Cloning and Molecular Characterization of HSL and Its Expression Pattern in HPG Axis and Testis during Different Stages in Bactrian Camel
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Sample Collection
2.2. RNA Isolation and cDNA Synthesis
2.3. CDS Region Cloning of HSL Gene
2.4. Bioinformatics Analysis
2.5. Quantitative Real-Time PCR (qPCR)
2.6. Western Blot
2.7. Histologic and Immunofluorescence Analysis
2.8. Gene Ontology Analysis
2.9. Statistical Analysis
3. Results
3.1. Cloning and Sequence Analysis of Bactrian Camel HSL CDS
3.2. Homology Analysis and Evolutionary Relationships of the HSL Gene among Different Species
3.3. Expression and Localization Analysis of HSL in Bactrian Camel HPG-Axis Tissues
3.4. Expression and Localization of HSL in the Testis of Bactrian Camels at Different Ages
3.5. Functional Analyses of Bactrian Camel HSL in Steroid Hormone Synthesis and Metabolism
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Mirzaei, F. Production and trade of camel products in some Middle East countries. J. Agric. Econ. Dev. 2012, 1, 153–160. [Google Scholar]
- Sbihi, H.M.; Nehdi, I.A.; Al-Resayes, S.I. Characterization of Hachi (Camelus dromedarius) fat extracted from the hump. Food Chem. 2013, 139, 649–654. [Google Scholar] [CrossRef] [PubMed]
- El-Anany, A.M.; Ali, R.F.M. Physicochemical characteristics of binary mixtures of camel hump fat and citrus seed oil. Riv. Ital. Sostanze Grasse 2018, 95, 183–193. [Google Scholar]
- Holm, C.; Kirchgessner, T.G.; Svenson, K.L.; Fredrikson, G.; Nilsson, S.; Miller, C.G.; Shively, J.E.; Heinzmann, C.; Sparkes, R.S.; Mohandas, T.; et al. Hormone-sensitive lipase: Sequence, expression, and chromosomal localization to 19 cent-q13.3. Science 1988, 241, 1503–1506. [Google Scholar] [CrossRef]
- Holm, C. Molecular mechanisms regulating hormone-sensitive lipase and lipolysis. Biochem. Soc. Trans. 2003, 31, 1120–1124. [Google Scholar] [CrossRef]
- Varlamov, O.; Chu, M.P.; McGee, W.K.; Cameron, J.L.; O’Rourke, R.W.; Meyer, K.A.; Bishop, C.V.; Stouffer, R.L.; Roberts, C.T., Jr. Ovarian cycle-specific regulation of adipose tissue lipid storage by testosterone in female nonhuman primates. Endocrinology 2013, 154, 4126–4135. [Google Scholar] [CrossRef]
- Jaffer, I.; Riederer, M.; Shah, P.; Peters, P.; Quehenberger, F.; Wood, A.; Scharnagl, H.; März, W.; Kostner, K.M.; Kostner, G.M. Expression of fat mobilizing genes in human epicardial adipose tissue. Atherosclerosis 2012, 220, 122–127. [Google Scholar] [CrossRef]
- Jocken, J.W.; Goossens, G.H.; Boon, H.; Mason, R.R.; Essers, Y.; Havekes, B.; Watt, M.J.; van Loon, L.J.; Blaak, E.E. Insulin-mediated suppression of lipolysis in adipose tissue and skeletal muscle of obese type 2 diabetic men and men with normal glucose tolerance. Diabetologia 2013, 56, 2255–2265. [Google Scholar] [CrossRef]
- Hołysz, M.; Trzeciak, W.H. Hormone-sensitive lipase/cholesteryl esterase from the adrenal cortex-structure, regulation and role in steroid hormone synthesis. Postepy Biochem. 2015, 61, 138–146. [Google Scholar]
- Roduit, R.; Masiello, P.; Wang, S.P.; Li, H.; Mitchell, G.A.; Prentki, M. A role for hormone-sensitive lipase in glucose-stimulated insulin secretion: A study in hormone-sensitive lipase-deficient mice. Diabetes 2001, 50, 1970–1975. [Google Scholar] [CrossRef]
- Wang, F.; Chen, Z.; Ren, X.; Tian, Y.; Wang, F.; Liu, C.; Jin, P.; Li, Z.; Zhang, F.; Zhu, B. Hormone-sensitive lipase deficiency alters gene expression and cholesterol content of mouse testis. Reproduction 2017, 153, 175–185. [Google Scholar] [CrossRef]
- Chap, H. Forty five years with membrane phospholipids, phospholipases and lipid mediators: A historical perspective. Biochimie 2016, 125, 234–249. [Google Scholar] [CrossRef]
- Blaise, R.; Guillaudeux, T.; Tavernier, G.; Daegelen, D.; Evrard, B.; Mairal, A.; Holm, C.; Jégou, B.; Langin, D. Testis hormone-sensitive lipase expression in spermatids is governed by a short promoter in transgenic mice. J. Biol. Chem. 2001, 276, 5109–5115. [Google Scholar] [CrossRef]
- Casado, M.E.; Pastor, O.; Mariscal, P.; Canfrán-Duque, A.; Martínez-Botas, J.; Kraemer, F.B.; Lasunción, M.A.; Martín-Hidalgo, A.; Busto, R. Hormone-sensitive lipase deficiency disturbs the fatty acid composition of mouse testis. Prostaglandins Leukot. Essent. Fat. Acids 2013, 88, 227–233. [Google Scholar] [CrossRef]
- Casado, M.E.; Huerta, L.; Ortiz, A.I.; Pérez-Crespo, M.; Gutiérrez-Adán, A.; Kraemer, F.B.; Lasunción, M.; Busto, R.; Martín-Hidalgo, A. HSL-knockout mouse testis exhibits class B scavenger receptor upregulation and disrupted lipid raft microdomains. J. Lipid Res. 2012, 53, 2586–2597. [Google Scholar] [CrossRef] [PubMed]
- Haemmerle, G.; Zimmermann, R.; Hayn, M.; Theussl, C.; Waeg, G.; Wagner, E.; Sattler, W.; Magin, T.M.; Wagner, E.F.; Zechner, R. Hormone-sensitive lipase deficiency in mice causes diglyceride accumulation in adipose tissue, muscle, and testis. J. Biol. Chem. 2002, 277, 4806–4815. [Google Scholar] [CrossRef] [PubMed]
- Osuga, J.; Ishibashi, S.; Oka, T.; Yagyu, H.; Tozawa, R.; Fujimoto, A.; Shionoiri, F.; Yahagi, N.; Kraemer, F.B.; Tsutsumi, O.; et al. Targeted disruption of hormone-sensitive lipase results in male sterility and adipocyte hypertrophy, but not in obesity. Proc. Natl. Acad. Sci. USA 2000, 97, 787–792. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Otali, D.; Fredenburgh, J.; Oelschlager, D.K.; Grizzle, W.E. A standard tissue as a control for histochemical and immunohistochemical staining. Biotech. Histochem. Off. Publ. Biol. Stain. Comm. 2016, 91, 309–326. [Google Scholar] [CrossRef]
- Olsson, H.; Strålfors, P.; Belfrage, P. Phosphorylation of the basal site of hormone-sensitive lipase by glycogen synthase kinase-4. FEBS Lett. 1986, 209, 175–180. [Google Scholar] [CrossRef]
- Wang, F.; Ren, X.F.; Chen, Z.; Li, X.L.; Zhu, H.J.; Li, S.; Ou, X.H.; Zhang, C.; Zhang, F.X.; Zhu, B.C. The N-terminal His-tag affects the triglyceride lipase activity of hormone-sensitive lipase in testis. J. Cell. Biochem. 2019, 120, 13706–13716. [Google Scholar] [CrossRef] [PubMed]
- Chung, S.; Wang, S.P.; Pan, L.; Mitchell, G.; Trasler, J.; Hermo, L. Infertility and testicular defects in hormone-sensitive lipase-deficient mice. Endocrinology 2001, 142, 4272–4281. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Holst, L.S.; Langin, D.; Mulder, H.; Laurell, H.; Grober, J.; Bergh, A.; Mohrenweiser, H.W.; Edgren, G.; Holm, C. Molecular cloning, genomic organization, and expression of a testicular isoform of hormone-sensitive lipase. Genomics 1996, 35, 441–447. [Google Scholar] [CrossRef]
- Zimmermann, R.; Strauss, J.G.; Haemmerle, G.; Schoiswohl, G.; Birner-Gruenberger, R.; Riederer, M.; Lass, A.; Neuberger, G.; Eisenhaber, F.; Hermetter, A.; et al. Fat mobilization in adipose tissue is promoted by adipose triglyceride lipase. Science 2004, 306, 1383–1386. [Google Scholar] [CrossRef] [PubMed]
- Majumdar, S.S.; Bhattacharya, I. Genomic and post-genomic leads toward regulation of spermatogenesis. Prog. Biophys. Mol. Biol. 2013, 113, 409–422. [Google Scholar] [CrossRef]
- Holst, L.S.; Hoffmann, A.M.; Mulder, H.; Sundler, F.; Holm, C.; Bergh, A.; Fredrikson, G. Localization of hormone-sensitive lipase to rat Sertoli cells and its expression in developing and degenerating testes. FEBS Lett. 1994, 355, 125–130. [Google Scholar] [CrossRef]
- Mairal, A.; Melaine, N.; Laurell, H.; Grober, J.; Holst, L.S.; Guillaudeux, T.; Holm, C.; Jégou, B.; Langin, D. Characterization of a novel testicular form of human hormone-sensitive lipase. Biochem. Biophys. Res. Commun. 2002, 291, 286–290. [Google Scholar] [CrossRef]
- Hermo, L.; Chung, S.; Gregory, M.; Smith, C.E.; Wang, S.P.; El-Alfy, M.; Cyr, D.G.; Mitchell, G.A.; Trasler, J. Alterations in the testis of hormone sensitive lipase-deficient mice is associated with decreased sperm counts, sperm motility, and fertility. Mol. Reprod. Dev. 2008, 75, 565–577. [Google Scholar] [CrossRef]
- Stocco, D.M. StAR protein and the regulation of steroid hormone biosynthesis. Annu. Rev. Physiol. 2001, 63, 193–213. [Google Scholar] [CrossRef]
- Yazawa, T.; Inaba, H.; Imamichi, Y.; Sekiguchi, T.; Uwada, J.; Islam, M.S.; Orisaka, M.; Mikami, D.; Ida, T.; Sato, T.; et al. Profiles of 5α-Reduced Androgens in Humans and Eels: 5α-Dihydrotestosterone and 11-Ketodihydrotestosterone Are Active Androgens Produced in Eel Gonads. Front. Endocrinol. 2021, 12, e657360. [Google Scholar] [CrossRef]
- Li, H.; Brochu, M.; Wang, S.; Rochdi, L.; Côté, M.; Mitchell, G.; Gallo-Payet, N.J.E. Hormone-sensitive lipase deficiency in mice causes lipid storage in the adrenal cortex and impaired corticosterone response to corticotropin stimulation. Endocrinology 2002, 143, 3333–3340. [Google Scholar] [CrossRef] [PubMed]
Gene | Sequence (5′-3′) | Tm (°C) | Length/bp | GenBank No. |
---|---|---|---|---|
HSL | ATGGAATCGGCCAGAGAAACG CTAGTTACTAGTTACGTAGAAACAGCCCT | 60 | 648 | XM_032487400.1 |
HSL | AACCGCCGCAGCATCTT CCCTCGTCGCCCTCAAA | 58 | 155 | XM_045510514.1 |
GAPDH | AACATCATCCCTGCTTCTACC ATGCCTGCTTCACTACCTTCT | 56 | 184 | NM_001357943.2 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nan, J.; Wang, Q.; Yan, Q.; Wang, J.; Zhang, Y.; Zhao, X. Cloning and Molecular Characterization of HSL and Its Expression Pattern in HPG Axis and Testis during Different Stages in Bactrian Camel. Curr. Issues Mol. Biol. 2022, 44, 3779-3791. https://doi.org/10.3390/cimb44080259
Nan J, Wang Q, Yan Q, Wang J, Zhang Y, Zhao X. Cloning and Molecular Characterization of HSL and Its Expression Pattern in HPG Axis and Testis during Different Stages in Bactrian Camel. Current Issues in Molecular Biology. 2022; 44(8):3779-3791. https://doi.org/10.3390/cimb44080259
Chicago/Turabian StyleNan, Jinghong, Qi Wang, Qiu Yan, Jie Wang, Yong Zhang, and Xingxu Zhao. 2022. "Cloning and Molecular Characterization of HSL and Its Expression Pattern in HPG Axis and Testis during Different Stages in Bactrian Camel" Current Issues in Molecular Biology 44, no. 8: 3779-3791. https://doi.org/10.3390/cimb44080259
APA StyleNan, J., Wang, Q., Yan, Q., Wang, J., Zhang, Y., & Zhao, X. (2022). Cloning and Molecular Characterization of HSL and Its Expression Pattern in HPG Axis and Testis during Different Stages in Bactrian Camel. Current Issues in Molecular Biology, 44(8), 3779-3791. https://doi.org/10.3390/cimb44080259