef] [PubMed]
- Jordán, J.; Galindo, M.F.; Tornero, D.; González-García, C.; Ceña, V. Bcl-xL blocks mitochondrial multiple conductance channel activation and inhibits 6-OHDA-induced death in SH-SY5Y cells. J. Neurochem. 2004, 89, 124–133. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Simpson, E.R.; Brown, K.A. p53: Protection against Tumor Growth beyond Effects on Cell Cycle and Apoptosis. Cancer Res. 2015, 75, 5001–5007. [Google Scholar] [CrossRef]
Primer | Forward (F) and Reverse (R) Sequences (5′ → 3′) | NCBI Accession Number |
---|---|---|
SNCA | F: TGACAAATGTTGGAGGAGCA | NM_000345.4 |
R: TGTCAGGATCCACAGGCATA | ||
LRRK2 | F: TCAGCTTGTTGTTGGACAGC | NM_198578.4 |
R: ACTGCGTGAGGAAGCTCATT | ||
PINK1 | F: ACGTTCAGTTACGGGAGTGG | NM_032409.3 |
R: GGCTAGTCAGGAGGGAAACC | ||
DJ-1 | F: GGGTGCAGGCTTGTAAACAT | NM_007262.5 |
R: GGACAAATGACCACATCACG | ||
PARK2 | F: CTGACACCAGCATCTTCCAG | NM_004562.3 |
R: CCAGTCATTCCTCAGCTCCT | ||
P53 | F: TGACACGCTTCCCTGGATTG | NM_001126114.3 |
R: GCTCGACGCTAGGATCTGAC | ||
Cyt-C | F: ACAAAGGCATCATCTGGGGAG | NM_018947.6 |
R: AAGGCAGTGGCCAATTATTACTC | ||
GAPDH | F: GACAGTCAGCCGCATCTTCT | NM_002046.7 |
R: GCGCCCAATACGACCAAATC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Derya-Andeden, M.; Altin-Celik, P.; Andeden, E.E.; Donmez-Altuntas, H. Desmodesmus Extract as a Mitochondrion-Targeted Neuroprotective Agent in Parkinson’s Disease: An In Vitro Study. Curr. Issues Mol. Biol. 2025, 47, 174. https://doi.org/10.3390/cimb47030174
Derya-Andeden M, Altin-Celik P, Andeden EE, Donmez-Altuntas H. Desmodesmus Extract as a Mitochondrion-Targeted Neuroprotective Agent in Parkinson’s Disease: An In Vitro Study. Current Issues in Molecular Biology. 2025; 47(3):174. https://doi.org/10.3390/cimb47030174
Chicago/Turabian StyleDerya-Andeden, Muazzez, Pinar Altin-Celik, Enver Ersoy Andeden, and Hamiyet Donmez-Altuntas. 2025. "Desmodesmus Extract as a Mitochondrion-Targeted Neuroprotective Agent in Parkinson’s Disease: An In Vitro Study" Current Issues in Molecular Biology 47, no. 3: 174. https://doi.org/10.3390/cimb47030174
APA StyleDerya-Andeden, M., Altin-Celik, P., Andeden, E. E., & Donmez-Altuntas, H. (2025). Desmodesmus Extract as a Mitochondrion-Targeted Neuroprotective Agent in Parkinson’s Disease: An In Vitro Study. Current Issues in Molecular Biology, 47(3), 174. https://doi.org/10.3390/cimb47030174