Physiological and Epigenetic Reaction of Barley (Hordeum vulgare L.) to the Foliar Application of Silicon under Soil Salinity Conditions
Abstract
:1. Introduction
2. Results
2.1. Effect of Salinity and Foliar Application of Si on the Relative Chlorophyll Content of Barley Leaves (CCI)
2.2. Influence of Salinity and Foliar Application of Si on Gas Exchange Parameters
2.3. Influence of Experimental Factors on the Chlorophyll Fluorescence Parameters
2.4. Effect of Salinity and Foliar Application of Silicon on the Level of DNA Methylation
3. Discussion
4. Materials and Methods
4.1. Plant Material and Growing Conditions
4.2. Measurement of the Relative Content of Chlorophyll
4.3. Measurement of Chlorophyll Fluorescence
4.4. Measurement of Gas Exchange
4.5. Methylation-Sensitive Amplification Polymorphism (MSAP) Assay
MSAP Electrophoresis and Visualization
4.6. Methylation Analysis
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Food and Agriculture Organization of the United Nations. Intergovernmental Technical Panel on Soils. Global Status of Soil Salinization and Sodification. In Status of the World’s Soil Resources: Main Report; FAO: Rome, Italy, 2015; pp. 124–127. [Google Scholar]
- Machado, R.M.A.; Serralheiro, R.P. Soil salinity: Effect on vegetable crop growth. management practices to prevent and mitigate soil salinization. Horticulturae 2017, 3, 30. [Google Scholar] [CrossRef]
- Mohanavelu, A.; Naganna, S.R.; Al-Ansari, N. Irrigation induced salinity and sodicity hazards on soil and groundwater: An overview of its causes, impacts and mitigation strategies. Agriculture 2021, 11, 983. [Google Scholar] [CrossRef]
- Isayenkov, S.V.; Maathuis, F.J. Plant salinity stress: Many unanswered questions remain. Front. Plant Sci. 2019, 10, 80. [Google Scholar] [CrossRef] [Green Version]
- Awaad, H.A.; Mansour, E.; Akrami, M.; Fath, H.E.; Javadi, A.A.; Negm, A. Availability and feasibility of water desalination as a non-conventional resource for agricultural irrigation in the mena region: A review. Sustainability 2020, 12, 7592. [Google Scholar] [CrossRef]
- Litalien, A.; Zeeb, B. Curing the earth: A review of anthropogenic soil salinization and plant-based strategies for sustainable mitigation. Sci. Total Environ. 2020, 698, 134235. [Google Scholar] [CrossRef] [PubMed]
- Rodziewicz, P.; Swarcewicz, B.; Chmielewska, K.; Wojakowska, A.; Stobiecki, M. Influence of abiotic stresses on plant proteome and metabolome changes. Acta Physiol. Plant 2014, 36, 1–19. [Google Scholar] [CrossRef] [Green Version]
- Shrivastava, P.; Kumar, R. Soil salinity: A serious environmental issue and plant growth promoting bacteria as one of the tools for its alleviation. Saudi J. Biol. Sci. 2015, 22, 123–131. [Google Scholar] [CrossRef] [Green Version]
- Tuteja, N. Mechanisms of high salinity tolerance in plants. Meth. Enzymol. 2007, 428, 419–438. [Google Scholar] [CrossRef]
- Munns, R.; Tester, M. Mechanisms of salinity tolerance. Annu. Rev. Plant Biol. 2008, 59, 651–681. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hossain, M.S.; Dietz, K.-J. Tuning of redox regulatory mechanisms, reactive oxygen species and redox homeostasis under salinity stress. Front. Plant Sci. 2016, 7, 548. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tsugane, K.; Kobayashi, K.; Niwa, Y.; Ohba, Y.; Wada, K.; Kobayashia, H. A recessive Arabidopsis mutant that grows photoautotrophically under salt stress shows enhanced active oxygen detoxification. Plant Cell 1999, 11, 1195–1206. [Google Scholar] [CrossRef] [Green Version]
- Hernández, J.A.; Ferrer, M.A.; Jiménez, A.; Barceló, A.R.; Sevilla, F. Antioxidant systems and O2−/H2O2 production in the apoplast of pea leaves. Its relation with salt-induced necrotic lesions in minor veins. Plant Physiol. 2001, 127, 817–831. [Google Scholar] [CrossRef] [PubMed]
- Chaves, M.M.; Flexas, J.; Pinheiro, C. Photosynthesis under drought and salt stress: Regulation mechanisms from whole plant to cell. Ann. Botany 2009, 103, 551–560. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abogadallah, G.M. Insights into the significance of antioxidative defense under salt stress. Plant Signal. Behav. 2010, 5, 369–374. [Google Scholar] [CrossRef] [PubMed]
- Isayenkov, S.V. Physiological and molecular aspects of salt stress in plants. Cyt. Genet. 2012, 46, 302–318. [Google Scholar] [CrossRef] [Green Version]
- You, J.; Chan, Z. ROS regulation during abiotic stress responses in crop plants. Front. Plant Sci. 2015, 6, 1092. [Google Scholar] [CrossRef] [Green Version]
- Apel, K.; Hirt, H. Reactive oxygen species: Metabolism, oxidative stress, and signal transduction. Ann. Rev. Plant Biol. 2004, 55, 373–399. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tripathy, B.C.; Oelmüller, R. Reactive oxygen species generation and signaling in plants. Plant Signal. Behav. 2012, 7, 1621–1633. [Google Scholar] [CrossRef] [PubMed]
- Sies, H.; Berndt, C.; Jones, D.P. Oxidative stress. Annu. Rev. Biochem. 2017, 86, 715–748. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, S.; Badger, M.R. Photoprotection in plants: A new light on photosystem II damage. Trends Plant Sci. 2011, 16, 53–60. [Google Scholar] [CrossRef] [PubMed]
- Sudhir, P.; Murthy, S. Effects of salt stress on basic processes of photosynthesis. Photosynthetica 2004, 42, 481–486. [Google Scholar] [CrossRef]
- Stepien, P.; Johnson, G.N. Contrasting responses of photosynthesis to salt stress in the glycophyte Arabidopsis and the halophyte Thellungiella: Role of the plastid terminal oxidase as an alternative electron sink. Plant Physiol. 2009, 149, 1154–1165. [Google Scholar] [CrossRef] [Green Version]
- Ashraf, M.; Harris, P.J.C. Photosynthesis under stressful environments: An overview. Photosynthetica 2013, 51, 163–190. [Google Scholar] [CrossRef]
- Ashraf, M. Relationships between growth and gas exchange characteristics in some salt-tolerant amphidiploid Brassica species in relation to their diploid parents. Environ. Exp. Bot. 2011, 45, 155–163. [Google Scholar] [CrossRef]
- Bano, A.; Fatima, M. Salt tolerance in Zea mays (L.) following inoculation with Rhizobium and Pseudomonas. Biol. Fertil. Soils 2009, 45, 405–413. [Google Scholar] [CrossRef]
- Parihar, P.; Singh, S.; Singh, R.; Singh, V.P.; Prasad, S.M. Effect of salinity stress on plants and its tolerance strategies: A review. Environ. Sci. Pollut. Res. 2015, 22, 4056–4075. [Google Scholar] [CrossRef]
- Fahad, S.; Hussain, S.; Matloob, A.; Khan, F.A.; Khaliq, A.; Saud, S.; Hassan, S.; Shan, D.; Khan, F.; Huang, J.; et al. Phytohormones and plant responses to salinity stress: A review. Plant Growth Regul. 2015, 75, 391–404. [Google Scholar] [CrossRef]
- Hussain, M.; Ahmad, S.; Hussain, S.; Lal, R.; Ul-Allah, S.; Nawaz, A. Rice in saline soils: Physiology, biochemistry, genetics and management. Adv. Agron. 2018, 148, 231–287. [Google Scholar] [CrossRef]
- Singh, J.; Thakur, J.K. Photosynthesis and Abiotic Stress in Plants. In Biotic and Abiotic Stress Tolerance in Plants; Vats, S., Ed.; Springer: Singapore, 2018; pp. 27–46. [Google Scholar] [CrossRef]
- Jallouli, S.; Ayadi, S.; Landi, S.; Capasso, G.; Santini, G.; Chamekh, Z.; Zouari, I.; Ben Azaiez, F.E.; Trifa, Y.; Esposito, S. Physiological and molecular osmotic stress responses in three durum wheat (Triticum turgidum ssp. durum) genotypes. Agronomy 2019, 9, 550. [Google Scholar] [CrossRef] [Green Version]
- Leng, P.; Yuan, B.; Guo, Y. The role of abscisic acid in fruit ripening and responses to abiotic stress. J. Exp. Bot. 2014, 65, 4577–4588. [Google Scholar] [CrossRef]
- Lim, C.W.; Baek, W.; Jung, J.; Kim, J.H.; Lee, S.C. Function of ABA in stomatal defense against biotic and drought stresses. Int. J. Mol. Sci. 2015, 16, 15251–15270. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bücker-Neto, L.; Paiva, A.L.S.; Machado, R.D.; Arenhart, R.A.; Margis-Pinheiro, M. Interactions between plant hormones and heavy metals responses. Genet. Mol. Biol. 2017, 40, 373–386. [Google Scholar] [CrossRef] [PubMed]
- Khaleghi, E.; Arzani, K.; Moallemi, N.; Barzegar, M. Evaluation of chlorophyll content and chlorophyll fluorescence parameters and relationships between chlorophyll a, b and chlorophyll content index under water stress in Olea europaea cv. Dezful. World Acad. Eng. Technol. 2012, 6, 1154–1157. [Google Scholar] [CrossRef]
- Murchie, E.H.; Lawson, T. Chlorophyll fluorescence analysis: A guide to good practice and understanding some new applications. J. Exp. Bot. 2013, 64, 3983–3998. [Google Scholar] [CrossRef] [Green Version]
- Goltsev, V.N.; Kalaji, H.M.; Paunov, M.; Bąba, W.; Horaczek, T.; Mojski, J.; Kociel, H.; Allakhverdiev, S.I. Variable chlorophyll fluorescence and its use for assessing physiological condition of plant photosynthetic apparatus. Russ. J. Plant Physiol. 2016, 63, 869–893. [Google Scholar] [CrossRef]
- Kalaji, H.M.; Schansker, G.; Brestic, M.; Bussotti, F.; Calatayud, A.; Ferroni, L.; Goltsev, V.; Guidi, L.; Jajoo, A.; Bąba, W.; et al. Frequently asked questions about chlorophyll fluorescence, the sequel. Photosynth. Res. 2017, 132, 13–66. [Google Scholar] [CrossRef] [Green Version]
- Stephens, K.E.; Miaskowski, C.A.; Levine, J.D.; Pullinger, C.R.; Aouizerat, B.E. Epigenetic regulation and measurement of epigenetic changes. Biol. Res. Nurs. 2018, 15, 373–381. [Google Scholar] [CrossRef] [Green Version]
- Xiong, L.Z.; Xu, C.G.; Saghai Maroof, M.A.; Zhang, Q. Patterns of cytosine methylation in an elite rice hybrid and its parental lines, detected by a methylation-sensitive amplification polymorphism technique. Mol. Gen. Genet. 1999, 261, 439–446. [Google Scholar] [CrossRef]
- Jones, P.A.; Baylin, S.B. The epigenomics of cancer. Cell 2007, 128, 683–692. [Google Scholar] [CrossRef] [Green Version]
- Ashapkin, V.V.; Kutueva, L.I.; Aleksandrushkina, N.I.; Vanyushin, B.F. Epigenetic mechanisms of plant adaptation to biotic and abiotic stresses. Int. J. Mol. Sci. 2020, 21, 7457. [Google Scholar] [CrossRef]
- Ganguly, D.R.; Crisp, P.A.; Eichten, S.R.; Pogson, B.J. Maintenance of pre-existing DNA methylation states through recurring excess-light stress. Plant Cell Environ. 2018, 41, 1657–1672. [Google Scholar] [CrossRef]
- Peraza-Echeverria, S.; Herrera-Valencia, A.V.; James-Kay, A. Detection of DNA methylation changes in micropropagated banana plants using methkumarylation-sensitive amplification polymorphism (MSAP). Plant Sci. 2001, 161, 359–367. [Google Scholar] [CrossRef]
- Ferreira, L.J.; Azevedo, V.; Maroco, J.; Oliveira, M.M.; Santos, A.P. Salt tolerant and sensitive rice varieties display differential methylome flexibility under salt stress. PLoS ONE 2015, 10, e0124060. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Karan, R.; de Leon, T.; Biradar, H.; Subudhi, P.K. Salt stress induced variation in DNA methylation pattern and its influence on gene expression in contrasting rice genotypes. PLoS ONE 2012, 7, e40203. [Google Scholar] [CrossRef]
- Wang, W.S.; Pan, Y.J.; Zhao, X.Q.; Dwivedi, D.; Zhu, L.H.; Ali, J.; Fu, B.Y.; Li, Z.K. Drought-induced site-specific DNA methylation and its association with drought tolerance in rice (Oryza sativa L.). J. Exp. Bot. 2011, 62, 1951–1960. [Google Scholar] [CrossRef] [PubMed]
- Zhong, L.; Xu, Y.; Wang, J.B. DNA-methylation changes induced by salt stress in wheat. Afr. J. Biotechnol. 2009, 8, 6201–6207. [Google Scholar] [CrossRef]
- Wang, B.; Zhang, M.; Fu, R.; Qian, X.; Rong, P.; Zhang, Y.; Jiang, P.; Wang, J.; Lu, X.; Wang, D.; et al. Epigenetic mechanisms of salt tolerance and heterosis in upland cotton (Gossypium hirsutum L.) revealed by methylation-sensitive amplified polymorphism analysis. Euphytica 2016, 208, 477–491. [Google Scholar] [CrossRef]
- Chen, R.; Li, M.; Zhang, H.; Duan, L.; Sun, X.; Jiang, Q.; Zhang, H.; Hu, Z. Continuous salt stress-induced long non-coding RNAs and DNA methylation patterns in soybean roots. BMC Genom. 2019, 20, 730. [Google Scholar] [CrossRef] [Green Version]
- Babaeian, M.; Tavassoli, A.; Ghanbari, A.; Esmaeilian, Y.; Fahimifard, M. Effects of foliar micronutrient application on osmotic adjustments, grain yield and yield components in sunflower (Alstar cultivar) under water stress at three stages. Afr. J. Agric. Res. 2011, 6, 1204–1208. [Google Scholar] [CrossRef]
- Sajedi, N.A.; Ardakani, M.R.; Madani, H.; Naderi, A.; Miransari, M. The effects of selenium and other micronutrients on the antioxidant activities and yield of corn (Zea mays L.) under drought stress. Physiol. Mol. Biol. Plants 2011, 17, 215–222. [Google Scholar] [CrossRef] [Green Version]
- Karim, M.R.; Zhang, Y.Q.; Zhao, R.R.; Chen, X.P.; Zhang, F.S.; Zou, C.Q. Alleviation of drought stress in winter wheat by late foliar application of zinc, boron, and manganese. J. Plant. Nutr. Soil Sci. 2012, 175, 142–151. [Google Scholar] [CrossRef]
- Niu, J.; Liu, C.; Huang, M.; Liu, K.; Yan, D. Effects of foliar fertilization: A review of current status and future perspectives. J. Soil Sci. Plant Nutr. 2021, 21, 104–118. [Google Scholar] [CrossRef]
- Sajedi, N.; Madani, H.; Naderi, A. Effect of microelements and selenium on superoxide dismutase enzyme, malondialdehyde activity and grain yield maize (Zea mays L.) under water deficit stress. Not. Bot. Horti Agrobot. Cluj-Napoca 2011, 39, 153–159. [Google Scholar] [CrossRef] [Green Version]
- Tavanti, T.R.; de Melo, A.A.R.; Moreira, L.D.K.; Sanchez, D.E.J.; dos Santos Silva, R.; da Silva, R.M.; dos Reis, A.R. Micronutrient fertilization enhances ROS scavenging system for alleviation of abiotic stresses in plants. Plant Physiol. Biochem. 2021, 160, 386–396. [Google Scholar] [CrossRef]
- Abdelaal, K.A.A.; Mazrou, Y.S.A.; Hafez, Y.M. Silicon foliar application mitigates salt stress in sweet pepper plants by enhancing water status, photosynthesis, antioxidant enzyme activity and fruit yield. Plants 2020, 9, 733. [Google Scholar] [CrossRef]
- Epstein, E. The anomaly of silicon in plant biology. Proc. Natl. Acad. Sci. USA 1994, 91, 11–17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Neumann, D. Silicon in plants. Prog. Mol. Subcell. Biol. 2003, 33, 149–160. [Google Scholar] [CrossRef]
- Luyckx, M.; Hausman, J.F.; Lutts, S.; Guerriero, G. Silicon and plants: Current knowledge and technological perspectives. Front. Plant Sci. 2017, 8, 411. [Google Scholar] [CrossRef] [Green Version]
- Savvas, D.; Ntatsi, G. Biostimulant activity of silicon in horticulture. Sci. Hortic. 2015, 196, 66–81. [Google Scholar] [CrossRef]
- Hou, L.; Szwonek, E.; Xing, S. Advances in silicon research of horticultural crops. Veg. Crops Res. Bull. 2006, 64, 5–17. [Google Scholar]
- Sacala, E.; Durbajlo, W. The effect of sodium silicate on maize growing under stress conditions. Przem. Chem. 2012, 91, 949–951. (In Polish) [Google Scholar]
- Adrees, M.; Ali, S.; Rizwan, M.; Zia-ur-Rehman, M.; Ibrahim, M.; Abbas, F.; Farid, M.; Qayyum, M.F.; Irshad, M.K. Mechanisms of silicon-mediated alleviation of heavy metal toxicity in plants: A review. Ecotoxicol. Environ. Saf. 2015, 119, 186–197. [Google Scholar] [CrossRef]
- Pati, S.; Pal, B.; Badole, S.; Hazra, G.C.; Mandal, B. Effect of silicon fertilization on growth, yield, and nutrient uptake of rice. Commun. Soil Sci. Plant Anal. 2016, 47, 284–290. [Google Scholar] [CrossRef]
- Mustafa, T.; Sattar, A.; Sher, A.; Ul-Allah, S.; Ijaz, M.; Irfan, M.; Buth, M.; Cheema, M. Exogenous application of silicon improves the performance of wheat under terminal heat stress by triggering physio-biochemical mechanisms. Sci. Rep. 2021, 11, 1–12. [Google Scholar] [CrossRef]
- Etesami, H.; Jeong, B.R. Silicon (Si): Review and future prospects on the action mechanisms in alleviating biotic and abiotic stresses in plants. Ecotoxicol. Environ. Saf. 2018, 147, 881–896. [Google Scholar] [CrossRef]
- Hussain, A.; Rizwan, M.; Ali, Q.; Shafaqat, A. Seed priming with silicon nanoparticles improved the biomass and yield while reduced the oxidative stress and cadmium concentration in wheat grains. Environ. Sci. Pollut. Res. 2019, 26, 7579–7588. [Google Scholar] [CrossRef]
- Qados, A.M.A. Mechanism of nanosilicon-mediated alleviation of salinity stress in faba bean (Vicia faba L.) plants. J. Exp. Agric. Int. 2015, 7, 78–95. [Google Scholar] [CrossRef]
- Saleh, J.; Najafi, N.; Oustan, S. Effects of silicon application on wheat growth and some physiological characteristics under different levels and sources of salinity. Commun. Soil Sci. Plant Anal. 2017, 48, 1114–1122. [Google Scholar] [CrossRef]
- Chen, W.; Yao, X.; Cai, K.; Chen, J. Silicon alleviates drought stress of rice plants by improving plant water status, photosynthesis and mineral nutrient absorption. Biol. Trace Elem. Res. 2011, 142, 67–76. [Google Scholar] [CrossRef]
- Ali, S.; Farooq, M.A.; Yasmeen, T.; Hussain, S.; Arif, M.S.; Abbas, F.; Bharwana, S.A.; Zhang, G. The influence of silicon on barley growth, photosynthesis and ultra-structure under chromium stress. Ecotoxicol. Environ. Saf. 2013, 89, 66–72. [Google Scholar] [CrossRef]
- Xie, Z.; Song, R.; Shao, H.; Song, F.; Xu, H.; Lu, Y. Silicon improves maize photosynthesis in saline-alkaline soils. Sci. World J. 2015, 2015, 245072. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.J.; Zhang, X.J.; Lang, D.Y.; Li, M.; Liu, H.; Zhang, X.H. Silicon alleviates salt and drought stress of Glycyrrhiza uralensis plants by improving photosynthesis and water status. Biol. Plant. 2020, 64, 302–313. [Google Scholar] [CrossRef] [Green Version]
- Ma, J.; Choi, H.; Stafford, R.J.; Miller, M.J. Silicone-specific imaging using an inversion-recovery-prepared fast three-point Dixon technique. J. Magn. Reson. Imaging 2004, 19, 298–302. [Google Scholar] [CrossRef]
- Guével, M.H.; Menzies, J.G.; Bélanger, R.R. Effect of root and foliar applications of soluble silicon on powdery mildew control and growth of wheat plants. Eur. J. Plant Pathol. 2007, 119, 429–436. [Google Scholar] [CrossRef]
- Artyszak, A. Effect of silicon fertilization on crop yield quantity and quality—A literature review in Europe. Plants 2018, 7, 54. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Oliveira, R.L.L.; de Mello Prado, R.; Felisberto, G.; Cruz, F.J.R. Different sources of silicon by foliar spraying on the growth and gas exchange in sorghum. J. Soil Sci. Plan. Nutr 2019, 19, 948–953. [Google Scholar] [CrossRef]
- Grašič, M.; Dobravc, M.; Golob, A.; Vogel-Mikuš, K.; Gaberščik, A. Water shortage reduces silicon uptake in barley leaves. Agric. Water Manag. 2019, 217, 47–56. [Google Scholar] [CrossRef]
- Domiciano, G.P.; Cacique, I.S.; Chagas Freitas, C.; Filippi, M.C.C.; da Matta, F.M.; do Vale, F.X.R.; Rodrigues, F.Á. Alterations in gas exchange and oxidative metabolism in rice leaves infected by Pyricularia oryzae are attenuated by silicon. Phytopathology 2015, 105, 738–747. [Google Scholar] [CrossRef] [Green Version]
- Laane, H.-M. The effects of foliar sprays with different silicon compounds. Plants 2018, 7, 45. [Google Scholar] [CrossRef] [Green Version]
- Sienkiewicz-Cholewa, U. Response of spring wheat grown in drought stress to foliar and soil silicon application. Prog. Plant Prot. 2021, 61, 207–213. [Google Scholar] [CrossRef]
- Abdel-Haliem, M.E.; Hegazy, H.S.; Hassan, N.S.; Naguib, D.M. Effect of silica ions and nano silica on rice plants under salinity stress. Ecol. Eng. 2017, 99, 282–289. [Google Scholar] [CrossRef]
- Hellal, F.A.; Abdelhameid, M.; Abo-Basha, D.M.; Zewainy, R.M. Alleviation of the adverse effects of soil salinity stress by foliar application of silicon on faba bean (Vica faba L.). Res. J. Appl. Sci. 2012, 8, 4428–4433. [Google Scholar]
- Shaaban, M.M.; Abou El-Nour, E.Z.A. Macro and micro-nutrients concentrations and uptake by maize seedlings irrigated with fresh or saline water as affected by K-silicate foliar fertilization. Am. J. Plant Physiol. 2014, 9, 95–102. [Google Scholar] [CrossRef] [Green Version]
- Avestan, S.; Ghasemnezhad, M.; Esfahani, M.; Byrt, C.S. Application of nano-silicon dioxide improves salt stress tolerance in strawberry plants. Agronomy 2019, 9, 246. [Google Scholar] [CrossRef] [Green Version]
- Qados, A.; Moftah, A. Influence of silicon and nano-silicon on germination, growth and yield of faba bean (Vicia faba L.) under salt stress conditions. J. Exp. Agric. Int. 2014, 5, 509–524. [Google Scholar] [CrossRef]
- Maathuis, F.J.M.; Amtmann, A. K+ nutrition and Na+ toxicity: The basis of cellular K+/Na+ ratios. Ann. Bot. 1999, 84, 123–133. [Google Scholar] [CrossRef] [Green Version]
- Shabala, S.; Cuin, T.A. Potassium transport and plant salt tolerance. Physiol. Plant. 2008, 133, 651–669. [Google Scholar] [CrossRef] [PubMed]
- Chakraborty, K.; Bhaduri, D.; Meena, H.N.; Kalariya, K. External potassium (K(+)) application improves salinity tolerance by promoting Na(+)-exclusion, K(+)-accumulation and osmotic adjustment in contrasting peanut cultivars. Plant Physiol. Biochem. 2016, 103, 143–153. [Google Scholar] [CrossRef]
- Mittler, R. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 2002, 7, 405–410. [Google Scholar] [CrossRef]
- Ozfidan-Konakci, C.; Yildiztugay, E.; Kucukoduk, M. Protective roles of exogenously applied gallic acid in Oryza sativa subjected to salt and osmotic stresses: Effects on the total antioxidant capacity. Plant Growth Regul. 2015, 75, 219–234. [Google Scholar] [CrossRef]
- Tyerman, S.D.; Munns, R.; Fricke, W.; Arsova, B.; Barkla, B.J.; Bose, J.; Bramley, H.; Byrt, C.; Chen, Z.; Wen, Z. Energy costs of salinity tolerance in crop plants. New Phytol. 2019, 221, 25–29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rodrigues-Corrêa, K.C.D.S.; Fett-Neto, A.G. Abiotic stresses and non-protein amino acids in plants. Crit. Rev. Plant Sci. 2019, 38, 411–430. [Google Scholar] [CrossRef]
- Dawood, M.G.; Taie, H.A.A.; Nassar, R.M.A.; Abdelhamid, M.T.; Schmidhalter, U. The changes induced in the physiological, biochemical and anatomical characteristics of Vicia faba by the exogenous application of proline under seawater stress. S. Afr. J. Bot. 2014, 93, 54–63. [Google Scholar] [CrossRef] [Green Version]
- Zeng, F.; Shabala, L.; Zhou, M.; Zhang, G.; Shabala, S. Barley responses to combined waterlogging and salinity stress: Separating effects of oxygen deprivation and elemental toxicity. Front. Plant Sci. 2013, 4, 313. [Google Scholar] [CrossRef] [Green Version]
- Negrao, S.; Schmöckel, S.M.; Tester, M. Evaluating traits contributing to salinity tolerance. Ann. Bot. 2017, 119, 13–26. [Google Scholar] [CrossRef] [Green Version]
- Taiz, L.; Zeiger, E. Photosynthesis: Physiological and Ecological Considerations. In Plant Physiology, 4th ed.; Taiz, L., Zeiger, E., Eds.; Sinauer Associates Inc.: Sunderland, MA, USA, 2002; Volume 9, pp. 172–174. [Google Scholar]
- Zeeshan, M.; Lu, M.; Sehar, S.; Holford, P.; Wu, F. Comparison of biochemical, anatomical, morphological, and physiological responses to salinity stress in wheat and barley genotypes deferring in salinity tolerance. Agronomy 2020, 10, 127. [Google Scholar] [CrossRef] [Green Version]
- Parida, A.K.; Das, A.B.; Mittra, B. Effects of NaCl stress on the structure, pigment complex composition, and photosynthetic activity of mangrove Bruguiera parviflora chloroplasts. Photosynthetica 2003, 41, 191–200. [Google Scholar] [CrossRef]
- Kalteh, M.; Alipour, Z.; Ashraf, S.; Marashi Aliabadi, M.; Falah Nosratabadi, A. Effect of silica nanoparticles on basil (Ocimum basilicum) under salinity stress. J. Chem. Health Risks 2018, 4, 49–55. [Google Scholar] [CrossRef]
- Chung, Y.S.; Kim, K.S.; Hamayun, M.; Kim, Y. Silicon confers soybean resistance to salinity stress through regulation of reactive oxygen and reactive nitrogen species. Front. Plant Sci. 2020, 10, 1725. [Google Scholar] [CrossRef]
- Mateos-Naranjo, E.; Andrades-Moreno, L.; Davy, A.J. Silicon alleviates deleterious effects of high salinity on the halophytic grass Spartina densiflora. Plant Physiol. Biochem. 2013, 63, 115–121. [Google Scholar] [CrossRef]
- Ueda, A.; Yahagi, H.; Fujikawa, Y.; Nagaoka, T.; Esaka, M.; Calcaño, M.; González, M.M.; Martich, J.D.H.; Saneoka, H. Comparative physiological analysis of salinity tolerance in rice. Soil Sci. Plant Nutr. 2013, 59, 896–903. [Google Scholar] [CrossRef]
- Ueda, A.; Kanechi, M.; Uno, Y.; Inagaki, N. Photosynthetic limitations of a halophyte sea aster (Aster tripolium L.) under water stress and NaCl stress. J. Plant Res. 2003, 116, 65–70. [Google Scholar] [CrossRef] [PubMed]
- Hernández, J.A.; Olmos, E.; Corpas, F.J.; Sevilla, F.; del Río, L.A. Salt-induced oxidative stress in chloroplasts of pea plants. Plant Sci. 1995, 105, 151–167. [Google Scholar] [CrossRef]
- Gururani, M.A.; Venkatesh, J.; Tran, L.S.P. Regulation of photosynthesis during abiotic stress-induced photoinhibition. Mol. Plant 2015, 8, 1304–1320. [Google Scholar] [CrossRef] [Green Version]
- Ali, M.; Gul, A.; Hasan, H.; Gul, S.; Fareed, A.; Nadeem, M.; Siddique, R.; Jan, S.U.; Jamil, M. Cellular Mechanisms of Drought Tolerance in Wheat. In Climate Change and Food Security with Emphasis on Wheat; Oztruk, M., Gul, A., Eds.; Academic Press: Cambridge, MA, USA, 2020; Volume 9, pp. 155–164. [Google Scholar] [CrossRef]
- Leegood, R.C.; Lea, P.J.; Adcock, M.D.; Häusler, R.E. The regulation and control of photorespiration. J. Exp. Bot. 1995, 46, 1397–1414. [Google Scholar] [CrossRef]
- Netondo, G.W.; Onyango, J.C.; Beck, E. Sorghum and salinity: II. Gas exchange and chlorophyll fluorescence of sorghum under salt stress. Crop Sci. 2004, 44, 806. [Google Scholar] [CrossRef]
- Sharma, N.; Gupta, N.K.; Gupta, S.; Hasegawa, H. Effect of NaCl salinity on photosynthetic rate, transpiration rate, and oxidative stress tolerance in contrasting wheat genotypes. Photosynthetica 2005, 43, 609–613. [Google Scholar] [CrossRef]
- James, R.A.; Rivelli, A.R.; Munns, R.; von Caemmerer, S. Factors affecting CO2 assimilation, leaf injury and growth in salt-stressed durum wheat. Funct. Plant Biol. 2002, 29, 1393–1403. [Google Scholar] [CrossRef]
- Yeo, A.R.; Flowers, S.A.; Rao, G.; Welfare, K.; Senanayake, N.; Flowers, T.J. Silicon reduces sodium uptake in rice (Oryza sativa L.) in saline conditions and this is accounted for by a reduction in the transpirational bypass flow. Plant Cell Environ. 1999, 22, 559–565. [Google Scholar] [CrossRef]
- Li, H.; Zhu, Y.; Hu, Y. Beneficial effects of silicon in alleviating salinity stress of tomato seedlings grown under sand culture. Acta Physiol Plant 2015, 37, 71. [Google Scholar] [CrossRef]
- Zhu, Y.; Gong, H. Beneficial effects of silicon on salt and drought tolerance in plants. Agron. Sustain. Dev. 2014, 34, 455–472. [Google Scholar] [CrossRef] [Green Version]
- Rios, J.J.; Martínez-Ballesta, M.C.; Ruiz, J.M.; Blasco, B.; Carvajal, M. Silicon-mediated improvement in plant salinity tolerance: The role of aquaporins. Front. Plant Sci. 2017, 8, 948. [Google Scholar] [CrossRef] [Green Version]
- Goltsev, V.; Zaharieva, I.; Chernev, P.; Kouzmanova, M.; Kalaji, H.M.; Yordanov, I.; Krasteva, V.; Alexandrov, V.; Stefanov, D.; Allakhverdiev, S.I. Drought-induced modifications of photosynthetic electron transport in intact leaves: Analysis and use of neural networks as a tool for a rapid non-invasive estimation. Biochim. Biophys. Acta BBA Bioenerg. 2012, 1817, 1490–1498. [Google Scholar] [CrossRef] [Green Version]
- Brestic, M.; Zivcak, M. PSII Fluorescence Techniques for Measurement of Drought and High Temperature Stress Signal in Crop Plants: Protocols and Applications. In Molecular Stress Physiology of Plants; Rout, G.R., Das, A.B., Eds.; Springer: Cham, Germany, 2013; pp. 87–131. [Google Scholar] [CrossRef]
- Kalaji, H.M.; Jajoo, A.; Oukarroum, A.; Brestic, M.; Zivcak, M.; Samborska, I.A.; Cetner, M.D.; Łukasik, I.; Goltsev, V.N.; Ladle, R.J. Chlorophyll a fluorescence as a tool to monitor physiological status of plants under abiotic stress conditions. Acta Physiol. Plant. 2016, 38, 102. [Google Scholar] [CrossRef] [Green Version]
- Trawczyński, C. Wpływ dolistnego nawożenia preparatem Herbagreen na plonowanie ziemniaków/The effect of foliar fertilization with Herbagreen on potato yielding. Ziemn. Polski 2013, 2, 29–33. (In Polish) [Google Scholar]
- Kumar, S.; Soukup, M.; Elbaum, R. Silicification in grasses: Variation between different cell types. Front. Plant Sci. 2017, 8, 438. [Google Scholar] [CrossRef] [Green Version]
- Souri, Z.; Khanna, K.; Karimi, N.; Ahmad, P. Silicon and plants: Current knowledge and future prospects. J. Plant Growth Reg. 2021, 40, 906–925. [Google Scholar] [CrossRef]
- Ibrahim, W.; Ahmed, I.M.; Chen, X.; Cao, F.; Zhu, S.; Wu, F. Genotypic differences in photosynthetic performance, antioxidant capacity, ultrastructure and nutrients in response to combined stress of salinity and Cd in cotton. BioMetals 2015, 28, 1063–1078. [Google Scholar] [CrossRef]
- Xia, J.; Li, Y.; Zou, D. Effects of salinity stress on PSII in Ulva lactuca as probed by chlorophyll fluorescence measurements. Aquat. Bot. 2004, 80, 129–137. [Google Scholar] [CrossRef]
- Choi, C.S.; Sano, H. Abiotic-stress induces demethylation and transcriptional activation of a gene encoding a glycerophosphodiesterase-like protein in tobacco plants. Mol. Genet. Genom. 2007, 277, 589–600. [Google Scholar] [CrossRef] [PubMed]
- Finnegan, E.J.; Peacock, W.J.; Dennis, E.S. Reduced DNA methylation in Arabidopsis thaliana results in abnormal plant development. Proc. Natl. Acad. Sci. USA 1996, 93, 8449–8454. [Google Scholar] [CrossRef] [Green Version]
- Mirouze, M.; Paszkowski, J. Epigenetic contribution to stress adaptation in plants. Curr. Opin. Plant Biol. 2011, 14, 267–274. [Google Scholar] [CrossRef] [PubMed]
- Sun, C.; Ali, K.; Yan, K.; Fiaz, S.; Dormatey, R.; Bi, Z.; Bai, J. Exploration of epigenetics for improvement of drought and other stress resistance in crops: A review. Plants 2021, 10, 1226. [Google Scholar] [CrossRef]
- Doyle, J.J.; Doyle, J.L. Isolation of plant DNA from fresh tissue. Focus 1990, 12, 13–15. [Google Scholar]
- Bassam, B.J.; Gresshoff, P.M. Silver staining DNA in polyacrylamide gels. Nat. Protoc. 2007, 2, 2649–2654. [Google Scholar] [CrossRef]
- Walder, R.Y.; Langtimm, C.J.; Chaterjee, R.; Walder, J.A. Cloning of the MspI modification enzyme. The site of modification and its effect on cleavage by MspI and HpaII. J. Biol. Chem. 1983, 258, 1235–1241. [Google Scholar] [CrossRef]
- Xiangqian, L.; Mingliang, X.; Schuyler, S.K. DNA methylation profiles differ between field- and in vitro-grown leaves of apple. J. Plant Physiol. 2002, 159, 1229–1234. [Google Scholar] [CrossRef]
Analyzed Values | Control | NaCl | NaCl + 0.05% Si | NaCl + 0.1% Si | NaCl+ 0.2% Si |
---|---|---|---|---|---|
Total bands number | 858 | 878 | 895 | 952 | 938 |
Number of symmetric methylation bands | 159 | 114 | 137 | 80 | 85 |
Symmetric methylation (%) | 19% | 13% | 15% | 8% | 9% |
Number of hemimethylation bands | 89 | 90 | 78 | 78 | 91 |
Hemimethylation bands (%) | 10% | 10% | 9% | 8% | 10% |
% total methylation | 29% | 23% | 24% | 17% | 19% |
MSAP Stage | Primers/Adapters | Sequences |
---|---|---|
Ligation | EcoRI-Adapter | 5′CTCGTAGACTGCGTACC 3′ 3′CATCTGACGCATGGTTAA 5′ |
MspI-HpaII-Adapter | 5‘CGACTCAGGACTCAT 3′ 3′TGAGTCCTGAGTAGCAG 5′ | |
Preamplification | Pre-EcoRI | 5′GACTGCGTACCAATTC 3′ |
Pre-MspI-HpaII | 5′GATGAGTCCTGAGTCGG 3′ |
No. | Primer Name | Sequences |
---|---|---|
0 | EcoRI-ACT | 5′GACTGCGTACCAATTCACT 3′ |
1 | EcoRI-AG | 5′GACTGCGTACCAATTCAG 3′ |
2 | EcoRI-AC | 5′GACTGCGTACCAATTCAC 3′ |
3 | EcoRI-AT | 5′GACTGCGTACCAATTCAT 3′ |
4 | MspI/HpaII-ATG | 5′GATGAGTCCTGAGTCGGATG 3′ |
5 | MspI/HpaII-CTA | 5′GATGAGTCCTGAGTCGGCTA 3′ |
6 | MspI/HpaII-CTC | 5′GATGAGTCCTGAGTCGGCTC 3′ |
7 | MspI/HpaII-CAT | 5′GATGAGTCCTGAGTCGGCAT 3′ |
8 | MspI/HpaII-CT | 5′GATGAGTCCTGAGTCGGCT 3′ |
9 | MspI/HpaII-GT | 5′GATGAGTCCTGAGTCGGGT 3′ |
10 | MspI/HpaII-CA | 5′GATGAGTCCTGAGTCGGCA 3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Stadnik, B.; Tobiasz-Salach, R.; Mazurek, M. Physiological and Epigenetic Reaction of Barley (Hordeum vulgare L.) to the Foliar Application of Silicon under Soil Salinity Conditions. Int. J. Mol. Sci. 2022, 23, 1149. https://doi.org/10.3390/ijms23031149
Stadnik B, Tobiasz-Salach R, Mazurek M. Physiological and Epigenetic Reaction of Barley (Hordeum vulgare L.) to the Foliar Application of Silicon under Soil Salinity Conditions. International Journal of Molecular Sciences. 2022; 23(3):1149. https://doi.org/10.3390/ijms23031149
Chicago/Turabian StyleStadnik, Barbara, Renata Tobiasz-Salach, and Marzena Mazurek. 2022. "Physiological and Epigenetic Reaction of Barley (Hordeum vulgare L.) to the Foliar Application of Silicon under Soil Salinity Conditions" International Journal of Molecular Sciences 23, no. 3: 1149. https://doi.org/10.3390/ijms23031149