The Promoter of the Immune-Modulating Gene TIR-Containing Protein C of the Uropathogenic Escherichia coli Strain CFT073 Reacts to the Pathogen’s Environment
Abstract
:1. Introduction
2. Results
2.1. THP-1 Cell-Associated CFT073 Activate P2 Most Efficiently
2.2. Potassium and Sodium Salts Induce the tcpC Promoter
2.3. Bacterial Density Induces the tcpC Promoter
2.4. Identification of P2 Promoter Regulatory Proteins
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains
4.2. Primers/Plasmids
4.3. Cell Lines
4.4. Culture Media and Reagents
4.5. Culture of Bacteria
4.6. Generation of Reporter CFT073 Strains
4.7. Promoter-Stimulation Assays
4.8. Analysis of the Promoter Activity by Flow Cytometry
4.9. DNA-Precipitation of P2 Binding Proteins
4.10. Mass Spectrometry: In-Gel Digestion of Samples
4.11. Mass Spectrometry: Analysis
4.12. Statistics
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mobley, H.L.; Green, D.M.; Trifillis, A.L.; Johnson, D.E.; Chippendale, G.R.; Lockatell, C.V.; Jones, B.D.; Warren, J.W. Pyelonephritogenic Escherichia coli and killing of cultured human renal proximal tubular epithelial cells: Role of hemolysin in some strains. Infect. Immun. 1990, 58, 1281–1289. [Google Scholar] [CrossRef] [Green Version]
- Welch, R.A.; Burland, V.; Plunkett, G., III; Redford, P.; Roesch, P.; Rasko, D.; Buckles, E.L.; Liou, S.R.; Boutin, A.; Hackett, J.; et al. Extensive mosaic structure revealed by the complete genome sequence of uropathogenic Escherichia coli. Proc. Natl. Acad. Sci. USA 2002, 99, 17020–17024. [Google Scholar] [CrossRef] [Green Version]
- Cirl, C.; Miethke, T. Microbial Toll/interleukin 1 receptor proteins: A new class of virulence factors. Int. J. Med. Microbiol. 2010, 300, 396–401. [Google Scholar] [CrossRef]
- Waldhuber, A.; Puthia, M.; Wieser, A.; Cirl, C.; Durr, S.; Neumann-Pfeifer, S.; Albrecht, S.; Rommler, F.; Muller, T.; Zheng, Y.; et al. Uropathogenic Escherichia coli strain CFT073 disrupts NLRP3 inflammasome activation. J. Clin. Investig. 2016, 126, 2425–2436. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cirl, C.; Wieser, A.; Yadav, M.; Duerr, S.; Schubert, S.; Fischer, H.; Stappert, D.; Wantia, N.; Rodriguez, N.; Wagner, H.; et al. Subversion of Toll-like receptor signaling by a unique family of bacterial Toll/interleukin-1 receptor domain-containing proteins. Nat. Med. 2008, 14, 399–406. [Google Scholar] [CrossRef] [PubMed]
- Fang, J.Q.; Ou, Q.; Pan, J.; Fang, J.; Zhang, D.Y.; Qiu, M.Q.; Li, Y.Q.; Wang, X.H.; Yang, X.Y.; Chi, Z.; et al. TcpC inhibits toll-like receptor signaling pathway by serving as an E3 ubiquitin ligase that promotes degradation of myeloid differentiation factor 88. PLoS Pathog. 2021, 17, e1009481. [Google Scholar] [CrossRef] [PubMed]
- Waldhuber, A.; Snyder, G.A.; Rommler, F.; Cirl, C.; Muller, T.; Xiao, T.S.; Svanborg, C.; Miethke, T. A Comparative Analysis of the Mechanism of Toll-Like Receptor-Disruption by TIR-Containing Protein C from Uropathogenic Escherichia coli. Pathogens 2016, 5, 25. [Google Scholar] [CrossRef] [Green Version]
- Newman, R.M.; Salunkhe, P.; Godzik, A.; Reed, J.C. Identification and characterization of a novel bacterial virulence factor that shares homology with mammalian Toll/interleukin-1 receptor family proteins. Infect. Immun. 2006, 74, 594–601. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Salcedo, S.P.; Marchesini, M.I.; Lelouard, H.; Fugier, E.; Jolly, G.; Balor, S.; Muller, A.; Lapaque, N.; Demaria, O.; Alexopoulou, L.; et al. Brucella Control of Dendritic Cell Maturation Is Dependent on the TIR-Containing Protein Btp1. PLoS Pathog. 2008, 4, e21. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yadav, M.; Zhang, J.; Fischer, H.; Huang, W.; Lutay, N.; Cirl, C.; Lum, J.; Miethke, T.; Svanborg, C. Inhibition of TIR domain signaling by TcpC: MyD88-dependent and independent effects on Escherichia coli virulence. PLoS Pathog. 2010, 6, e1001120. [Google Scholar] [CrossRef]
- Schubert, S.; Norenberg, D.; Clermont, O.; Magistro, G.; Wieser, A.; Romann, E.; Hoffmann, C.; Weinert, K.; Denamur, E. Prevalence and phylogenetic history of the TcpC virulence determinant in Escherichia coli. Int. J. Med. Microbiol. 2010, 300, 429–434. [Google Scholar] [CrossRef] [PubMed]
- Ittensohn, J.; Hemberger, J.; Griffiths, H.; Keller, M.; Albrecht, S.; Miethke, T. Regulation of Expression of the TIR-Containing Protein C Gene of the Uropathogenic Escherichia coli Strain CFT073. Pathogens 2021, 10, 549. [Google Scholar] [CrossRef]
- Berry, M.R.; Mathews, R.J.; Ferdinand, J.R.; Jing, C.; Loudon, K.W.; Wlodek, E.; Dennison, T.W.; Kuper, C.; Neuhofer, W.; Clatworthy, M.R. Renal Sodium Gradient Orchestrates a Dynamic Antibacterial Defense Zone. Cell 2017, 170, 860–874.e819. [Google Scholar] [CrossRef]
- Groisman, E.A. The pleiotropic two-component regulatory system PhoP-PhoQ. J. Bacteriol. 2001, 183, 1835–1842. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Groisman, E.A.; Mouslim, C. Sensing by bacterial regulatory systems in host and non-host environments. Nat. Rev. Microbiol. 2006, 4, 705–709. [Google Scholar] [CrossRef]
- Gunn, J.S. The Salmonella PmrAB regulon: Lipopolysaccharide modifications, antimicrobial peptide resistance and more. Trends Microbiol. 2008, 16, 284–290. [Google Scholar] [CrossRef] [PubMed]
- Moon, K.; Gottesman, S. A PhoQ/P-regulated small RNA regulates sensitivity of Escherichia coli to antimicrobial peptides. Mol. Microbiol. 2009, 74, 1314–1330. [Google Scholar] [CrossRef] [Green Version]
- Xie, M.; Wu, M.; Han, A. Structural insights into the signal transduction mechanism of the K+-sensing two-component system KdpDE. Sci. Signal. 2020, 13, eaaz2970. [Google Scholar] [CrossRef]
- Epstein, W. The KdpD Sensor Kinase of Escherichia coli Responds to Several Distinct Signals to Turn on Expression of the Kdp Transport System. J. Bacteriol. 2016, 198, 212–220. [Google Scholar] [CrossRef] [Green Version]
- Wagenlehner, F.M.E.; Bjerklund Johansen, T.E.; Cai, T.; Koves, B.; Kranz, J.; Pilatz, A.; Tandogdu, Z. Epidemiology, definition and treatment of complicated urinary tract infections. Nat. Rev. Urol. 2020, 17, 586–600. [Google Scholar] [CrossRef]
- Hamilton, C.; Tan, L.; Miethke, T.; Anand, P.K. Immunity to uropathogens: The emerging roles of inflammasomes. Nat. Rev. Urol. 2017, 14, 284–295. [Google Scholar] [CrossRef] [PubMed]
- Klein, R.D.; Hultgren, S.J. Urinary tract infections: Microbial pathogenesis, host-pathogen interactions and new treatment strategies. Nat. Rev. Microbiol. 2020, 18, 211–226. [Google Scholar] [CrossRef]
- Fischer, H.; Yamamoto, M.; Akira, S.; Beutler, B.; Svanborg, C. Mechanism of pathogen-specific TLR4 activation in the mucosa: Fimbriae, recognition receptors and adaptor protein selection. Eur. J. Immunol. 2006, 36, 267–277. [Google Scholar] [CrossRef] [PubMed]
- Frendeus, B.; Wachtler, C.; Hedlund, M.; Fischer, H.; Samuelsson, P.; Svensson, M.; Svanborg, C. Escherichia coli P fimbriae utilize the Toll-like receptor 4 pathway for cell activation. Mol. Microbiol. 2001, 40, 37–51. [Google Scholar] [CrossRef] [PubMed]
- Von Vietinghoff, S.; Kurts, C. Regulation and function of CX3CR1 and its ligand CX3CL1 in kidney disease. Cell Tissue Res. 2021, 385, 335–344. [Google Scholar] [CrossRef]
- Elms, J.J. Potassium imbalance: Causes and prevention. Postgrad. Med. 1982, 72, 165–171. [Google Scholar] [CrossRef] [PubMed]
- Giebisch, G.; Wang, W. Potassium transport: From clearance to channels and pumps. Kidney Int. 1996, 49, 1624–1631. [Google Scholar] [CrossRef] [Green Version]
- Epstein, W. The roles and regulation of potassium in bacteria. Prog. Nucleic Acid. Res. Mol. Biol. 2003, 75, 293–320. [Google Scholar]
- Palmer, L.G.; Schnermann, J. Integrated control of Na transport along the nephron. Clin. J. Am. Soc. Nephrol. 2015, 10, 676–687. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gottschalk, C.W.; Mylle, M. Micropuncture study of the mammalian urinary concentrating mechanism: Evidence for the countercurrent hypothesis. Am. J. Physiol. 1959, 196, 927–936. [Google Scholar] [CrossRef]
- Jobin, K.; Muller, D.N.; Jantsch, J.; Kurts, C. Sodium and its manifold impact on our immune system. Trends Immunol. 2021, 42, 469–479. [Google Scholar] [CrossRef] [PubMed]
- Jobin, K.; Stumpf, N.E.; Schwab, S.; Eichler, M.; Neubert, P.; Rauh, M.; Adamowski, M.; Babyak, O.; Hinze, D.; Sivalingam, S.; et al. A high-salt diet compromises antibacterial neutrophil responses through hormonal perturbation. Sci. Transl. Med. 2020, 12, eaay3850. [Google Scholar] [CrossRef] [PubMed]
- Reitzer, L.; Zimmern, P. Rapid Growth and Metabolism of Uropathogenic Escherichia coli in Relation to Urine Composition. Clin. Microbiol. Rev. 2019, 33, e00101-19. [Google Scholar] [CrossRef] [PubMed]
- Antunes, L.C.M.; Ferreira, R.B.R.; Buckner, M.M.C.; Finlay, B.B. Quorum sensing in bacterial virulence. Microbiology (Reading) 2010, 156, 2271–2282. [Google Scholar] [CrossRef] [Green Version]
- Surette, M.G.; Miller, M.B.; Bassler, B.L. Quorum sensing in Escherichia coli, Salmonella typhimurium, and Vibrio harveyi: A new family of genes responsible for autoinducer production. Proc. Natl. Acad. Sci. USA 1999, 96, 1639–1644. [Google Scholar] [CrossRef] [Green Version]
- Sperandio, V.; Mellies, J.L.; Nguyen, W.; Shin, S.; Kaper, J.B. Quorum sensing controls expression of the type III secretion gene transcription and protein secretion in enterohemorrhagic and enteropathogenic Escherichia coli. Proc. Natl. Acad. Sci. USA 1999, 96, 15196–15201. [Google Scholar] [CrossRef] [Green Version]
- Dorman, C.J. H-NS: A universal regulator for a dynamic genome. Nat. Rev. Microbiol. 2004, 2, 391–400. [Google Scholar] [CrossRef]
- Rafiei, N.; Cordova, M.; Navarre, W.W.; Milstein, J.N. Growth Phase-Dependent Chromosome Condensation and Heat-Stable Nucleoid-Structuring Protein Redistribution in Escherichia coli under Osmotic Stress. J. Bacteriol. 2019, 201, e00469-19. [Google Scholar] [CrossRef]
- Yamada, H.; Yoshida, T.; Tanaka, K.; Sasakawa, C.; Mizuno, T. Molecular analysis of the Escherichia coli hns gene encoding a DNA-binding protein, which preferentially recognizes curved DNA sequences. Mol. Gen. Genet. 1991, 230, 332–336. [Google Scholar] [CrossRef]
- Yamada, H.; Muramatsu, S.; Mizuno, T. An Escherichia coli protein that preferentially binds to sharply curved DNA. J. Biochem. 1990, 108, 420–425. [Google Scholar] [CrossRef]
- Datsenko, K.A.; Wanner, B.L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 2000, 97, 6640–6645. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Protein Name | Uniprot Entry | Score (−10 lgP) | Coverage (%) | Peptides | Unique Peptides | Avg. Mass |
---|---|---|---|---|---|---|
DNA-binding protein StpA | A0A0H2VCA0 | 211.11 138.62 | 40 24 | 5 2 | 5 2 | 15,360 15,360 |
Cytosol aminopep-tidase | P68766 | 199.08 121.75 | 16 8 | 7 3 | 7 3 | 54,880 54,880 |
DNA-binding protein H-NS | P0ACF9 | 177.18 117.92 | 31 22 | 6 2 | 6 2 | 15,540 15,540 |
5-methyl-tetrahydropteroyltriglutamate-homocysteine methyltransferase | Q8FBM1 | 156.12 43.01 | 7 3 | 5 2 | 5 2 | 84,691 84,691 |
R4-like protein | Q8VR68 | 139.22 104.41 | 18 6 | 6 2 | 5 2 | 42,719 42,719 |
Uncharacterized protein | A0A0H2V7N7 | 139.20 75.95 | 12 7 | 3 2 | 3 2 | 34,655 34,655 |
Putative transcriptional regulator (c4494) | A0A0H2VDP8 | 128.29 118.72 59.19 | 10 10 3 | 5 3 1 | 5 3 1 | 41,118 41,118 41,118 |
Succinate-CoA ligase (ADP-forming) subunit beta | P0A837 | 115.18 68.76 | 8 4 | 2 1 | 2 1 | 41,393 41,393 |
50S ribosomal protein L9 | P0A7R2 | 109.27 44.09 | 25 15 | 3 2 | 3 2 | 15,769 15,769 |
Phospho-enolpyru-vate-protein phospho-transferase | A0A0H2VBQ5 | 84.47 69.18 | 3 2 | 1 1 | 1 1 | 55,207 55,207 |
IucD protein | A0A0H2VC61 | 77.64 34.30 | 7 3 | 2 1 | 2 1 | 50,897 50,897 |
30S ribosomal protein S10 | P0A7R6 | 74.76 39.49 | 15 15 | 1 1 | 1 1 | 11,736 11,736 |
Branched-chain-amino-acid aminotransferase | P0AB81 | 69.80 60.31 | 7 7 | 2 2 | 2 2 | 34,094 34,094 |
Uncharacterized protein YheO | P64625 | 68.62 28.10 | 5 5 | 1 1 | 1 1 | 26,821 26,821 |
Transcriptional regulator MraZ | P65434 | 67.52 20.53 | 11 5 | 2 1 | 2 1 | 17,360 17,360 |
HTH-type transcriptional repressor CytR | P0ACN8 | 54.26 53.16 | 3 5 | 1 2 | 1 2 | 37,820 37,820 |
50S ribosomal protein L7/L12 | P0A7K3 | 28.78 26.44 | 10 10 | 1 1 | 1 1 | 12,295 12,295 |
Strains | Deleted Gene | Locus Tag | Function |
---|---|---|---|
CFT073 | none | ||
CFT073 tcpC::gfpmut2 | tcpC | c2398 | Chromosomal tcpC reporter |
CFT073 ΔkdpD | kdpD | c0780 | Sensor protein KdpD, component of the potassium-sensing, two-component system KdpD/E |
CFT073 ΔphoQ | phoQ | c1508 | Sensor protein PhoQ, component of the macrophage-sensing, two-component system PhoQ/P |
CFT073 Δhns | hns | c1701 | DNA-binding protein H-NS |
CFT073 ΔpepA | pepA | c5360 | Cytosol aminopeptidase |
CFT073 Δc4494 | c4494 | c4494 | Putative transcriptional regulator |
Designation | Sequence |
---|---|
phoQ a | 5′-catttaaccggaaaaaag-3′ |
phoQ b | 5′-GCAGCTCCAGCCTACACttatcactacatcaaggc-3′ |
phoQ iR | aacgttacgacaaatatc |
phoQ c | 5′-GGAGGATATTCATATGtcagcgcaattcgaacag-3′ |
phoQ d | 5′-gacgaagtgatcaaactg-3′ |
kdpD eF | gataatcatccgctccgg |
kdpD GP1 | CGCAGAAAGCGACGAATAGCCTGTTCATCTTC-AACAATCAGAACGTTTGTCACgtgtaggctggagctgc |
kdpD iF | ccagcgttaaccactctt |
kdpD iR | aagagtggttaacgctgg |
kdpD GP2 | GCCGGTCGTCAACATTGTCGAACTCAATCTG-GCACTGGATAAGCTTcatatgaatatcctccttagttcc |
kdpD eR | taaacagatagccgcacg |
hns a | 5′-attatctccccataaaatg-3′ |
hns b | 5′-GCAGCTCCAGCCTACACatctcaaacttatattggg-3′ |
hns c | 5′-GGAGGATATTCATATGtcttttgtagattgcac-3′ |
hns d | 5′-actgcggtaataaattag-3′ |
pepA eF | cccgcaccagatatcttatg |
pepA a | 5′-cgtaaaaactcgtcttttgc-3′ |
pepA b | 5′-GCAGCTCCAGCCTACACgctcctgaatcttaaagac-3′ |
pepA c | 5′-GGAGGATATTCATATGtcaggctgtgttgttattg-3′ |
pepA d | 5′-catatatggggcttcttgtg-3′ |
pepA eR | gtccagaaggtagaacgttg |
c4494 a | 5′-ggtgtttgctgacagctata-3′ |
c4494 b | 5′-GCAGCTCCAGCCTACACttctcatgggatggaatagc-3′ |
c4494 c | 5′-GGAGGATATTCATATGaagggaaaataagcgtaatgttc-3′ |
c4494 d | 5′-gccaggggttatcttctg-3′ |
kan iF | gaggctattcggctatgactg |
kan iR | cagtcatagccgaatagcctc |
GSP1 | 5′-tgagcatggggattcttact-3′ |
GSP2 | 5′-ccaagtcatgaaatgcgata-3′ |
GSP3 | 5′-tgcccgtacacgtattacag-3′ |
AAP (Abriched Anchor Primer) | 5′-ggccacgcgtcgactagtacgggiigggiigggiig-3‘ |
AUAP (Abriched universal Amplification Primer) | 5′-ggccacgcgtcgactagtac-3′ |
tcpC 5′UTR_Biotin_fw | 5′-[Btn]gcaggagtctatggtaacg-3′ |
tcpC 5′UTR_rev | 5′-catatgctatcacattttgag-3′ |
lacZ 5′UTR_Biotin_fw | 5′-[Btn]agaaaaaccacccttccg-3′ |
lacZ 5’UTR_rev | 5′-catagtcatagctgtatcctgtg-3′ |
Bacterial Host | Construct | Plasmid Back-Bone | Resistance | Plasmid Name | Function |
---|---|---|---|---|---|
CFT073 | Pc2397:gfpmut2 | pUA66 | kan † | pPc2397:gfpmut2:KAN | P1 reporter |
CFT073 | Pc2398:gfpmut2 | pUA66 | kan | pPc2398:gfpmut2:KAN | P2 reporter |
CFT073 | Pc2397-Pc2398:gfpmut2 | pUA66 | kan | p(Pc2397-Pc2398):gfpmut2:KAN | P1+P2 reporter |
CFT073 | kan, amp ‡ | pKD4 | Carries the kanamycin cassette flanked by FRT-sequences | ||
CFT073 | amp | pKD46 | Carries the arabinose-inducible λ-red-system | ||
CFT073 | cm ¶, amp | pCP20 | Carries the FLP-recombinase |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hemberger, J.; Ittensohn, J.; Griffiths, H.; Keller, M.; Costina, V.; Albrecht, S.; Miethke, T. The Promoter of the Immune-Modulating Gene TIR-Containing Protein C of the Uropathogenic Escherichia coli Strain CFT073 Reacts to the Pathogen’s Environment. Int. J. Mol. Sci. 2022, 23, 1148. https://doi.org/10.3390/ijms23031148
Hemberger J, Ittensohn J, Griffiths H, Keller M, Costina V, Albrecht S, Miethke T. The Promoter of the Immune-Modulating Gene TIR-Containing Protein C of the Uropathogenic Escherichia coli Strain CFT073 Reacts to the Pathogen’s Environment. International Journal of Molecular Sciences. 2022; 23(3):1148. https://doi.org/10.3390/ijms23031148
Chicago/Turabian StyleHemberger, Jacqueline, Julia Ittensohn, Hannah Griffiths, Maren Keller, Victor Costina, Simone Albrecht, and Thomas Miethke. 2022. "The Promoter of the Immune-Modulating Gene TIR-Containing Protein C of the Uropathogenic Escherichia coli Strain CFT073 Reacts to the Pathogen’s Environment" International Journal of Molecular Sciences 23, no. 3: 1148. https://doi.org/10.3390/ijms23031148