Next Article in Journal
Effects of Plant-Growth-Promoting Rhizobacteria on Soil Bacterial Community, Soil Physicochemical Properties, and Soil Enzyme Activities in the Rhizosphere of Alfalfa under Field Conditions
Previous Article in Journal
Learn the Past and Present to Teach the Future—Role of Active Surveillance of Exposure to Endemic and Emerging Viruses in the Approach of European Bison Health Protection
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Diversity
Volume 15
Issue 4
10.3390/d15040536
diversity-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Stenomitos nagquensis sp. nov. (Leptolyngbyaceae, Cyanobacteria) from a Meadow Wetland in the Tibet Plateau: A Novel Species Studied Based on a Polyphasic Approach

by
Melissa H. Pecundo
1,2,3,
Tao Chen
3,
Yunhua Wang
3,
Xuemei Wen
4,
Zhangli Hu
1,2,5,
Huirong Chen
1,* and
Nan Li
3,*
1
Shenzhen Engineering Laboratory of Marine Algal Biotechnology, Guangdong Provincial Key Laboratory of Plant Epigenetics, Longhua Innovation Institute for Biotechnology, College of Life Sciences and Oceanography, Shenzhen University, Shenzhen 518060, China
2
College of Physics and Optoelectronic Engineering, Shenzhen University, Shenzhen 518060, China
3
Fairy Lake Botanical Garden, Chinese Academy of Sciences, Shenzhen 518004, China
4
Tibet Plateau Institute of Biology, Lhasa 850001, China
5
Southern Marine Science and Engineering Guangdong Laboratory (Guangzhou), Guangzhou 511458, China
*
Authors to whom correspondence should be addressed.
Diversity 2023, 15(4), 536; https://doi.org/10.3390/d15040536
Submission received: 13 February 2023 / Revised: 1 April 2023 / Accepted: 4 April 2023 / Published: 7 April 2023
Browse Figures
Versions Notes

Abstract

:
A novel cyanobacterial strain (CSML-F035) here described as Stenomitos nagquensis sp. nov. was isolated from a plateau meadow wetland habitat in the Tibet Autonomous Region. The novel strain was studied based on a polyphasic approach by combining characteristics of cell morphology and evidence from molecular data and ecology. Phylogenetic analyses based on the 16S rRNA and rbcL genes indicated that the novel strain is a member of the genus Stenomitos (Leptolyngbyaceae) but is positioned in a unique clade, with strongly supported values from BI, ML, and NJ methods. The percentage similarity of the 16S rRNA gene sequence of CSML-F035 compared with known strains of Stenomitos was >97%. Morphologically, S. nagquensis sp. nov. possesses overlapping morphological characteristics with other Stenomitos species, with thin trichomes enclosed in a firm, colorless, hyaline, persistent mucilage. However, the strain appeared to have slightly smaller cells compared to most known species of Stenomitos. Further analyses of the 16S–23S ITS region showed dissimilarity at 11.2–22.8% compared to known species of Stenomitos. The secondary helices—including D1–D1, V2, Box–B, and V3—that were predicted based on the 16S–23S ITS region for Stenomitos nagquensis sp. nov. were also distinct, thereby providing strong additional support for the separation of this species. This study highlights the importance of unexplored habitats in the Tibet region in which cyanobacterial diversity can be deemed high, with many potential new species that remain poorly explored.

1. Introduction

Cyanobacteria, also known as Cyanoprokaryota, are diverse and among the most important phyla of photosynthetic prokaryotes, the characterization and identification of which originally relied on traditional morphology [1,2,3]. However, many genera in this group are phenotypically plastic, with small or almost no differences in morphological characteristics. Under these circumstances, identification of cyanobacteria (at both the species and generic levels) by morphology alone is difficult and problematic. The use of modern tools based on molecular data has clarified the taxonomy of cyanobacteria, particularly those lacking clear morphological distinctness [4,5,6]. Sequences of the 16S rRNA gene have become the gold standard and greatly improved the classification and systematics of cyanobacteria [7,8]. Additionally, modern polyphasic tools that combine morphology, ecophysiology, biochemistry, and genetics have led to the establishment of several new orders and families and a relatively large number of new genera and species of cyanobacteria [1,9,10,11,12,13].
In the comprehensive review of Komárek et al. [9], 8 orders, 46 families, and 202 genera of cyanobacterial were described based on phylogenomic analyses. While many taxa have undergone taxonomic revision, several genera have remained unrevised and polyphyletic—particularly those in the Synechococcales [9]. In 2018, Mai et al. [11] made a considerable taxonomic revision of the Synechococcales, with recognition of four families, including two new ones: Oculatellaceae and Trichocoleaceae. Despite the revision, a number of polyphyletic genera still exist in this group, suggesting that further revision is needed. Strunecký et al. [14] extensively evaluated the classification of cyanobacteria at the order and family levels on the basis of phylogenomic and polyphasic analyses, resolving the taxonomy of many families. They [14] also separated several new orders—including Nodosilineales, Oculatellales, and Leptolyngbyales—from the polyphyletic Synechococcales. Leptolyngbyales contains three families—Leptolyngbyaceae (with 21 genera), Trichocoleaceae (with 5 genera), and Neosynechococcaceae (with only 1 genus)—as a product of extensive analysis by polyphasic criteria [14]. Leptolyngbya, belonging to Leptolyngbyaceae, is the largest and most species-rich, but with many taxa that are polyphyletic in origin [9,11,15,16,17]. Using a polyphasic approach, studies have separated and/or split out several strains with Leptolyngbya-like morphotypes as new genera, including Nodosilinea [18], Haloleptolyngbya [19], Pantanalinema, Alkalinema [20], Kovacikia, Oculatella, Stenomitos [21], Chamaethrix [22], Chroakolemma [23], Albertania [24], Euryhalinema, and Leptoelongatus [25]. Some genera were assigned to different families. For instance, Prochlorothrix, Trichocoleus, Halomicronema, Haloleptolyngbya, Oculatella, Nodosilinea, Thermoleptolyngbya, Pinocchia, Elainella, Euryhalinema, Leptoelongatus, and Timaviella—previously assigned to Leptolyngbyaceae [11,25,26]—were treated at the family level [14]. Therefore, for the Leptolyngbyaceae sensu stricto, the 21 monophyletic genera are Alkalinema, Arthronema, Chamaethrix, Chroakolemma, Heteroleibleinia, Jaaginema, Kovacikia, Leptodesmis, Leptolyngbya, Limnolyngbya, Myxacorys, Onodrimia, Pantanalinema, Phormidesmis, Planktolyngbya, Plectolyngbya, Pseudophormidium, Scytolyngbya, Sokolovia, Stenomitos, and Tapinothrix [14]. To achieve better resolution of cyanobacterial taxonomy, new cyanobacteria should be analyzed using modern polyphasic approaches and should be clearly unique phylogenetically, distinct morphologically, and related biochemically and ecologically.
Cyanobacteria/Cyanoprokaryota are ecologically diverse and are distributed over a wide range of habitats, including extreme environments. In China, a number of new genera and species from both coccoid and filamentous groups—including Scytolyngbya [27], Neochroococcus [28], Microcoleusiopsis [29], and Microseira minor [30]—have been reported. The Tibet Autonomous Region (TAR)—a province in southwesternmost China—has a unique topography and geography of varying elevations in which biological diversity—particularly of cyanobacteria—is expected but understudied. One paper reported novel picocyanobacteria from the lakes in eastern Tibet [31]. A new genus in the Nostocalean group that forms distinct purple or black colonies was isolated from wet soil samples in Tibet and named Purpureonostoc [32,33].
Here, for the first time, we describe another free-living cyanobacterial strain isolated from a freshwater wetland meadow at 4922 m above sea level in the Tibet Autonomous Region. Our isolate showed clear morphology that placed it in the Leptolyngbyaceae. Based on evidence from morphology, ecology, and a phylogenetic analysis of the 16S rRNA gene, as well as from other informative molecular markers such as the rbcL gene and the 16S–23S ITS region, we propose it as a novel species.

2. Materials and Methods

2.1. Sampling Site

Samples were collected in August 2020 in Shiqi Village, Maidika Township, Jiali County, Nagqu Prefecture, Tibet Autonomous Region, 31°05′32.69 N, 93°02′48.41 E, 4922 m above sea level. The samples were taken from a meadow that is covered with fresh water in the summer but completely dry or covered by snow in the winter (Figure 1). Samples with a small amount of water were collected and put in clean Ziploc plastic bags, placed in an ice chest, and transported to the laboratory for isolation.

2.2. Culturing and Morphological Description

The samples were first washed with sterile distilled water and cut into small pieces. Isolation was carried out by putting the samples in a nitrogen-reduced BG11 broth with the antifungal cycloheximide [34] to prevent fungal contamination, after which they were maintained in a growth chamber with a 14 h:10 h light/dark cycle. The chamber was equipped with white fluorescent lamps set to a photon flux density of 40 μmol m−2 s−1 and a temperature of 26 °C ± 2 °C. The living strains reported in this paper are currently maintained at the Cycad Symbiotic Microorganism Laboratory (CSML) in the research building of Fairy Lake Botanical Garden, Shenzhen, China. The cyanobacterial strain described herein is designated CSML-F035. The filaments of strain CSML-F035 were observed under a Nikon Eclipse light microscope (Nikon NI-SS 936076, Japan) at a magnification of 100–1000 times. All micrographs presented were taken using a camera (Nikon Y-TV55, Tokyo 108–6920, Japan) attached to the light microscope. The width and length from at least 50 vegetative cells in 25 trichomes were measured and recorded. The appearance of the sheaths, presence of necridia, and apical cell morphologies were also noted and provided in the description. The morphological data from strain CSML-F035 were compared to data available for Stenomitos species. A freeze-dried, metabolically inactive specimen prepared from this material was deposited in the herbarium of Shenzhen Fairy Lake Botanical Garden (SZG) under accession number FLBG-CSML035.

2.3. DNA Extraction, PCR Amplification, and Gene Sequencing

Genomic DNA from strain CSML-F035 was isolated using a sodium dodecyl sulfate (SDS) extraction buffer containing 100 mM Tris HCl (pH 8.0), 50 mM EDTA, and 3% SDS. The DNA was obtained from a culture in the log phase of growth (ca. 14 days) that was harvested from a solid BG11 culture plate. The cells were first rinsed with sterile deionized water three times and then centrifuged for 1 min at 3000 rpm to expel excess water. Lysing of the cells was carried out by a freeze–thawing method (using liquid nitrogen and a water bath at 60 °C) and shaking on a tissue homogenizer with 60 mg glass beads (Tissuelyser 24, Jingxin Technology, Shanghai, China) twice, for 30 s each time [34]. The DNA was stored at −20 °C. The DNA samples were processed for PCR amplification of several molecular markers. First, the 16S rRNA gene with the 16S–23S ITS region was amplified using the primers 8F (5’–AGTTGATCCTGGCTCAG–3′) and BS23SR (5′–CTTCGCCTCTGTGTGCCTAGG–3´). In addition, the 16S rRNA gene and 16S–23S ITS region were also amplified separately using the primers 27F (5′–AGAGTTTGATCCTGGCTCAG–3′) and 1492R (5′–TACGGYTACCTTGTTAYGACTT–3′), and the primers 322F (5´–TGTACACACCGCCCGTC–3´) and 340R (5′–CTCTGTGTGCCTAGGTATCC–3′), respectively. The rbcL gene was additionally amplified, using the primers rbcLf (5′–GACTTCACCAAAGAYGACGAAAACAT–3′) and rbcLr (5′–GAACTCGAACTTRATYTCTTTCCA–3′). These primer regions were adapted from [13,34,35,36,37]. The PCR conditions used for the amplification of the primers mentioned above are provided in Supplementary Table S1 [13,34,35,36,37]. All PCR reactions were performed in 25 µL volumes containing equal volumes of purified water and PCR FastTaq Premix (TOLO Biotech Co., Ltd., Shanghai, China), 1 µL of each primer (0.01 mM concentration), and 1.5 µL of template DNA (20 ng µL−1). PCR amplification was performed on a T100TM Thermal Cycler (BIO-RAD, Singapore). The quality of the PCR products was visualized by horizontal electrophoresis on 1% agarose gel in 1× TAE stained with gel red and sent to TSINGKE Biotechnology Co., Ltd. (Guangdong, China) for sequencing on a 3730XL DNA Analyzer (Applied Biosystems).

2.4. Phylogenetic Analyses

The 16S rRNA gene phylogeny was constructed based on 16S rRNA gene sequences of 107 cyanobacterial taxa retrieved from the NCBI GenBank database. Four copies of 16S rRNA gene sequences were generated from our CSML-F035 strain, but only two sequences (1344 bp, 1359 bp) with consensus files were included in the 16S rRNA gene phylogeny, resulting in a total of 109 cyanobacteria in the 16S rRNA gene phylogeny. Pairwise alignment of these cyanobacterial sequences was performed using the default settings of MAFFT v.450 [38] on Geneious Prime 2023.0.1 [39], edited and proofread manually. The final alignment was ~1370 bp long. The phylogenetic tree was constructed using maximum-likelihood (ML), Bayesian inference (BI), and neighbor-joining (NJ) methods. For the alignment datasets, the model of nucleotide substitution that most appropriately fit under the Bayesian information criterion (BIC) using IQ-TREE v6.10 [40] and jModelTest 2.1.1 [41] on XSEDE on the CIPRES Science Gateway [42] was the TIM3e + R evolutionary model. The maximum-likelihood (ML) phylogeny was built in IQ-TREE v6.10, generating 1000 samples for ultrafast bootstrap and 1000 bootstrap replications [40] following the selected best model. GTR + I + G could also be used as an appropriate alternative model for those alignment datasets, with the TIM3e model as the chosen best model. Therefore, the phylogenetic trees analyzed by the BI and NJ methods were generated in Mr. Bayes v3.2.6 [43], applying the model GTR + I + G and MEGA version X with the Kimura-2 parameter model [44], respectively. The BI execution was composed of two runs with four Markov chain Monte Carlo (MCMC) models running for 10 million generations, until the average standard deviation of split frequencies between runs reached <0.01. The phylogenetic tree consensus files were viewed using FigTree v1.4.4 and rooted with the outgroup Gloeobacter violaceus VP3-01. A maximum-likelihood phylogenetic tree was also constructed based on the rbcL gene. The NCBI GenBank accession numbers for our sequences are OQ175012–OQ175015 for the 16S rRNA gene, OQ175019–OQ175020 for 16S–23S ITS, and OQ200111 for the rbcL gene.

2.5. Secondary Structure Analyses of the 16S–23S Internal Transcribed Spacer (ITS) Region

The 16S–23S ITS operons of the closest taxa to CSML-F035 strain were downloaded from the NCBI GenBank. The RNA structure v6.2 software [45] was used to predict the conserved domains of the 16S–23S ITS regions D1–D1′, V2, Box–B, and V3. We also compared the lengths of the domains in the 16S–23S ITS region, including D1–D1′, Spacer + D2, D3 + Spacer, tRNAisoleucine (tRNA–Ile), V2 + tRNAalanine (tRNA–Ala) Spacer + Box–B + Spacer, Box–A, D4 + Spacer, V3, and the D5 region among CSML-F035 and the other strains under investigation.

2.6. Calculation of p-Distance for the 16S rRNA Gene and 16S–23S ITS Region; Nomenclature

The distance matrix for the percentage similarity of the 16S rRNA gene sequences among strains of Stenomitos and CSML-F035 was determined after pairwise alignment and then viewed on the Distances panel (presented in %) in Geneious Prime. For the 16S–23S rRNA ITS region, similarity was estimated in MEGA v7.0.26 [44], where the p-distances were determined by calculating the sequence dissimilarity based on the formula (1 − p) × 100. Finally, the name for CSML-F035 was established and proposed as Stenomitos nagquensis according to the International Code of Nomenclature for Algae, Fungi, and Plants.

3. Results

3.1. Taxonomic Treatment

Order Leptolyngbyales
Family Leptolyngbyaceae
Stenomitos nagquensis M. Pecundo, X. Wen and T. Chen sp. nov. (Figure 2 and Figure 3):
Description: Colonies were thin, flat, and blue–green, slowly spreading on the surface of solid BG11 medium. Filaments were thin, occasionally coiled, and sometimes appearing loosely parallel or spirally arranged. Two overlapping trichomes in one firm sheath were rarely observed, with false or true branching absent. Trichomes were isopolar, untapered, and clearly constricted at the cross-walls. Mucilaginous sheaths were colorless, firm, hyaline, persistent, and widened in the younger stages, while they were thin in older colonies. Vegetative cells were bright blue–green in younger colonies, green in older stages, isodiametric to slightly longer than wide in younger cells, and wider than long when compressed, particularly in the older stages, reproducing through simple binary fission in a single plane. Polar granules were evident in some vegetative cells, mostly granulated in older stages. Vegetative cells were 0.4–2.2 µm long and 0.5–1.2 µm wide. Apical cells were rounded to slightly conical, rarely elongated, and similar in size with most vegetative cells. Hormogonia were motile and usually composed of 3–10 cells. Thylakoids were parietal. Necridia were present.
Etymology: “nagquensis” refers to the source locality—Nagqu Prefecture, where the cyanobacterial strain was collected and isolated.
Holotype: Metabolically inactive, freeze-dried from cultured material of strain CSML-F035 deposited in the herbarium of Shenzhen Fairy Lake Botanical Garden (SZG); available under accession no. FLBG-CSML 035.
Type locality: Isolated from a wet fresh water meadow in Jiali County, Nagqu, Tibet Autonomous Region, 93°2′48.41 E, 31°5′32.69 N, 4922 m above sea level; sample collected on 6 August 2020 by X. Wen.
Habitat/Source: Free-living in fresh water.
Reference strain: An actively growing culture of CSML-F035 is maintained at Cycad Symbiotic Microbiology Laboratory, Fairy Lake Botanical Garden, Shenzhen, China.
Reference sequences: The GenBank accession numbers for the holotypes 16S rRNA, 16S–23S ITS, and rbcL are OQ175012, OQ175019, and OQ200111, respectively.

3.2. 16S rRNA Gene Sequence Similarity and Phylogenetic Analyses

The four copies of 16S rRNA gene sequences from strain CSML-F035 showed similarity values of 99.4–100% (calculation not shown). The 16S rRNA gene sequence of strain CSML-F035 and the sequences from strains of Stenomitos retrieved from GenBank showed similarities that ranged from 97.2 to 99.3% (Supplementary Table S2, Figure 4), except against S. pantisii, where the sequence similarity was 90.8% (Supplementary Table S2, Figure 4). Specifically, our novel strain had the highest 16S rRNA gene sequence similarity to Stenomitos frigidus BEA 0966B and Stenomitos tremulus CPCC 471, at 99.3% and 99.2%, respectively (Supplementary Table S2, Figure 4). These two strains were isolated from a freshwater source in Las Palmas, Spain and a benthos pond on Bylot Island, Canada, respectively. Furthermore, the sequence similarity of CSML-F035 against other closely related taxa in Leptolyngbyaceae was <95%; in particular, it was 89.0–90.2% against the generitype Leptolyngbya, 95.5% to Neosynechococcus sphagnicola sy1 (Figure 4), 90.8% to Plectolyngbya, 93.9% to Scytolyngbya, 94.6% to Kovacikia muscicola HA7619–LM3, and 90.4% to Myxacorys (calculation not shown). Two sequences from the novel strain CSML-F035 joined the clade of the Stenomitos sensu stricto but positioned in a unique node with strong supporting values from the ML, BI, and NJ analyses. The 16S rRNA gene phylogeny also showed that Stenomitos sensu stricto is a sister group of the newly described taxon Neosynechococcus sphagnicola sy1 isolated from a peat bog in Slovakia (Figure 4). We observed the low support values in the external clades in all of the phylogenies, but the stable position of our novel strain in the Stenomitos was consistent, as inferred by different methods, and was not affected by the unstable placement of other groups in Leptolyngbyaceae. In particular, the placement of the novel strain together with its sister taxon Stenomitos frigidus BEA 0966B in one branch is close to the clade containing six strains labelled Stenomitos frigidus isolated from the Antarctic region (where all of the strains bear ANT on their codes) and “Leptolyngbya nostocorum” UAM 387 isolated from a biofilm sample on a rock surface in the Guadarrama River in Madrid, Spain (Figure 4). It seems that the strain UAM 387 is a member of Stenomitos sensu stricto rather than Leptolyngbya, as was noted in the name of the deposited sequence. The rbcL gene sequence was also successfully amplified from the novel strain CSML-F035. In the rbcL gene phylogenetic tree, our strain formed a clade together with uncultured cyanobacterial strains from deglaciated soils on the Tibetan Plateau, and a sister clade to the strain Stenomitos frigidus ACSSI_171 from solonetz (soil) in Russia (Figure 5). Our novel strain and the cyanobacterial strain ACSSI_171 were placed in different clades in the same larger branch in the monophyletic group of Stenomitos in the 16S rRNA phylogeny (Figure 4). Particularly, ACSSI_171 is close to the clade of Stenomitos frigidus strains CANT/11 and CAU10/11 from biological soil crusts from semiarid regions of Europe, and of Stenomitos sp. UMPCCC 1204 isolated from a water sample in Holland Lake.

3.3. ITS p-Distance Dissimilarity and Secondary Structures of 16S–23S ITS

We obtained three copies of the 16S–23S ITS region from Stenomitos nagquensis CSML-F035, for which all sequences had the two tRNA-encoding genes tRNA–Ile and tRNA–Ala. We determined the p-distance dissimilarity of our strain CSML-F035 against strains for which the ITS operons also have both of these tRNAs (Table 1). This resulted in the comparison of CSML-F035 to 13 closely related strains. The ITS region of our novel strain differed in length in comparison to the closely related strains that we used for analysis. For instance, most of the strains of Stenomitos frigidus Antarctic (ANT) have an ITS region that is 500–600 nucleotides (nt) long, while that of our strain was 700–750 nt long. Comparing the conserved domains of the 16S–23S ITS region among these taxa, most of the strains were similar in length, with only a few nt differences observed in some of the domains. For example, the length of the D1–D1′ helices among the strains compared, including our novel strain, was typically 65 nt, and only the strain KPBAG 10,004 showed 64 nt (Table 2). Likewise, the lengths observed for the Spacer + D2 (with 36–38nt), D3 + Spacer (10 nt), Box-B (39–43 nt), Box–A (26 nt), D4 (13–14 nt), and V3 helices (92–96 nt) were similar (Table 2). On comparison, the V2 helices were remarkably different in length among the taxa, ranging from 65 to 77 nt (Table 2). In fact, two known described species (Stenomitos rutilans HA7619–LM2 and Stenomitos kolaensis Pasv RS28) had only 5 nt in their V2 helices and, therefore, were not included for comparison of the V2 helices.
Lineage separation between species can be considered if the dissimilarity in the 16S–23S rRNA ITS region is more than 7%. The dissimilarity in the 16S–23S ITS region between Stenomitos nagquensis sp. nov. and the 13 comparative related strains ranged from 11.2 to 22.8% (Table 1), further supporting the separation of S. nagquensis sp. nov. from other known strains described in this genus. For the comparison of the folded secondary structures, the D1–D1’ helix of strains in Stenomitos—including S. nagquensis sp. nov.—showed a consistent similar basal region up to the mid-stem below the mid-helix, with minimal differences in the bases on the terminal loop (Figure 6). The same case was observed for the Box–B helices in which S. nagquensis sp. nov was distinct only on the terminal loop consisting of AGCUU nucleoside bases (Figure 7). The V2 and V3 helices were extensive and greatly varied in structure among the strains under investigation (Figure 6 and Figure 7), with only similarity in the most basal region 5′–GUC-GAC–3′ for V3, but slightly varied (5′–GAG/A-UUU/C–3′) for V2 helices. Furthermore, the V2 helix of S. nagquensis is composed of only 2 internal bulges, in comparison to other strains with 3–5 internal bulges (Figure 6). In addition, the V3 helix of our novel strain consists of several unpaired bases from the middle to the top part of the helix (Figure 7) thereby creating an extensive number of small internal bulges compared to the other related strains used for comparison.

4. Discussion

Stenomitos was separated from the polyphyletic and morphologically poorly defined Leptolyngbya in 2016 by a modern polyphasic approach—specifically, by morphology, monophyletic clustering on 16S rRNA-based phylogeny, and p-distance dissimilarity and secondary structures based on the 16S–23S ITS regions [21]. Morphologically, Stenomitos is characterized by thin filaments without false and true branching, trichomes with thin sheaths, and cells with parietal thylakoids [21,46]. Six species collected from a wide range of geographic locations have been described in this group so far, including the type species Stenomitos rutilans [21], S. hiloensis, S. kolaensis [46], S. pantisii [47], S. frigidus (formerly known as Phormidium frigidum [48] and S. tremulus (formerly known as Pseudanabaena tremula) [21]. Herein, we present a cyanobacterial strain S. nagquensis sp. nov., collected and isolated from a freshwater sample in meadow wetland in the Tibet Autonomous Region, which appears to be a new member of this group based on its morphologic characteristics, genetic data, and ecological distinctness.
The established workflow for the description of new taxa begins with the analysis of the genetic distance by comparing the 16S rRNA gene sequences with closely related taxa [49,50]. As previously suggested and followed in contemporary studies on cyanobacterial taxonomic research, 93.4–95% is the similarity cutoff range proposed for species in different genera [51,52], while 98.65–98.7% is the threshold set for strains to be presumed to be different species [53]. However, this may not be the case for several taxa of cyanobacteria proposed as novel species, where the similarity values appear less or more than the reported threshold. For instance, S. pantisii was observed with low 16S rDNA sequence similarity against species of Stenomitos, including our novel strain S. nagquensis (Table S2). In this study, Stenomitos nagquensis was 99.3% similar to Stenomitos frigidus BEA 0966B and 99.2% similar to the type species S. tremulus. In this group alone, newly described taxa show similarity values of >98.7%, i.e., S. kolaensis is 99.2% similar to S. hiloensis, as is S. hiloensis to S. tremulus (Table S2). Similar circumstances were observed for cyanobacterial taxa in other lineages. For example, Odorella benthonica shows 99.92% similarity to Pleurocapsa minor (JQ070059) and is separated by distinct morphology and ecological differences [54], as cited in [55]. In the heterocystous Nostocaceaen group, Desmonostoc muscorum Lukesova 1/87 shows 99.3% 16S rRNA gene sequence similarity to D. geniculatum HA4340-LM1 [21], and D. magnisporum AR6-PS shows 99.1% similarity to D. punense MCC 2741, as both shown in [34,35]. In this circumstance, the p-distance method based on the 16S rRNA gene cannot be used as the only absolute basis for separating terminal taxonomic levels (i.e., genera and species). Therefore, apart from utilizing the gold standard 16S-rRNA-gene-based phylogeny, other informative molecular characteristics—including the analysis of the p-distance dissimilarity of 16S–23S ITS and the prediction of secondary structures—have proven their usefulness as strong additional sources of evidence to support the high similarity values given by the 16S rRNA gene sequence comparison across cyanobacterial lineages [55,56,57].
The 16S rRNA phylogenetic tree revealed that our strain CSML-F035 joined the large cluster of cyanobacteria with strains labelled as Stenomitos frigidus. However, this group is polyphyletic and still in need of taxonomic revision. By looking at the branch containing our strain, a close cluster consisting of Stenomitos frigidus Antarctic (ANT) strains appeared to represent two different species, as already mentioned in [46]. Furthermore, other closely related strains bearing the same name—including strains CAU/CANT (from the semiarid Tabernas Desert, Spain), ACSSI 171 (Russia), AR3 (Valleys, Antarctica), and BEA (Lake, Spain)—are all polyphyletic and occupy their own distinct placement in the 16S rRNA phylogeny; therefore, they require further investigation to merit new names. However, S. frigidus BEA 0966B (GenBank accession number ON032979), to which our novel strain is most similar in terms of genetic distance, and which also sits in one clade in the 16S rRNA phylogeny, lacks published morphological descriptions, 16S–23S ITS regions, and other genetic data, limiting further comparative analysis. This strain shares similar ecological habitats with our novel strain, and both were isolated from freshwater sources, but from two geographically distant areas. Further revisionary work on these strains, including characterization using both molecular and morphological features, will provide a clearer resolution on their taxonomic status. In addition, the geographical range and ecological differences among these strains also provide important notes as to why these species are potentially distinctive from one another. Related ecological factors encompass the concept of cyanobacterial taxonomic descriptions and can be considered as an extension of the polyphasic approach [20,55]. In addition, the use of other molecular markers that have been utilized in previous studies—especially for groups with cryptic traits—could help in the assessment of phylogenetic relationships at the cyanobacterial genus and species levels [35,37]. In this study, the rbcL gene was used as an additional genetic marker for characterizing S. nagquensis sp. nov.
Cyanobacterial morphologies and ultrastructure are remarkably diverse in nature, with the presence of many cryptic taxa that exhibit unrecognizable morphological distinctions. The common problems include either a lack of unique features for diagnosis, the possession of overlapping features with different or unrelated groups [11,55], or both. For example, a cyanobacterial strain (ZJJ01) from a freshwater pond isolated from Zhangjiajie National Forest Park, China, appeared to be morphologically similar to Leptolyngbya but was found to belong to the genus Nodosilinea after further morphologic examination and confirmation from molecular data [57]. Members of the genus Stenomitos are not exempt from morphological plasticity, and they exhibit morphological variability as well. In fact, several species within the genus are described as exactly alike, while other members are more morphologically similar to members from other lineages. For instance, S. pantisii showed exactly the same morphological features as S. kolaensis [47] (see also the morphological comparisons in Table 3), while S. kolaensis itself was reported to be morphologically more similar to Tildeniella nuda (Oculatellaceae) [11,46] than to any previously described member of Stenomitos. S. nagquensis showed strong overlapping morphological features with S. hiloensis, exhibiting smaller cells and a similar shape of vegetative cells, rather than with the generitype S. rutilans or other species described in this genus (Table 3). However, the novel S. nagquensis described in this study was derived from a very different habitat from that of S. hiloensis, which was recovered from the seep wall in a tropical rainforest [46].
The utility of the 16S–23S ITS region has become an effective tool for recognizing intrageneric and intergeneric limits within cyanobacteria [58,59]. It should be noted that many cryptic taxa of cyanobacteria were resolvable through analysis of the 16S–23S ITS region [60]. The percentage dissimilarity within the 16S–23S ITS region is equally useful for delimiting species of cyanobacteria. The percentage dissimilarity within the same species has always been less than 3%, while the percentage dissimilarity between species is typically more than 7.0% [34,59,60]. In this study, all known species and unnamed strains of Stenomitos for which the 16S–23S ITS region was available in NCBI GenBank were retrieved and compared against our strain. Stenomitos nagquensis is distinct from other strains of Stenomitos based on the percentage dissimilarity of the ITS region, which is >11.2%, and fits well within the criteria for species delimitation based on a percentage dissimilarity of >7.0%. This further substantiates the recognition of S. nagquensis as new. However, the p-distance comparison of the ITS region was not made against S. pantisii, since its 16S–23S rRNA ITS region was not available and the given accession number MN185751 [47] is incorrect and was registered to a different organism. Furthermore, only the D1-D1’ and Box-B helices were drawn for S. pantisii [47], but they were both distinct from the D1-D1’ and Box-B structures of S. nagquensis. Altogether, S. nagquensis sp. nov presented significant differences in the paired regions and loops in all of the secondary structures of the D1–D1′, Box–B, V2, and V3 helices when compared to any strains in Stenomitos and other closely related taxa, strongly supporting the recognition of this species as a new member within the genus.
In conclusion, strain CSML-F035 was found to be unique ecologically, phylogenetically, genetically, and in the secondary structures of the 16S–23S ITS region. The evidence substantially supports recognition of Stenomitos nagquensis as new and adds to the knowledge of cyanobacteria in the Tibet region.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/d15040536/s1: Table S1: List of gene regions, PCR amplification conditions, and their references, as followed in this study. Table S2: A partial similarity matrix (%) generated using the 16S rRNA gene sequence of Stenomitos nagquensis sp. nov. and its closely related species. References [13,34,35,36,37] are cited in the Supplementary Materials file.

Author Contributions

Conceptualization, M.H.P., T.C., H.C. and N.L.; methodology and resources, M.H.P., X.W. and Y.W.; software, validation, formal analysis, investigation, data curation, and writing—original draft preparation, M.H.P.; writing—review and editing, and project administration, M.H.P. and T.C.; supervision, Z.H., H.C. and N.L.; funding acquisition, N.L., H.C. and Z.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by grants from the Shenzhen Fairy Lake Botanical Garden for Metagenomics Studies on Microbial Diversity in the Coralloid Roots in Cycadales (Li N. FLSF-2020-02), the China National Forestry and Grassland Administration Special Financial Aid Programs for Wildlife Conservation and Nature Reserve Management (Li N. 2013; Li N. 2017), and Rescue and Breeding of Rare and Endangered Wild Species (Li N. 2019073039) to N.L., and from the National Natural Science Foundation of China (41876188), the Shenzhen Special Fund for Sustainable Development (KCXFZ20211020164013021), and the Guangxi Innovation Drive Development Special Fund (Gui Ke AA18242047) to Z.H.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

We sincerely thank David Boufford for advising on some technical terms and English editing to improve the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Komárek, J. Cyanobacterial taxonomy current problems and prospects for the integration of traditional and molecular approaches. Algae 2006, 2, 249–375. [Google Scholar] [CrossRef] [Green Version]
  2. Taton, A.; Grubisic, S.; Ertz, D.; Hodgson, D.A.; Piccardi, R.; Biondi, N.; Tredici, M.R.; Mainini, M.; Losi, D.; Marinelli, F.; et al. Polyphasic study of Antarctic Cyanobacterial Strains. J. Phycol. 2006, 42, 1257–1270. [Google Scholar] [CrossRef]
  3. Johansen, J.R.; Casamatta, D.A. Recognizing cyanobacterial diversity through adoption of a new species paradigm. Algol. Stud. 2005, 117, 71–93. [Google Scholar] [CrossRef]
  4. Komárek, J. Recent changes (2008) in cyanobacteria taxonomy based on a combination of molecular background with phenotype and ecological consequences (genus and species concept). Hydrobiologia 2010, 1, 245–259. [Google Scholar] [CrossRef]
  5. Johansen, J.R.; Bohunická, M.; Lukešová, A.; Hrčková, K.; Vaccarino, M.A.; Chesarino, N.M. Morphological and molecular characterization within 26 strains of the genus Cylindrospermum (Nostocaceae, Cyanobacteria), with descriptions of three new species. J. Phycol. 2014, 50, 187–202. [Google Scholar] [CrossRef]
  6. Davydov, D.; Vilnet, A. Review of the Cyanobacterial Genus Phormidesmis (Leptolyngbyaceae) with the Description of Apatinema gen. nov. Diversity 2022, 14, 731. [Google Scholar] [CrossRef]
  7. Wilmotte, A.; Herdman, M. Phylogenetic relationships among cyanobacteria based on 16S rRNA sequences. In Bergey’s Manual of Systematic Bacteriology; Boone, D.R., Castenholz, R.W., Eds.; Springer: New York, NY, USA, 2001; pp. 487–493. [Google Scholar]
  8. Robertson, B.R.; Tezuka, N.; Watanabe, M. Phylogenetic analyses of Synechococcus strains (cyanobacteria) using sequences of 16S rDNA and part of the phycocyanin operon reveal multiple evolutionary lines and reflect phycobilin content. Int. J. Syst. Evol. Microbiol. 2001, 51, 861–871. [Google Scholar] [CrossRef] [Green Version]
  9. Komárek, J.; Kastovsky, J.; Mareš, J.; Johansen, J.R. Taxonomic classification of cyanoprokaryotes (cyanobacterial genera) using a polyphasic approach. Preslia 2014, 86, 295–335. [Google Scholar]
  10. Sciuto, K.; Moro, I. Detection of the new cosmopolitan genus Thermoleptolyngbya (Cyanobacteria, Leptolyngbyaceae) using the 16S rRNA gene and 16S–23S ITS region. Mol. Phylogenetics Evol. 2016, 105, 15–35. [Google Scholar] [CrossRef]
  11. Mai, T.; Johansen, J.R.; Pietrasiak, N.B.M.; Martin, M.P. Revision of the Synechococcales (Cyanobacteria) through recognition of four families including Oculatellaceae fam. nov. and Trichocoleaceae fam. nov. and six new genera containing 14 species. Phytotaxa 2018, 365, 1–59. [Google Scholar] [CrossRef] [Green Version]
  12. Caires, T.A.; Lyra, G.D.; Hentschke, G.S.; da Silva, A.M.S.; de Araujo, V.L.; Sant’Anna, C.L.; Nunes, J.M.D. Polyphasic delimitation of a filamentous marine genus, Capillus gen. nov. (Cyanobacteria, Oscillatoriaceae) with the description of two Brazilian species. Algae 2018, 33, 291–304. [Google Scholar] [CrossRef]
  13. Maltseva, S.; Kezlya, E.; Krivova, Z.; Gusev, E.; Kulikovskiy, M.; Maltsev, Y. Phylogeny and fatty acid profiles of Aliinostoc vietnamicum sp. nov. (Cyanobacteria) from soils of Vietnam. J. Phycol. 2022, 58, 789–803. [Google Scholar] [CrossRef] [PubMed]
  14. Strunecký, O.; Ivanovaš, A.P.; Mareš, J. An updated classification of cyanobacterial orders and families based on phylogenomic and polyphasic analysis. J. Phycol. 2022, 59, 12–51. [Google Scholar] [CrossRef] [PubMed]
  15. Casamatta, D.A.; Johansen, J.R.; Vis, M.L.; Broadwater, S.T. Molecular and morphological characterization of ten polar and near-polar strains within the Oscillatoriales (Cyanobacteria). J. Phycol. 2005, 41, 421–438. [Google Scholar] [CrossRef]
  16. Komárek, J.; Anagnostidis, K. Cyanoprokaryota II. In Süsswasserflora von Mittleuropa 19/2; Büdel, B., Krienitz, L., Gärtner, G., Schagerl, M., Eds.; Elsevier/Spektrum: München, Germany, 2005; p. 759. [Google Scholar]
  17. Johansen, J.R.; Olsen, C.E.; Lowe, R.L.; Fučíková, K.; Casamatta, D.A. Leptolyngbya species from selected seep walls in the Great Smoky Mountains National Park. Algol. Stud. 2008, 126, 21–36. [Google Scholar] [CrossRef]
  18. Perkerson, R.B.; Johansen, J.R.; Kovacik, L.; Brand, J.; Kastovsky, J.; Casamatta, D.A. A unique pseudanabaenalean (Cyanobacteria) genus Nodosilinea gen. nov. based on morphological and molecular data. J. Phycol. 2011, 47, 1397–1412. [Google Scholar] [CrossRef]
  19. Dadheech, P.W.; Mahmoud, H.; Kotut, K.; Krienitz, L. Haloleptolyngbya alcalis gen.et sp. nov., a new filamentous cyanobacterium from the soda lake Nakuru, Kenya. Hydrobiologia 2011, 637, 269–283. [Google Scholar]
  20. Vaz, M.G.M.V.; Genuário, D.B.; Andreote, A.P.D.; Malone, C.F.S.; Sant´Anna, C.L.; Barbiero, L.; Fiore, M.F. Pantanalinema gen. nov. and Alkalinema gen. nov.: Novel pseudanabaenacean genera (Cyanobacteria) isolated from saline-alkaline lakes. Int. J. Syst. Evol. Microbiol. 2015, 65, 298–308. [Google Scholar] [CrossRef]
  21. Miscoe, L.H.; Johansen, J.R.; Vaccarino, M.A.; Pietrasiak, N.; Sherwood, A.R. The diatom flora and cyobacteria from caves on Kauai, Hawaii. II. Novel cyanobacteria from caves on Kauai, Hawaii. Bibl. Phycol. 2016, 123, 75–152. [Google Scholar]
  22. Dvořák, P.; Hašler, P.; Pitelková, P.; Tabáková, P.; Casamatta, D.A.; Poulíčková, A. A new cyanobacterium from the Everglades, Florida—Chamaethrix gen. nov. Fottea 2017, 17, 269–276. [Google Scholar] [CrossRef] [Green Version]
  23. Becerra-Absalón, I.; Johansen, J.R.; Muñoz-Martín, M.A.; Gustavo, M. Chroakolemma gen. nov. (Leptolyngbyaceae, Cyanobacteria) from soil biocrusts in the semi-desert Central Region of Mexico. Phytotaxa 2018, 367, 201–218. [Google Scholar] [CrossRef] [Green Version]
  24. Zammit, G. Systematics and biogeography of sciophilous cyanobacteria; an ecological and molecular description of Albertania skiophila (Leptolyngbyaceae) gen. & sp. nov. Phycologia 2018, 57, 481–491. [Google Scholar]
  25. Chakraborty, S.; Maruthanayagam, V.; Achari, A.; Mahansaria, R.; Pramanik, A.; Jaisankar, P.; Mukherjee, J. Euryhalinema mangrovii gen. nov., sp. nov., and Leptoelongatus litoralis gen. nov., sp. nov. (Leptolyngbyaceae) isolated from an Indian mangrove forest. Phytotaxa 2019, 422, 58–74. [Google Scholar] [CrossRef]
  26. Radzi, R.; Muangmai, N.; Broady, P.; Wan, M.; Merican, F. Nodosilinea signiensis sp. nov. (Leptolyngbyaceae, Synechococcales), a new terrestrial cyanobacterium isolated from mats collected on signy island, south orkney islands, antarctica. PLoS ONE 2019, 14, e0224395. [Google Scholar] [CrossRef]
  27. Song, G.; Jiang, Y.; Li, R. Scytolyngbya timoleontis gen et sp. nov. (Leptolyngbyaceae, Cyanobacteria): A novel false branching Cyanobacteria from China. Phytotaxa 2015, 224, 72–84. [Google Scholar] [CrossRef]
  28. Geng, R.; Wang, Y.; Cai, F.; Zhang, Y.; Yang, P.; Dai, G.; Li, R.; Yu, G. Neochroococcus gongqingensis gen. et sp. nov., a new member of coccoid cyanobacteria from a watercourse, Eastern China. Fottea 2021, 21, 44–52. [Google Scholar] [CrossRef]
  29. Geng, R.; Li, W.; Chao, A.; Guo, X.; Li, H.; Yu, G.; Li, R. Establishment of a New Filamentous Cyanobacterial Genus, Microcoleusiopsis gen. nov. (Microcoleaceae, Cyanobacteria), from Benthic Mats in Open Channel, Jiangxi Province, China. Diversity 2021, 13, 548. [Google Scholar] [CrossRef]
  30. Geng, R.Z.; Wen, Q.Z.; Wang, Y.L.; Yang, P.; Dai, G.F.; Li, R.H.; Yu, G.L. A novel filamentous cyanobacterium Microseira minor sp. nov. (Oscillatoriaceae, Cyanobacteria) from the Ganfu Channel, Jiangxi, China. Phytotaxa 2021, 524, 178–190. [Google Scholar] [CrossRef]
  31. Wu, Q.L.; Xing, P.; Liu, W.-T. East Tibetan lakes harbour novel clusters of picocyanobacteria as inferred from the 16S–23S rRNA internal transcribed spacer sequences. Microb. Ecol. 2010, 59, 614–622. [Google Scholar] [CrossRef]
  32. Cai, F.; Wang, Y.; Yu, G.; Wang, J.; Pen, X.; Li, R. Proposal of Purpurea gen. nov. (Nostocales, Cyanobacteria), a novel cyanobacterial genus from wet soil samples in Tibet, China. Fottea 2020, 20, 86–97. [Google Scholar] [CrossRef]
  33. Cai, F.; Li, R. Purpureonostoc, a new name for a recently described genus of Nostoc-like cyanobacteria. Fottea 2020, 20, 111. [Google Scholar] [CrossRef]
  34. Pecundo, M.H.; Cai, F.; Chang, A.C.G.; Ren, H.; Li, N.; Li, R.; Chen, T. Polyphasic approach identifies two new species of Desmonostoc (Nostocales, Cyanobacteria) in the coralloid roots of Cycas fairylakea (Cycadales). Phycologia 2021, 60, 653–668. [Google Scholar] [CrossRef]
  35. Maltseva, S.; Bachura, Y.; Erst, T.; Kulikovskiy, M.; Maltsev, Y. Description of Desmonostoc caucasicum sp. nov. (Cyanobacteria) using an integrative taxonomic approach. Phycologia 2022, 61, 514–527. [Google Scholar] [CrossRef]
  36. Iteman, I.; Rippka, R.; Tandeau De Marsac, N.; Herdman, M. Comparison of conserved structural and regulatory domains within divergent 16S rRNA–23S rRNA spacer sequences of cyanobacteria. Microbiology 2000, 146, 1275–1286. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Singh, P.; Fatma, A.; Mishra, A.K. Molecular phylogeny and evogenomics of heterocystous cyanobacteria using rbcl gene sequence data. Ann. Microbiol. 2015, 65, 799–807. [Google Scholar] [CrossRef]
  38. Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Green Version]
  39. Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; et al. Geneious basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef] [Green Version]
  40. Trifinopoulos, J.; Nguyen, L.T.; von Haeseler, A.; Minh, B.Q. W-IQTREE: A fast-online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Res. 2016, 44, 232–235. [Google Scholar] [CrossRef] [Green Version]
  41. Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. JModelTest 2: More models, new heuristics and parallel computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef] [Green Version]
  42. Miller, M.A.; Pfeiffer, W.; Schwartz, T. The CIPRES science gateway: A community resource for phylogenetic analyses. In Proceedings of the 2011 TeraGrid Conference: Extreme Digital Discovery, Salt Lake City, UT, USA, 18-21 July 2011; pp. 1–8. [Google Scholar]
  43. Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef] [Green Version]
  44. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
  45. Mathews Lab. RNAstructure, 1996–2019, Version 6.2. Available online: http://rna.urmc.rochester.edu/RNAstructure.html (accessed on 10 June 2021).
  46. Shalygin, S.; Shalygina, R.R.; Redkina, V.V.; Gargas, C.B.; Johansen, J.R. Description of Stenomitos kolaensis and S. hiloensis sp. nov. (Leptolyngbyaceae, Cyanobacteria) with an emendation of the genus. Phytotaxa 2020, 440, 108–128. [Google Scholar] [CrossRef]
  47. Panou, M.; Gkelis, S. Unravelling unknown cyanobacteria diversity linked with HCN production. Mol. Phylogenetics Evol. 2022, 166, 107322. [Google Scholar] [CrossRef] [PubMed]
  48. Fritsch, F.E. Freshwater algae. In National Antarctic Expedition 1901–1904 Natural History Zoology and Botany [Part 3]; Anon, Ed.; British Museum: London, UK, 1912; Volume VI, pp. 1–66. [Google Scholar]
  49. Stackebrandt, E.; Ebers, J. Taxonomic parameters revisited: Tarnished gold standards. Microbiol. Today 2006, 33, 152–155. [Google Scholar]
  50. Staley, J.T. The bacterial species dilemma and the genomic–phylogenetic species concept. Philos. Trans. R. Soc. 2006, 361, 1899–1909. [Google Scholar] [CrossRef] [Green Version]
  51. Wayne, L.G.; Brenner, D.J.; Colwell, R.R.; Grimont, P.A.D.; Kandler, O.; Krichevsky, M.I.; Starr, M.P. Report of the ad hoc committee on reconciliation of approaches to bacterial systematics. Int. J. Syst. Evol. Microbiol. 1987, 37, 463–464. [Google Scholar] [CrossRef] [Green Version]
  52. Pietrasiak, N.; Mühlsteinová, R.; Siegesmund, M.A.; Johansen, J.R. Phylogenetic placement of Symplocastrum (Phormidiaceae, Cyanophyceae) with a new combination S. californicum and two new species: S. fletchnerae and S. torsivum. Phycologia 2014, 53, 529–541. [Google Scholar] [CrossRef]
  53. Kim, M.; Oh, H.S.; Park, S.C.; Chun, J. Towards a taxonomic coherence between average nucleotide identity and 16S rRNA gene sequence similarity for species demarcation of prokaryotes. Int. J. Syst. Evol. Microbiol. 2014, 64, 346–351. [Google Scholar] [CrossRef]
  54. Shalygin, S.; Huang, I.; Allen, E.H.; Burkholder, J.M.; Zimba, P.V. Odorella benthonica gen. & sp. nov. (Pleurocapsales, Cyanobacteria): An odor and prolific toxin producer isolated from a California aqueduct. J. Phycol. 2019, 55, 509–520. [Google Scholar]
  55. Jung, P.; Mikhailyuk, T.; Emrich, D.; Baumann, K.; Dultz, S.; Büdel, B. Shifting boundaries: Ecological and geographical range extension based on three new species in the cyanobacterial genera Cyanocohniella, Oculatella, and Aliterella. J. Phycol. 2020, 56, 1216–1231. [Google Scholar] [CrossRef]
  56. Rasouli-Dogaheh, S.; Komárek, J.; Chatchawan, T.; Hauer, T. Thainema gen. nov. (Leptolyngbyaceae, Synechococcales): A new genus of simple trichal cyanobacteria isolated from a solar saltern environment in Thailand. PLoS ONE 2022, 17, e0261682. [Google Scholar] [CrossRef] [PubMed]
  57. Cai, F.; Li, S.; Zhang, H.; Yu, G.; Li, R. Nodosilinea hunanesis sp. nov. (Prochlorotrichaceae, Synechococcales) from a Freshwater Pond in China Based on a Polyphasic Approach. Diversity 2022, 14, 364. [Google Scholar] [CrossRef]
  58. Johansen, J.R.; Kovacik, L.; Casamatta, D.A.; Fučiková, K.; Kaštovský, J. Utility of 16S-23S ITS sequence and secondary structure for recognition of intrageneric and intergeneric limits within cyanobacterial taxa: Leptolyngbya corticola sp. nov. (Pseudanabanaceae, Cyanobacteria). Nova Hedwig. 2011, 92, 283–302. [Google Scholar] [CrossRef]
  59. Osorio-Santos, K.; Pietrasiak, N.; Bohunická, M.; Miscoe, L.H.; Kovaácik, L.; Martin, M.P.; Johansen, J.R. Seven new species of Oculatella (Pseudanabaenales, Cyanobacteria). Eur. J. Phycol. 2014, 49, 450–470. [Google Scholar] [CrossRef] [Green Version]
  60. Pietrasiak, N.; Osorio-Santos, K.; Shalygin, S.; Martin, M.P.; Johansen, J.R. When is a lineage a species? A case study in Myxacorys gen. nov. (Synechococcales: Cyanobacteria) with the description of two new species from the Americas. J. Phycol. 2019, 55, 976–996. [Google Scholar] [CrossRef]
Diversity 15 00536 g001 550
Figure 1. (a) General appearance of the sampling site; (b) mass of visible macroscopic colonies in fresh water. Photos were taken by X. Wen.
Figure 1. (a) General appearance of the sampling site; (b) mass of visible macroscopic colonies in fresh water. Photos were taken by X. Wen.
Diversity 15 00536 g001
Diversity 15 00536 g002 550
Figure 2. Line drawings of Stenomitos nagquensis sp. nov; scale bar = 5 µm.
Figure 2. Line drawings of Stenomitos nagquensis sp. nov; scale bar = 5 µm.
Diversity 15 00536 g002
Diversity 15 00536 g003 550
Figure 3. Light micrographs of Stenomitos nagquensis sp. nov. from the strain CSML-F035: (a) Parallel trichomes; isodiametric cells. (b–f) Detail of trichomes with varying shapes of apical cells; some trichomes also showing clear constrictions at the cross-walls. (S) Sheaths; (N) necridia; (A) apical cells; scale bar: 10 µm.
Figure 3. Light micrographs of Stenomitos nagquensis sp. nov. from the strain CSML-F035: (a) Parallel trichomes; isodiametric cells. (b–f) Detail of trichomes with varying shapes of apical cells; some trichomes also showing clear constrictions at the cross-walls. (S) Sheaths; (N) necridia; (A) apical cells; scale bar: 10 µm.
Diversity 15 00536 g003
Diversity 15 00536 g004 550
Figure 4. Maximum-likelihood (ML) phylogenetic tree based on the 16S rRNA gene, with node supports from ML, neighbor-joining, and Bayesian inference. Bootstrap and posterior probability values from 99 to 100/1.0 are represented by asterisks (*). The novel species Stenomitos nagquensis, written in bold, is separated on a unique node with high support values. Accession numbers are provided after each taxon name, and the numbers in parentheses after the accession numbers are the percentage similarity values between Stenomitos nagquensis and the taxon.
Figure 4. Maximum-likelihood (ML) phylogenetic tree based on the 16S rRNA gene, with node supports from ML, neighbor-joining, and Bayesian inference. Bootstrap and posterior probability values from 99 to 100/1.0 are represented by asterisks (*). The novel species Stenomitos nagquensis, written in bold, is separated on a unique node with high support values. Accession numbers are provided after each taxon name, and the numbers in parentheses after the accession numbers are the percentage similarity values between Stenomitos nagquensis and the taxon.
Diversity 15 00536 g004
Diversity 15 00536 g005 550
Figure 5. Maximum-likelihood phylogenetic tree based on the rbcL gene, with node support from ML and Bayesian inference. Bootstrap and posterior probability values from 99 to 100 are represented by asterisks (*). The novel species is written in bold.
Figure 5. Maximum-likelihood phylogenetic tree based on the rbcL gene, with node support from ML and Bayesian inference. Bootstrap and posterior probability values from 99 to 100 are represented by asterisks (*). The novel species is written in bold.
Diversity 15 00536 g005
Diversity 15 00536 g006 550
Figure 6. Predicted secondary structures of the D1–D1′ and V2 helices of the 16S–23S ITS region of strains of Stenomitos. The novel strain is labelled in bold.
Figure 6. Predicted secondary structures of the D1–D1′ and V2 helices of the 16S–23S ITS region of strains of Stenomitos. The novel strain is labelled in bold.
Diversity 15 00536 g006
Diversity 15 00536 g007 550
Figure 7. Predicted secondary structures of Box-B and V3 helices of the 16S–23S ITS region of strains of Stenomitos. The novel species is labelled in bold.
Figure 7. Predicted secondary structures of Box-B and V3 helices of the 16S–23S ITS region of strains of Stenomitos. The novel species is labelled in bold.
Diversity 15 00536 g007
Table
Table 1. Percentage dissimilarity based on 16S–23S ITS sequences for operons containing both tRNA genes among Stenomitos nagquensis sp. nov. and its closely related strains.
Table 1. Percentage dissimilarity based on 16S–23S ITS sequences for operons containing both tRNA genes among Stenomitos nagquensis sp. nov. and its closely related strains.
StrainStenomitos nagquensis CSML-F035Stenomitos rutilans HA7619-LM2Stenomitos hiloensis HA6792-KK3Stenomitos kolaensis Pasv RS28Stenomitos frigidus ANT.L52B.3Stenomitos frigidus ANT.L8.1Stenomitos frigidus ANT.L53B.1Stenomitos sp. BACA0708Stenomitos sp. BACA0054Stenomitos sp. BACA0618Stenomitos sp. WJT24NPBG20Stenomitos sp. SAG 37.90Stenomitos sp. KPABG 610003
Stenomitos nagquensis CSML-F035
Stenomitos rutilans HA7619-LM215.1
Stenomitos hiloensis HA6792-KK314.112.3
Stenomitos kolaensis Pasv RS2811.211.68.6
Stenomitos frigidus ANT.L52B.322.820.923.320.3
Stenomitos frigidus ANT.L8.114.115.613.812.622.8
Stenomitos frigidus ANT.L53B.114.115.313.612.622.80
Stenomitos sp. BACA070812.610.93.97.722.214.214.0
Stenomitos sp. BACA005416.312.311.711.623.916.516.211.4
Stenomitos sp. BACA061817.212.010.710.823.518.117.810.110.8
Stenomitos sp. WJT24NPBG2020.114.217.515.220.723.823.817.217.219.1
Stenomitos sp. SAG 37.9015.710.612.79.323.316.616.312.213.011.818.7
Stenomitos sp. KPABG 61000315.712.914.39.920.715.014.713.916.316.321.315.8
Stenomitos sp. KPABG 61000415.015.513.512.224.011.711.713.215.416.321.015.614.2
Table
Table 2. Lengths of conserved domains of the 16S–23S rRNA ITS region among Stenomitos nagquensis sp. nov. and its closely related strains.
Table 2. Lengths of conserved domains of the 16S–23S rRNA ITS region among Stenomitos nagquensis sp. nov. and its closely related strains.
StrainD1-D1′ HelixSpacer + D2D3 + SpacertRNA–IleV2 HelixtRNA–AlaSpacerBox–B HelixSpacer + Box–AD4 + SpacerV3 HelixD5 region
Stenomitos nagquensis CSML-F035653810796573393926139428
Stenomitos rutilans HA7619-LM265361079–73484026149228
Stenomitos hiloensis HA6792-KK3653610796973403926139328
Stenomitos kolaensis Pasv_RS2865371079–73424026139328
Stenomitos frigidus ANT.L52B.3653610797773414226149417
Stenomitos frigidus ANT.L8.1/ANT L53B.1653610796973404026139617
Stenomitos sp. BACA0708653610796973373926139328
Stenomitos sp. BACA0054653610797573413926149328
Stenomitos sp. WJT24NPBG20653610797473404326149327
Stemonitos sp. SAG 37.90653710797473414026149426
Stenomitos sp. KPABG 610003653710797373423926149428
Stenomitos sp. KPABG 61004643710796873404026139625
Stenomitos sp. BACA0618653710797473434026149328
Table
Table 3. Morphological comparisons of Stenomitos nagquensis sp. nov and known Stenomitos species.
Table 3. Morphological comparisons of Stenomitos nagquensis sp. nov and known Stenomitos species.
StrainColor and Appearance of TrichomesSize of Vegetative Cells Length (µm)Shapes of CellsApical CellsAppearance of Mucilaginous SheathPresence of NecridiaIsolation Source/Habitat LocalityReference
Stenomitos nagquensis CSML-F035Bright-to-pale blue–green/short, unbranched, constricted at the cross-walls0.4–2.2Isodiametric, rarely elongatedRound to slightly conicalColorless, firm, hyalinePresentFreshwater, meadow wetland, Tibet, ChinaThis study
Stenomitos pantisii TAU-MAC 4318Blue–green/constricted at the cross-walls1.5–2.5 Isodiametric-to-elongatedRound to slightly conical, elongateSoft, colorless, hyaline-to-firmPresentRocks, grava cave in Corfu Island, GreecePanou and Gkelis [47]
Stenomitos hiloensis HA6792-KK3Blue–green/isopolar, unbranched, untapered, constricted near the cell walls0.5–1.2 IsodiametricRoundFirm, thin, colorlessPresent, frequentSeep wall, Hilo,
Hawaii		Shalygin et al. [46]
Stenomitos kolaensis Pasv_RS28Bright-to-pale blue–green/constricted at the cross-walls 1.5–2.5 Isodiametric-to-elongatedRound to slightly conical, elongatedSoft, colorless, hyaline-to-firmPresentSoil, Kola, RussiaShalygin et al. [46]
Stenomitos rutilans HA7619-LM2Red–brown/short, tapered, unconstricted at the cross-wall2.8–4.8Thin, longer than broadThin, longer than broadAbsent or present as thin and colorlessAbsentCave wall, Waikapala’e Cave, Oahu, HawaiiMiscoe et al. [21]
Stenomitos tremulus UTCC471Blue–green/short, straight, bent3.0–7.0Longer than broadBluntly roundColorless, openAbsentPond, Bylot Island, Northwest CanadaCasamatta et al. [15]
Stenomitos frigidusBlue–green/constricted1.0–2.4–RoundHyalineAbsentStreams, AntarcticaMiscoe et al.; Fritsch [21,48]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Pecundo, M.H.; Chen, T.; Wang, Y.; Wen, X.; Hu, Z.; Chen, H.; Li, N. Stenomitos nagquensis sp. nov. (Leptolyngbyaceae, Cyanobacteria) from a Meadow Wetland in the Tibet Plateau: A Novel Species Studied Based on a Polyphasic Approach. Diversity 2023, 15, 536. https://doi.org/10.3390/d15040536

AMA Style

Pecundo MH, Chen T, Wang Y, Wen X, Hu Z, Chen H, Li N. Stenomitos nagquensis sp. nov. (Leptolyngbyaceae, Cyanobacteria) from a Meadow Wetland in the Tibet Plateau: A Novel Species Studied Based on a Polyphasic Approach. Diversity. 2023; 15(4):536. https://doi.org/10.3390/d15040536

Chicago/Turabian Style

Pecundo, Melissa H., Tao Chen, Yunhua Wang, Xuemei Wen, Zhangli Hu, Huirong Chen, and Nan Li. 2023. "Stenomitos nagquensis sp. nov. (Leptolyngbyaceae, Cyanobacteria) from a Meadow Wetland in the Tibet Plateau: A Novel Species Studied Based on a Polyphasic Approach" Diversity 15, no. 4: 536. https://doi.org/10.3390/d15040536

APA Style

Pecundo, M. H., Chen, T., Wang, Y., Wen, X., Hu, Z., Chen, H., & Li, N. (2023). Stenomitos nagquensis sp. nov. (Leptolyngbyaceae, Cyanobacteria) from a Meadow Wetland in the Tibet Plateau: A Novel Species Studied Based on a Polyphasic Approach. Diversity, 15(4), 536. https://doi.org/10.3390/d15040536

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop