Next Article in Journal
Proximity Effect of Optically Active h-BCN Nanoflakes Deposited on Different Substrates to Tailor Electronic, Spintronic, and Optoelectronic Properties
Next Article in Special Issue
Screening and Application of DNA Markers for Novel Quality Consistency Evaluation in Panax ginseng
Previous Article in Journal
TOR Mediates Stress Responses Through Global Regulation of Metabolome in Plants
Previous Article in Special Issue
Fine Mapping and Candidate Genes Analysis for Regulatory Gene of Anthocyanin Synthesis in the Corolla, Shedding Light on Wild Potato Evolution
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Rapid Identification of Alien Chromosome Fragments and Tracing of Bioactive Compound Genes in Intergeneric Hybrid Offspring Between Brassica napus and Isatis indigotica Based on AMAC Method

1
School of Agriculture, Yunnan University, Kunming 650504, China
2
Yunnan Key Laboratory of Genetic Improvement of Herbal Oil Crops, Industrial Crops Research Institute, Yunnan Academy of Agricultural Sciences, Kunming 650225, China
3
Engineering Technology Research Center of National Forestry and Grassland Administration on Southwest Landscape Architecture, College of Landscape Architecture and Horticulture Sciences, Southwest Forestry University, Kunming 650224, China
4
College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2025, 26(5), 2091; https://doi.org/10.3390/ijms26052091
Submission received: 15 January 2025 / Revised: 24 February 2025 / Accepted: 25 February 2025 / Published: 27 February 2025

Abstract

Distant hybridization between Brassica napus and related genera serves as an effective approach for rapeseed germplasm innovation. Isatis indigotica, a wild relative of Brassica, has emerged as a valuable genetic resource for rapeseed improvement due to its medicinal properties. This study employed anchor mapping of alien chromosomal fragment localization (AMAC) method to efficiently identify alien chromosomal fragments in the progeny derived from distant hybridization between I. indigotica and Brassica napus, ‘Songyou No. 1’. Based on the AMAC method, we developed 193,101 IP and SSR markers utilizing the I. indigotica reference genome (Woad-v1.0). Through Electronic-PCR analysis against the Brassica and I. indigotica pan-genome, 27,820 specific single-locus (SSL) IP and SSR markers were obtained. Subsequently, 205 pairs of IP primers and 50 pairs of SSR primers were synthesized randomly, among which 148 pairs of IP markers (72.20%) and 45 pairs of SSR markers (90%) were verified as SSL molecular markers for the I. indigotica genome with no amplification product in four Brassica crops. These 193 SSL markers enable precise identification of one complete I6 chromosome and three chromosomal fragments (I1:1.17 Mb, I5:2.61 Mb, I7:1.11 Mb) in ‘Songyou No. 1’. Furthermore, we traced 32 genes involved in bioactive compound biosynthesis within/near these alien segments in ‘Songyou No. 1’ and developed seven functional markers. This study not only validates the efficacy of SSL markers for detecting exogenous chromatin in intergeneric hybrids but also provides valuable insights for the precise identification and mapping of desired chromosomal fragments or genes embedded in the derivatives from distant hybridization and potential applications in marker-assisted breeding for medicinal plant via distant hybridization strategy between I. indigotica and Brassica crops.

1. Introduction

Crop improvement for increased yield, resistance against abiotic/biotic stresses, and other desired traits over time is imperative. The combination of sought-after traits from different species’ parents to one offspring is evidently the most common improvement method and is known as distant hybridization. Distant hybridization between Brassica and related genera serves as an effective approach for germplasm innovation in rapeseed breeding, which also plays a significant role in the natural evolution of Brassica species [1]. Isatis indigotica Fort (2n = 14, II) belongs to the Brassicaceae family, commonly known as “Banlangen” for its dried roots [2]. It is a traditional Chinese herbal medicine with properties for clearing heat, detoxifying, preventing colds, and soothing the throat [3]. Pharmacological studies have demonstrated I. indigotica’s therapeutic potential, including antibacterial, anticancer, antiviral, antipyretic, anti-inflammatory, choleretic, anti-endotoxin, and immune-enhancing activities [4,5]. Besides pharmacological benefits, I. indigotica also exhibits resistance against tobacco mosaic virus (TMV) [6] and the fungal pathogen Sclerotinia sclerotiorum, which causes stem rot in rapeseed [2]. The medicinal properties primarily derive from three bioactive compound classes: terpenoids, lignans, and indole alkaloids, and a total of 59, 66, and 32 genes involved in the biosynthetic pathways of the above three active compounds have been respectively identified and annotated in the reference genome of Isatis indigotica, ‘Woad-v1.0’ [4].
Currently, I. indigotica has been extensively applied for the genetic improvement of Brassica crops through distant hybridization. Du et al. [7] successfully generated somatic hybrids between B. napus and I. indigotica Fort. via somatic cell fusion. Subsequently, a complete set of B. napus–I. indigotica monosomic alien addition lines (MAALs) were created [8,9]. Notably, three disomic alien additions (Dd, Df, and Dg) derived from crosses between B. napus, ‘Huashuang No. 3’ (2n = 38, AACC) and I. indigotiga (2n = 14, II) exhibit resistance to highly pathogenic H5N6 avian influenza virus, with efficacy comparable to the clinical antiviral drug Oseltamivir (Tamiflu®) [10]. The Dd addition line, certified as ‘Lancai No. 1.’ (Variety Certification No. Jingpinjian Cai 2014032) by the Beijing Seed Management Station, displayed in vitro inhibitory activity against the Influenza A virus strain A/PR/8/34 (H1N1). This discovery pioneered the development of antiviral Brassica vegetables, including B. oleracea and canola derivatives [11]. The MAAL Mg line served as the male parent in developing the antiviral addition line ‘Songyou No. 1’ through crossed with ‘Huashuang No. 3’ (B. napus, female parent) [11]. Subsequent hybridization between ‘Songyou No. 1’ and ‘Chuan A-3’ (B. napus) yielded the improved ‘Songyou No. 2’ [12]. This innovation in B. napus germplasm resources demonstrates multifunctional potential for utilization in vegetable production, livestock feed formulations, and pharmaceutical industries [10,12,13].
With the ongoing development of a superior intergeneric hybrid between I. indigotica and Brassica crops, how to rapidly and efficiently identify and map the introgressed I. indigotica chromosomal fragments has become increasingly crucial. Current identification techniques for alien chromatin in distant hybridization progenies include: (1) phenotypic trait evaluation, (2) cytogenetic analysis (karyotyping, banding patterns, fluorescence/genomic in situ hybridization), and (3) molecular marker systems. Among these, molecular markers serve as indispensable tools due to their environmental independence, high throughput, reproducibility, and operational efficiency [14,15]. Previous studies have demonstrated the use of I. indigotica genome-specific molecular markers for the identification of its distant hybridization progenies with B. napus [8]. However, only a few markers between specific species of I. indigotica and B. napus have been developed, which do not yet meet the universal requirements for identifying I. indigotica exogenous fragments in intergeneric Brassica hybrids. Therefore, developing comprehensive, genome-specific molecular markers with robust cross-hybrid validation will advance germplasm innovation and utilization in I. indigotica–Brassica distant hybridization.
Over the past decade, a high-quality reference genome for diploid progenitors and allopolyploid species within the Brassica genus has been systematically characterized and driven by high-throughput sequencing technology [16,17,18,19]. These resources have enabled pan-genome analyses that delineate species-level structural variations and the presence/absence of gene polymorphisms across Brassica germplasm [20]. As a collective representation of all genomic sequences within a species or genus, pan-genomes provide critical insights for identifying introgressed chromatin in distant hybrids. Traditional single-reference approaches often fail to detect species-specific genetic variation in hybrid progeny, whereas pan-genome comparisons enable comprehensive identification of donor-derived sequences through muti-reference analysis [20]. In recent years, genetic variation datasets have been established for Brassica crops such as B. napus, B. oleracea, and B. rapa. Based on pan-genome information, significant agronomic traits and candidate genes related to species domestication have been identified [20,21,22,23]. Building on this foundation, we previously proposed an anchor mapping of alien chromosome fragment (AMAC) method—a five-stage pipeline for rapid detection and localization of introgressed chromosomal segments: (1). Donor genomic marker development: Design whole-genome molecular markers (IP and/or SSR) targeting the distant hybridization donor species utilizing the newest reference genome sequence. (2). SSL markers prediction: Perform in silico PCR screening against recipient species’ pan-genomes to predict species-specific single-locus (SSL) markers. (3). Experimental validation: Verify marker specificity through PCR amplification and agarose gel electrophoresis across various parental lines. (4). Hybrid screening: Deploy validated SSL markers to detect alien chromatin in individual offspring plants derived from distant hybridization. (5). Boundary refinement: Iteratively screen and validate new SSL markers, flanking the previously validated SSL markers to precisely define the size of the introgressed fragments [24]. This method has successfully been applied to identify the radish (Raphanus sativus) chromosome segment and locate the ORF gene in the progeny of rape-radish intergeneric hybrid [24].
In this study, we implemented our established AMAC methodology to develop and partially verify whole-genome SSL molecular markers for I. tinctoria through systematic screening against multiple reference genomes: the B. napus pan-genome [20], B. oleracea [21], B. rapa [23], B. juncea [22], and I. indigotica [4]. Then, these genome-wide SSL markers were used to detect the source and sizes of I. tinctoria chromosomal fragments and trace the gene clusters associated with medicinally valuable compounds in ‘Songyou No. 1’. The results provide efficient and reliable molecular markers for the identification of I. tinctoria-Brassica intergeneric hybrid offspring and facilitate targeted introgression breeding in B. napus germplasm improvement.

2. Results

2.1. Development of I. indigotica Whole-Genome Intron Polymorphism (IP) and SSR Markers

A total of 30,323 genes were annotated in the genome file of I. indigotica (Woad-v1.0) [4]; 29,784 of these contained 132,473 introns in total, with an average of 4.45 introns per gene. 16,311, 20,012, 20,907, 16,852, 14,361, 17,868, and 17,258 introns were detected on each chromosome, I1-I7. Moreover, 8904 introns were found on the Contigs (Figure 1, Table S1).
A total of 128,302 (96.85%) introns with a length of 500 bp or less were used for the development of genome-wide IP markers, resulting in the successful development of IP primers for 120,302 intron loci, accounting for 90.81% of all introns. Then, 90,636 pairs of IP primers anticipatedly amplified only one locus in the Woad-v1.0 genome with method of electronic PCR (ePCR) in silico, which also were subjected to ePCR analysis in the I. indigotica reference genomes ASM1459570v1, and ASM90040638v1, resulting in expected PCR amplification products for 89,686, and 58,785 pairs of IP primers (Table 1), respectively. In the I. indigotica genome ASM1459570v1, there are 89,686 marker pairs expected to amplify one locus, 14,837 marker pairs expected to amplify two loci, 3556 markers expected to amplify three loci, and 3357 marker pairs expected to amplify more than three loci. In the I. indigotica genome ASM90040638v1, there are 58,785 markers expected to amplify one locus, 12,364 markers expected to amplify two loci, 2359 markers expected to amplify three loci, and 1229 marker pairs expected to amplify more than three loci (Table 1). A total of 41,003 IP primer pairs were identified that were expected to amplify a single locus across all three I. indigotica reference genomes (Figure 1 and Figure 2A, Table S2). These IP primers are predicted to be genome-wide SL-IP markers specific to I. indigotica.
A total of 83,589 SSR loci were identified in I. indigotica reference genome Woad-v1.0, of which 72,764 loci were successfully developed with primers. Among these, 48,142, 42,951, and 19,595 SSR primer pairs were expected to amplify a single locus in the three respective I. indigotica reference genomes (Table 1). The results of ePCR showed that a total of 11,742 pairs of SSR primers were expected to amplify a single locus across all reference genomes, including Woad-v1.0, ASM1459570v1, and ASM90040638v1 (Figure 1 and Figure 2B, Table S3). These 11,742 pairs of primers are expected to serve as SL-SSR markers for the I. indigotica genome.

2.2. e-PCR Analysis for Whole-Genome SSL Markers in I. indigotica as Compared to the Pan-Genome of Brassica Species

A total of 41,003 I. indigotica whole-genome SL-IP markers obtained from previous analysis were further subjected to e-PCR analysis across the genomes of several Brassica species, including B. napus, B. rapa, B. oleracea and B. juncea. The results revealed that 18,233 I. indigotica whole-genome SL-IP markers were predicted to amplify in the B. napus pan-genome, 14,973 pairs in the B. rapa genome, 12,744 pairs in the B. oleracea genome, and 18,964 pairs in the B. juncea genome (Table 2). In contrast, 22,770, 26,030, 28,259, and 22,039 pairs of I. indigotica whole-genome SL-IP markers were predicted to have no amplification products in the above four Brassica species genomes, respectively. By taking the union of the reverse selection results, it was evident that 19,830 pairs of I. indigotica whole-genome SL-IP markers were predicted to have no PCR amplification products in any of four Brassica species (Figure 1 and Figure 3A, Table S4). These 19,830 pairs of IP markers are designated to be whole-genome SSL-IP markers unique to I. indigotica.
Similarly, 11,742 pairs of I. indigotica whole-genome SL- SSR markers obtained from the previous analysis were analyzed with e-PCR across the genomes of 4 Brassica species, including B. napus, B. rapa, B. oleracea, and B. juncea. The results showed that 1376 pairs of I. indigotica SL-SSR markers were predicted to amplify in the B. juncea reference genome, 1304 pairs in the B. napus pan-genome, 995 pairs in the B. rapa genome, and 830 pairs in the B. oleracea genome (Table 2). By comparison, 10,366, 10,438, 10,747, and 10,912 pairs of I. indigotica whole-genome SL-SSR markers were predicted to have no amplification products in the above four Brassica species, respectively. By taking the union of the reverse selection results, it was clear that 10,130 pairs of I. indigotica whole-genome SL-SSR markers were predicted to have no PCR amplification products in all four Brassica crops (Figure 1 and Figure 3B, Table S5). These 10,130 pairs of SSR markers were designated as specific whole-genome SSL-SSR markers for I. indigotica.

2.3. PCR Validation and Map Construction for I. indigotica Whole-Genome SSL-IP and SSL-SSR Markers

In order to validate the predicted I. indigotica genome SSL-IP and SSL-SSR markers, primers were selected according to the expected results of the amplifying site and size from the e-PCR analysis. A total of 205 pairs of IP primers and 50 pairs of SSR primers were synthesized. Initial screening for specificity was conducted using these primers across four I. indigotica genomes and four Brassica genomes (Figure 4). Differential markers identified were further validated in a small-scale test involving 12 I. indigotica samples and 12 Brassica crop samples (Figure 5). The results showed that some markers amplified in the 12 I. indigotica samples but did not amplify in any of the 12 Brassica crop samples (Figure 5). Through the validation process, a total of 193 genomes SSL-IP and SSL-SSR markers (Table S6) were screened for I. indigotica, including 148 IP markers and 45 SSR markers. These markers were distributed across the I. indigotica genome with an average density of 0.64 markers per Mb (Table 3). The relatively even distribution of these 193 SSL-IP and SSL-SSR markers across the seven chromosomes of I. indigotica facilitated the development of a comprehensive whole-genome SSL marker map for the species (Figure 6).

2.4. Tracing of Bioactive Compounds Genes in B. napus Addition Line ‘Songyou No. 1’ and Development of Functional Markers

Unique markers for the I. indigotica genome were used to detect alien chromosomal fragments in B. napus addition line ‘Songyou No. 1’. The results showed that a complete I. indigotica chromosome I6 (g) was present in the hybrid progeny of ‘Songyou No. 1’, which is consistent with previous GISH analysis findings in I. indigotica hybrid progeny [8] (Figure 7A). Additionally, three I. indigotica chromosome segments I1 (f), I5 (c), and I7 (a) (Table S1) were identified with sizes of 1.17 Mb (Figure 7B), 2.61 Mb (Figure 7C), and 1.11 Mb (Figure 7D).
To analyze whether the alien fragments of I. indigotica in ‘Songyou No. 1’ contain genes responsible for the biosynthesis of bioactive compounds, we examined its biosynthetic pathways according to the reference genome annotation [4]. Thirty-two relevant genes are distributed across chromosomes I5 (c), I6 (g), and I7 (a) (Table S1), with the highest number (26 genes) found on chromosome I6 (g). These genes were primarily categorized into three groups: Terpenoids and sterols biosynthetic pathways, Lignans and flavonoids biosynthetic pathways, and Indole alkaloids biosynthetic pathways. Specifically, the terpenoids and sterols biosynthetic pathways involved 9 genes, the lignans and flavonoids biosynthetic pathways included 17 genes, and the indole alkaloids biosynthetic pathways contained 6 genes (Figure 7, Table 4). The identification of genes related to the biosynthesis of bioactive compounds on the aforementioned alien chromosomal fragments suggests that ‘Songyou No. 1’ has potential antiviral activity. Furthermore, on chromosome I5 (c), the SSL-IP marker I05_1048 was located only about 68 Kb away from the SM02 (Iin18475) gene, while I05_1057 is situated about 428 Kb from the DIR (Iin18531) gene. These markers can serve as tightly linked loci for these two genes and may be utilized in molecular marker-assisted breeding in the future.
Based on the identification of 32 genes associated with the production of bioactive substances, genome SSL-IP markers were developed. Among these, SSL-IP markers were successfully developed for 7 genes, with 6 markers located on chromosome I6 and 1 marker on chromosome I7 (Table 5, Figure 8). These genome SSL-IP markers can be utilized as functional markers in the future to detect these genes.

3. Discussion

Molecular marker technology has been widely adopted in various aspects of crop breeding, including variety identification, genetic map construction, gene mapping and cloning [25], germplasm improvement [15], and marker-assisted selection [26]. In I. indigotica, molecular marker technology played a significant role in identifying distant hybrid progeny, exploring genetic diversity, and identifying germplasm [8,27,28]. However, there are few reports on the development of specific molecular markers for the I. indigotica genome and systematic approaches. The advancement of whole-genome sequencing, along with the availability of robust in silico tools, can accelerate the development of low-cost, highly efficient gene-associated functional molecular markers for gene mapping, crop breeding, and germplasm resource identification. Introns, once considered non-coding DNA, are now recognized for their critical roles in regulating gene expression [29]. By leveraging publicly available genome sequences, this study identified introns across the entire genome and explored their polymorphisms as molecular markers in plants. Among simple PCR-based markers, IPs are gene-specific, often hypervariable, environmentally neutral, and co-dominant, with high transferability across related species [30]. Genome-wide intron-derived polymorphic markers have been reported in rice [31], foxtail millet [32], sorghum [33], chickpea [34], Macrotyloma spp. [35] and tea plant [36] were reported. The current study deployed self-developed IP3.0 software to develop I. indigotica whole genome SL-IP and SL-SSR markers against the four different published genomes of I. indigotica. These I. indigotica genome-identified markers were then subjected to the e-PCR analysis against the Brassica genomes. The markers that failed to give any amplifications against the Brassica genomes and only resulted in amplifications for a single locus against the I. indigotica genome were designated as the genome SSL markers for I. indigotica genomes.
This study successfully constructed a high-resolution SSL marker map for I. indigotica by integrating genome-wide SSL-IP and SSL-SSR markers, effectively resolving longstanding challenges associated with marker distribution bias and coverage gaps in conventional systems [37]. The strategic use of anchor markers further enabled rapid and precise identification of alien chromosomal insertion fragments from I. indigotica in hybrid genomes, achieving unprecedented specificity in detecting heterologous chromosomal segments. This advancement significantly improves the efficiency of tracking exogenous DNA in complex hybrid backgrounds, as exemplified by the successful characterization of I. indigotica chromosomal fragments in the B. napus hybrid ‘Songyou No. 1’ [3]. Notably, this approach addresses a critical gap in plant genomics: while most prior studies relied on limited differential markers derived from pairwise species comparisons [38], our pan-genome-informed strategy leverages comprehensive genomic data from the Brassica genus and I. indigotica to develop universally applicable markers. These markers fulfill the pressing need for robust tools to identify I. indigotica-derived fragments across diverse intergeneric hybrids within the Brassica lineage [38]. It meets the general requirements for identifying exogenous fragments of I. indigotica in a wide range of intergeneric hybrids between I. indigotica and the Brassica genus. At the same time, a relatively systematic identification method for molecular markers of exogenous chromosomal fragments in I. indigotica has been established, which will provide important references for the identification of heterologous chromosomes in the progeny of distantly hybridized crops involving I. indigotica.
Distant hybrids are important intermediate materials for creating alien addition lines, and the hybrids produced through distant hybridization may experience severe segregation. Therefore, how to quickly and accurately identify the exogenous chromosomal fragments in the genomes of the offspring of elite distant hybrid lines is crucial for subsequent genetic and application research. While conventional cytogenetic techniques such as genome in situ hybridization (GISH) and fluorescence in situ hybridization (FISH) have been widely used to detect chromosomal variations [39], their utility is constrained by three key limitations: technical complexity, prolonged experimental timelines, and inability to resolve the precise size or boundaries of introgressed fragments [40,41]. These constraints render them impractical for high-throughput screening of large hybrid populations—a critical requirement in modern breeding programs. In contrast, molecular markers are widely used in the creation and identification of distant hybrid alien addition lines in the Brassicaceae family due to their stability, high sensitivity, large number, reliable repeatability, and insensitivity to spatiotemporal environmental factors. For instance, a complete set of the Brassica napus-Raphanus sativus disomic addition lines was successfully identified using RAPD markers [42]. Compared to RFLP, RAPD, and AFLP markers, SSR markers exhibit richer polymorphism and simpler operation, making them favored by researchers. Li et al. [43] identified the sixth disomic addition line of the cabbage-Brassica napus C genome using C genome-specific SSR markers, Zhu et al. [44] identified a complete set of AA+1C1-9 MAALs using C subgenome-specific SSR markers, and Tan et al. identified seven Brassica oleracea-nigra MAALs using black mustard chromosome-specific SSR markers [45]. Building on this foundation, Kang et al. [8] employed chromosome-specific SSR markers to establish a complete set of B. napus–Isatis indigotica MAALs, validated through GISH. While these studies underscore the utility of SSR markers, their reliance on low-density marker systems restricts resolution and fails to address genome-wide coverage gaps. Our study advances the field through integrated SSL-IP and SSL-SSR markers, achieving unprecedented precision in tracking alien chromosomal fragments. Unlike prior approaches limited to pairwise species comparisons [38], our pan-genome-informed strategy utilizes genus-wide Brassica genomic data to develop markers with cross-species applicability, ensuring robust identification of I. indigotica-derived segments across diverse intergeneric hybrids. The hybrid line ‘Songyou No. 1’ (B. napus–I. indigotica) exemplifies this approach’ efficacy: SSL-IP and SSL-SSR markers not only confirm intact I. indigotica chromosomes (as previously shown by GISH [8]) but also precisely mapped three discrete chromosomal fragments—I1 (1.17 Mb), I5 (2.61 Mb), and I7 (1.11 Mb)—within the hybrid genome. This dual-marker system enhances resolution through increased marker density and coverage, resolving genomic composition ambiguities undetectable by traditional cytogenetic methods. The SSL markers enable real-time monitoring of chromosomal inheritance and recombination dynamics, addressing a fundamental challenge in distant hybridization-genomic instability. By facilitating early-generation screening, these markers significantly reduce dependence on labor-intensive phenotypic evaluations, accelerating the development of stable addition lines. For instance, the identification of I. indigotica chromosomal fragments in ‘Songyou No. 1’ demonstrates how marker-assisted selection optimizes trait combinations (e.g., coupling B. napus high yield with I. indigotica disease resistance or medicinal compound biosynthesis) while minimizing breeding cycles. This efficiency is further exemplified by the AMAC method, which employs SSL markers for rapid, high-accuracy detection of exogenous fragments, establishing a scalable framework for hybrid derivative analysis.
I. indigotica, commonly known as woad, is a traditional dye and medicinal plant in China. Its roots (i.e., Banlangen) and leaves (i.e., Daqingye) exhibit strong antiviral activity, as well as antibacterial, anti-endotoxin, anticancer, immune-regulatory, and blood-activating properties [46]. The creation of the full set of B. napus- I. indigotica addition lines [4,10,11,12] has facilitated research into the genes carried by the alien chromosomes of I. indigotica in the B. napus background and the metabolic products determined by these genes. This provides new materials and insights for studying genome structure, medicinal functional components, and disease resistance mechanisms. Kang et al. used five B. napus- I. indigotica monosomic addition lines (Mb, Mc, Md, Me, and Mf) and one disomic addition line (Dd) with sterile cytoplasm, cultured and propagated through tissue culture to prepare aqueous extracts from the above-ground parts. Metabolomics analysis and in vitro antiviral activity evaluations were conducted. Principal component analysis revealed that the disomic addition line Dd exhibited the greatest metabolic difference from the B. napus metabolome and demonstrated some inhibitory effects on the H1N1 influenza virus [10]. Further studies on the in vitro antiviral activity of B. napus- I. indigotica disomic addition lines with normal B. napus cytoplasm and seed-reproductive ability found that three materials (Dd, Df, and Dg) exhibited resistance to the highly pathogenic avian influenza virus H5N6, comparable to the widely used antiviral drug Oseltamivir, and even stronger than that of I. indigotica itself [9]. These findings suggest that alien chromosomes of I. indigotica carry genes for synthesizing specific medicinally active components, which can be expressed under the B. napus background. In the present study, we identified 32 genes located on the I. indigotica chromosomes I5 (c), I6 (g), and I7 (a) (Table S1), which are responsible for generating bioactive substances. Among these, 26 genes are located on chromosome I6 (g), and the antiviral strain ‘Songyou No. 1’ was derived from the hybridization of B. napus- I. indigotica monosomic addition line Mg with B. napus variety ‘Huashuang No. 3’ [10,12]. The discovery that chromosome I6 (g) of I. indigotica harbors a gene cluster associated with bioactive compound biosynthesis provides critical insights into the molecular basis of the antiviral activity observed in the hybrid line ‘Songyou No. 1’. This genomic configuration strongly suggests that the antiviral properties of ‘Songyou No. 1’—including efficacy against highly pathogenic H5N6 avian influenza virus—stem directly from the expression of I6 (g)-derived metabolites under the B. napus genetic background. These findings establish ‘Songyou No. 1’ as a promising multifunctional crop with applications spanning (1) Human nutrition (vegetable oil production), (2) Sustainable agriculture (antiviral phytochemicals enriched animal feed), and (3) pharmaceutical industries (large-scale production of bioactive precursors).

4. Materials and Methods

4.1. Materials and DNA Extraction

12 I. indigotica genotypes were collected across multiple provinces and cities in China, and they were used as positive controls for the genome specificity of the developed markers. 12 Brassica genotypes (B. rapa, B. oleracea, B. juncea, and B. napus) were used as a negative control, provided by the Industrial Crops Institute, Yunnan Academy of Agricultural Sciences. The genus hybrid ‘Songyou No. 1’ was used as the testing genotype, contributed by Huazhong Agricultural University Wuhan, China, which was the offspring of an intergeneric cross between B. napus and I. indigotica [11] (Table S7). The DNA extraction was performed using the CTAB method [47].

4.2. Genome Sequence Resource

The genome data for I. indigotica (Woad-v1.0) were obtained from the NCBI website (https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=161756, accessed on 1 February 2020) [4] for whole-genome IP and SSR markers development. Additional reference genomes for I. indigotica and Brassica used in IP and SSR molecular markers electron PCR (ePCR) analysis included: the genome ASM1459570v1 downloaded from https://www.ncbi.nlm.nih.gov/assembly/GCA_014595705.1 (accessed on 15 September 2020), the genome ASM90040638v1, downloaded from https://www.ncbi.nlm.nih.gov/assembly/GCA_900406385.1 (accessed on 15 June 2019), the genome sequences of B. rapa (Brara_Chiifu_V3.0) [48], B. oleracea (Braol_JZS_V1.1) [49], and B. juncea (Braju_tum_V1.5) [50], downloaded from http://brassicadb.cn (accessed on 7 July 2022), the pan-genome sequences of B. napus was downloaded from the website http://cbi.hzau.edu.cn/bnapus (accessed on 10 September 2020) [20].

4.3. Development and Identification of I. indigotica Whole Genome Specific-Single-Locus IP and SSR Markers Based on the Method of AMAC

4.3.1. Development and Analysis of I. indigotica Whole Genome IP and SSR Markers

Based on the AMAC methodology established in our previous study [24], whole genome IP and SSR markers were developed using the IPv2.0 tool [24] and MISA tool [51] with I. indigotica genome (Woad-v1.0).
IPv2.0 tool was employed to develop IP markers, which were independently developed by the Industrial Crops Research Institute, Yunnan Academy of Agricultural Sciences, registered under copyright number 2021SR0437322 in China. Executing the IPv2.0 tool required three inputs: (1) the reference genome (FASTA format), (2) the annotation file of the reference genome (GFF/GFF3/GTF format), and (3) a key parameter, an integer, specifying the maximum intron length threshold for IP markers development. The three inputs were the file of the ‘Woad-v1.0’ reference genome sequence, file of its corresponding annotation, and ‘500’, respectively, in this study. The IP_V2.0 pipeline automatically integrates Primer3.0 for primer design and ePCR tool for in silico amplification prediction through its Perl/Shell scripting framework.
The Microsatellite Identification Tool (MISA) was employed to identify SSR regions with the following parameter settings: unit sizes and minimum repeat thresholds set as 1-12, 2-6, 3-5, 4-5, 5-5, and 6-5, with interruptions (maximum difference between two SSRs) set to 100.
Primer3.0 was used for designing primers with the following parameter settings: the primer length was controlled between 18 and 24 bp, with an optimal size of 22 bp; the melting temperature was 58 °C to 65 °C, with an optimal temperature of 60 °C; the GC content was in the range of 40% to 60%; and the predicted PCR product length was in the range of 80–900 bp.
The ePCR tools were used to further refine primer selection and optimize the utility of the IP and SSR primers with the following parameter settings: 3 base pair mismatch, 1 base pair gap, 60 base pair margin, and a product size range of 80–1500 base pairs.
All other parameters were set as their default values.

4.3.2. Prediction of Whole-Genome Single-Locus (SL) and Specific Single-Locus (SSL) Markers in I. indigotica

Based on in silico results from whole-genome IP and SSR primers, the IP and SSR markers predicted to amplify a single locus across all three I. indigotica reference genomes were categorized as I. indigotica genome SL-IP and SL-SSR markers, respectively. These markers were then subjected to ePCR analysis in the genomes of Brassica crops—including B. rapa (AA genome), B. oleracea (CC genome), B. juncea (AABB genome) and the pan-genome of B. napus (AACC genome). The parameters were identical to Section 4.3.1. The ePCR results were incorporated into a reverse selection process, wherein any I. indigotica SL-IP and SL-SSR markers expected to amplify in any of the Brassica reference genomes were excluded. Ultimately, only those markers that consistently amplified a single locus in all three I. indigotica genomes and also produced null ePCR products in all analyzed Brassica genomes were retained. These were predicted to be I. indigotica genome SSL-IP and SSL-SSR markers (in comparison to Brassica crops). The SSL markers located on chromosomes I1-I7 were selected for further experimental verification.

4.3.3. Validation of I. indigotica Genome SSL-IP and SSL-SSR Markers

To validate the specificity of the predicted SSL-IP and SSL-SSR Markers, 15–20 primer pairs were randomly selected per chromosome according to its size and location information from the results of ePCR analysis. A total of 205 IP primers and 50 SSR primers were synthesized, and subsequently experimentally PCR amplification using DNA from 12 I. indigotica inbred lines and 12 Brassica crops materials, including three B. napus hybrid, two conventional B. napus types, two B. juncea types, two B. oleracea types, two B. rapa types, and one B. napus addition line (‘Songyou No. 1’) (Table S7), with four samples randomly selected from each group (I1-I4 and B1-B4). Markers demonstrating consistent amplification in all four I. indigotica materials but showing non-amplification in any Brassica samples were selected. These candidate markers were then PCR-amplified across all 12 I. indigotica samples (I1-I12) and 12 Brassica crop populations (B1-B12) to confirm their specificity as I. indigotica genome SSL markers.
The PCR reaction system was 20 µL:2.5 µL (50 ng/µL) of template DNA, 0.5 µL (10 µmol/L) of each forward and reverse primer, and 16.5 µL of T3 Super PCR Mix (Qingke Biotechnology Co., Ltd., Beijing, China). The PCR amplification program was: 98 °C for 2 min for pre-denaturation, then 98 °C for 10 s for denaturation, 58 °C for 12 s for annealing, and 72 °C for 12 s for extension, for a total of 35 cycles, followed by a final extension at 72 °C for 2 min, and storage at 4 °C. PCR products were separated using 1% agarose gel electrophoresis at a constant voltage of 160 V for 20 min. After electrophoresis, images were captured and saved using a gel imaging system (UVI Platinum/Explorer).

4.4. Detecting Exogenous Chromosomal Segment in ‘Songyou No. 1’

The ‘Songyou No. 1’ was used as the twelfth sample of the Brassica samples group (B12, Table S7) for detecting exogenous chromosomal segments from the I. indigotica genome. The interval of exogenous I. indigotica chromosomal segments was determined by SSL markers amplifying in ‘Songyou No. 1’ (see Section 4.3.3 for details).

4.5. Analysis of Genes Involved in Biosynthetic Pathways of Active Compounds Within Alien Chromosomal Segments from I. indigotica Genome in ‘Songyou No. 1’ and Development of Functional Markers

According to genes annotation of the reference genome of I. indigotica, 59, 66, and 32 genes involved in the biosynthetic pathways of terpenoids, lignans, and indole alkaloids were respectively obtained [4]. Further analysis was performed to estimate whether these genes were present in Songyou No. 1 depending on the location of these genes in the reference genome, Woad-v1.0 [4].
PCR and electrophoresis were employed to verify those SSL-IP markers within genes involved in synthetic pathways of three bioactive compounds. The verified SSL-IP markers were categorized as functional markers of corresponding genes.

4.6. Drawing Method

The circle diagram was created using OmicStudio tools with the default parameters (https://www.omicstudio.cn/tool, accessed on 6 February 2023). The genetic marker map was constructed using the online tool MG2C_V2.1 (http://mg2c.iask.in/mg2c_v2.1/index.html, accessed on 3 March 2022) [52], with default settings. Marker positions were determined according to the results of ePCR analysis based on the Woad-v1.0 reference genome sequence.
The Venn diagram was generated using the online interactive tool VENNY2.1 (https://bioinfogp.cnb.csic.es/tools/venny/index.html, accessed on 1 January 2015), was used to draw Venn’s diagrams.

5. Conclusions

This study successfully developed and partially validated a substantial set of I. indigotica genome SSL-IP and SSL-SSR markers. Through the AMAC methodology, we characterized one complete I6 chromosome and three chromosomal fragments (I1:1.17 Mb, I5:2.61 Mb, I7:1.11 Mb) derived from I. indigotica in ‘Songyou No. 1’. Additionally, we identified 32 biosynthetic pathway genes for active compounds located on chromosomes I1 (f), I3 (b), I5 (c), and I6 (g) of I. indigotica, subsequently developing seven functional markers in ‘Songyou No. 1’. These validated SSL markers and functional markers establish a technical foundation for implementing marker-assisted breeding strategies in medicinal plants via distant hybridization between I. indigotica and Brassica species.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms26052091/s1.

Author Contributions

Conceptualization, F.Z., X.C. and X.G.; Data curation, Y.G., Y.H., J.G., Y.L. and K.Z.; Funding acquisition, F.Z., G.L. and X.C.; Validation, Y.H., Y.G. and J.G.; Writing—original draft, Y.H. and Y.G.; Writing—review & editing, F.Z. and X.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research is funded by the Yunnan Seed Laboratory (202205AR070001), National Natural Science Foundation of China (U2102217), Yunnan Program of Technology Innovation & Talent Cultivation (202305AD160025), Yunnan Intelligence Union Program (202303AM140015) and the Outstanding Young Talents Support Program of Yunnan Province (YNWR-QNBJ-2019-280).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data were shown in Tables and Figures in the main text or Supplemental Files.

Conflicts of Interest

The authors declare no competing interests.

References

  1. Hu, D.; Jing, J.; Snowdon, R.; Mason, A.; Shen, J.; Meng, J.; Zou, J. Exploring the gene pool of Brassica napus by genomics-based approaches. Plant Biotechnol. J. 2021, 19, 1693–1712. [Google Scholar] [CrossRef] [PubMed]
  2. Xu, Z.-Y.; Xi, Y.-F.; Zhou, W.-Y.; Lou, L.-L.; Wang, X.-B.; Huang, X.-X.; Song, S.-J. Alkaloids and monoterpenes from the leaves of Isatis Tinctoria Linnaeus and their chemotaxonomic significance. Biochem. Syst. Ecol. 2020, 92, 104089. [Google Scholar] [CrossRef]
  3. Wang, F.; Bi, J.; He, L.; Chen, J.; Zhang, Q.; Hou, X.; Xu, H. The indole alkaloids from the roots of Isatidis Radix. Fitoterapia 2021, 153, 104950. [Google Scholar] [CrossRef] [PubMed]
  4. Kang, M.; Wu, H.; Yang, Q.; Huang, L.; Hu, Q.; Ma, T.; Li, Z.; Liu, J. A chromosome-scale genome assembly of Isatis Indigotica, an important medicinal plant used in traditional Chinese medicine: An Isatis genome. Hort. Res. 2020, 7, 18. [Google Scholar] [CrossRef]
  5. Ho, Y.-L.; Chang, Y.-S. Studies on the antinociceptive, anti-inflammatory and antipyretic effects of Isatis Indigotica root. Phytomedicine 2002, 9, 419–424. [Google Scholar] [CrossRef]
  6. Wang, Q.-Y.; Wang, X.-B. A TMV-resistant increase material—Banlangen. Virol. Sin. 1990, 5, 107–110. [Google Scholar]
  7. Du, X.; Ge, X.; Yao, X.; Zhao, Z.; Li, Z. Production and cytogenetic characterization of intertribal somatic hybrids between Brassica Napus and Isatis Indigotica and backcross progenies. Plant Cell Rep. 2009, 28, 1105–1113. [Google Scholar] [CrossRef] [PubMed]
  8. Kang, L.; Du, X.; Zhou, Y.; Zhu, B.; Ge, X.; Li, Z. Development of a complete set of monosomic alien addition lines between Brassica Napus and Isatis Indigotica (Chinese Woad). Plant Cell Rep. 2014, 33, 1355–1364. [Google Scholar] [CrossRef]
  9. Yang, H.; Kang, L.; Li, P.; Ge, X.; Li, Z. Development and cytology of disomic alien addition between Brassica napus and Isatis indigotiga. Chin. J. Oil Crop Sci. 2016, 38, 281–286. [Google Scholar]
  10. Kang, L.; Li, P.; Wang, A.; Li, Z. Utilization of Chinese woad to develop antiviral rapeseed and novel cytoplasmic male sterility/fertility restoration system. Chin. J. Oil Crop Sci. 2018, 40, 674–678. [Google Scholar]
  11. Yang, J.; Yuan, Y.; Tang, J.; Zhou, J.; Yang, G.; Zhao, Y.; Huang, L. Characteristics and standardized cultivation techniques of Lancai No.1. Mod. Chin. Med. 2016, 18, 1006–1008. [Google Scholar]
  12. Cui, C.; Li, H.; Zhang, J.; Zheng, B.; Chai, L.; Jiang, J.; Zhang, K.; Qin, H.; Li, Z.; Jiang, L. Preliminary study on Songyou 2 for oilseeds and cruciferous vegetable. Chin. J. Oil Crop Sci. 2022, 44, 973–980. [Google Scholar]
  13. Wang, L.; Li, Z.; Yan, X.; Yang, M.; Yin, X.; Ma, N. New food and midicine homologous vegetable variety ‘Songyou NO.1’ and its high-yield cultivation technologies. Vegetables 2024, 8, 70–73. [Google Scholar]
  14. Fredua-Agyeman, R.; Coriton, O.; Huteau, V.; Parkin, I.A.P.; Chèvre, A.-M.; Rahman, H. Molecular cytogenetic identification of B genome chromosomes linked to blackleg disease resistance in Brassica Napus × B. Carinata interspecific Hybrids. Theor. Appl. Genet. 2014, 127, 1305–1318. [Google Scholar] [CrossRef] [PubMed]
  15. Li, J.; Yang, Y.; Sun, X.; Liu, R.; Xia, W.; Shi, P.; Zhou, L.; Wang, Y.; Wu, Y.; Lei, X.; et al. Development of intron polymorphism markers and their association with fatty acid component variation in oil palm. Front. Plant Sci. 2022, 13, 885418. [Google Scholar] [CrossRef] [PubMed]
  16. Zhou, Y.; Ye, H.; Liu, E.; Tian, J.; Song, L.; Ren, Z.; Wang, M.; Sun, Z.; Tang, L.; Ren, Z.; et al. The complexity of structural variations in Brassica rapa revealed by assembly of two complete T2T genomes. Sci. Bull. 2024, 69, 2346–2351. [Google Scholar] [CrossRef]
  17. Zhang, L.; Liang, J.-L.; Chen, H.-X.; Zhang, Z.-C.; Wu, J.; Wang, X.-W. A near-complete genome assembly of Brassica rapa provides new insights into the evolution of centromeres. Plant Biotechnol. J. 2023, 21, 1022–1032. [Google Scholar] [CrossRef] [PubMed]
  18. Ji, G.; Long, Y.; Cai, G.; Wang, A.; Yan, G.; Li, H.; Gao, G.; Xu, K.; Huang, Q.; Chen, B.; et al. A new chromosome-scale genome of wild Brassica oleracea provides insights into the domestication of Brassica crops. J. Exp. Bot. 2024, 75, 2882–2899. [Google Scholar] [CrossRef] [PubMed]
  19. Wu, Q.; Mao, S.; Huang, H.; Liu, J.; Chen, X.; Hou, L.; Tian, Y.; Zhang, J.; Wang, J.; Wang, Y.; et al. Chromosome-scale reference genome of broccoli (Brassica oleracea var. italica Plenck) provides insights into glucosinolate biosynthesis. Hort. Res. 2024, 11, uhae063. [Google Scholar] [CrossRef]
  20. Song, J.-M.; Guan, Z.; Hu, J.; Guo, C.; Yang, Z.; Wang, S.; Liu, D.; Wang, B.; Lu, S.; Zhou, R.; et al. Eight high-quality genomes reveal pan-genome architecture and ecotype differentiation of Brassica napus. Nat. Plants 2020, 6, 34–45. [Google Scholar] [CrossRef] [PubMed]
  21. Bayer, P.-E.; Golicz, A.-A.; Tirnaz, S.; Chan, C.; Edwards, D.; Batley, J. Variation in abundance of predicted resistance genes in the Brassica oleracea pangenome. Plant Biotechnol. J. 2019, 17, 789–800. [Google Scholar] [CrossRef]
  22. Paritosh, K.; Yadava, S.; Singh, P.; Bhayana, L.; Mukhopadhyay, A.; Gupta, V.; Bisht, N.; Zhang, J.; Kudrna, D.; Copetti, D.; et al. A chromosome-scale assembly of allotetraploid Brassica juncea (AABB) elucidates comparative architecture of the A and B genomes. Plant Biotechnol. J. 2020, 19, 602–614. [Google Scholar] [CrossRef]
  23. Cai, X.; Chang, L.; Zhang, T.; Chen, H.; Zhang, L.; Lin, R.; Liang, J.; Wu, J.; Freeling, M.; Wang, X. Impacts of allopolyploidization and structural variation on intraspecific diversification in Brassica rapa. Genome Biol. 2021, 22, 166. [Google Scholar] [CrossRef] [PubMed]
  24. Zu, F.; Li, X.; Chen, W.; Wang, J.; Luo, Y.; Mehmood, S.; Fan, C.; Li, J.; Dong, Y.; Zhou, Y.; et al. Application of an anchor mapping of alien chromosome (AMAC) fragment localization method in the identification of radish chromosome segments in the progeny of rape–radish interspecific hybrids. Int. J. Mol. Sci. 2024, 25, 13687. [Google Scholar] [CrossRef] [PubMed]
  25. Xia, S.; Cheng, L.; Zu, F.; Dun, X.; Zhou, Z.; Yi, B.; Wen, J.; Ma, C.; Shen, J.; Tu, J.; et al. Mapping of BnMs4 and BnRf to a common microsyntenic region of Arabidopsis thaliana chromosome 3 using intron polymorphism markers. Theor. Appl. Genet. 2012, 124, 1193–1200. [Google Scholar] [CrossRef] [PubMed]
  26. Li, J.; Li, H.; Liu, Z.; Wang, Y.; Chen, Y.; Yang, N.; Hu, Z.; Li, T.; Zhuang, J. Molecular markers in tea Plant (Camellia sinensis): Applications to evolution genetic identification and molecular breeding. Plant Physiol. Biochem. 2023, 198, 107704. [Google Scholar] [CrossRef] [PubMed]
  27. Su, Y.; Zhang, M.; Guo, Q.; Wei, M.; Shi, H.; Wang, T.; Han, Z.; Liu, H.; Liu, C.; Huang, J. Classification of Isatis indigotica Fortune and Isatis tinctoria Linnaeus via comparative analysis of chloroplast genomes. BMC Genom. 2023, 24, 465. [Google Scholar] [CrossRef]
  28. Tang, X.; Xiao, Y.; Lv, T.; Wang, F.; Zhu, Q.; Zheng, T.; Yang, J. High-throughput sequencing and de novo assembly of the Isatis indigotica transcriptome. PLoS ONE 2014, 9, e102963. [Google Scholar] [CrossRef] [PubMed]
  29. Jo, B.-S.; Choi, S.S. Introns: The functional benefits of introns in genomes. Genom. Inform. 2015, 13, 112. [Google Scholar] [CrossRef] [PubMed]
  30. Yang, L.; Jin, G.; Zhao, X.; Zheng, Y.; Xu, Z.; Wu, W. PIP: A database of potential intron polymorphism markers. Bioinformatics 2007, 23, 2174–2177. [Google Scholar] [CrossRef] [PubMed]
  31. Wang, X.; Zhao, X.; Zhu, J.; Wu, W. Genome-wide investigation of intron length polymorphisms and their potential as molecular markers in rice (Oryza sativa L.). DNA Res. 2006, 12, 417–427. [Google Scholar] [CrossRef]
  32. Muthamilarasan, M.; Venkata Suresh, B.; Pandey, G.; Kumari, K.; Parida, S.K.; Prasad, M. Development of 5123 intron-length polymorphic markers for large-Scale genotyping applications in foxtail millet. DNA Res. 2014, 21, 41–52. [Google Scholar] [CrossRef]
  33. Jaikishan, I.; Rajendrakumar, P.; Madhusudhana, R.; Elangovan, M.; Patil, J.V. Development and utility of PCR-based intron polymorphism markers in Sorghum [Sorghum bicolor (L.) Moench]. J. Crop Sci. Biotechnol. 2015, 18, 309–318. [Google Scholar] [CrossRef]
  34. Srivastava, R.; Bajaj, D.; Sayal, Y.-K.; Meher, P.-K.; Upadhyaya, H.-D.; Kumar, R.; Tripathi, S.; Bharadwaj, C.; Rao, A.-R.; Parida, S.-K. Genome-wide development and deployment of informative intron-spanning and intron-length polymorphism markers for genomics-assisted breeding applications in chickpea. Plant Sci. 2016, 252, 374–387. [Google Scholar] [CrossRef] [PubMed]
  35. Sharma, V.; Rana, M.; Katoch, M.; Sharma, P.K.; Ghani, M.; Rana, J.C.; Sharma, T.R.; Chahota, R.K. Development of SSR and ILP Markers in Horsegram (Macrotyloma uniflorum), their characterization, cross-Transferability and relevance for mapping. Mol. Breed. 2015, 35, 102. [Google Scholar] [CrossRef]
  36. Shen, Y.; He, X.; Zu, F.; Huang, X.; Yin, S.; Wang, L.; Geng, F.; Cheng, X. Development of genome-wide intron length polymorphism (ILP) markers in tea plant (Camellia sinensis) and related applications for genetics research. Int. J. Mol. Sci. 2024, 25, 3241. [Google Scholar] [CrossRef]
  37. Norman, A.; Taylor, J.; Edwards, J.; Kuchel, H. Optimising Genomic Selection in Wheat: Effect of marker density, population size and population structure on prediction accuracy. G3 Genes Genomes Genet. 2018, 8, 2889–2899. [Google Scholar] [CrossRef]
  38. Jonah, P.M.; Bello, L.L.; Lucky, O.; Midau, A.; Moruppa, S.M. The importance of molecular markers in plant breeding programmes. Glob. J. Sci. Front. Res. 2011, 11, 5–12. [Google Scholar]
  39. Jeberson, M.S.; Chaudhary, H.K.; Chahota, R.K.; Ashokkumar, K. Identification of alien chromosome/chromatin introgressions in triticale × wheat derived sable lines through molecular cytogenetic analysis. J. Curr. Opin. Crop Sci. 2021, 2, 1–10. [Google Scholar] [CrossRef]
  40. Jiang, J.; Gill, B.S. Current status and the future of fluorescence in situ hybridization (FISH) in plant genome research. Genome 2006, 49, 1057–1068. [Google Scholar] [CrossRef]
  41. Agrawal, N.; Gupta, M.; Atri, C.; Akhatar, J.; Kumar, S.; Heslop-Harrison, P.; Banga, S.S. Anchoring alien chromosome segment substitutions bearing gene(s) for resistance to mustard aphid in Brassica juncea-B. fruticulosa introgression lines and their possible disruption through gamma irradiation. Theor. Appl. Genet. 2021, 134, 3209–3224. [Google Scholar] [CrossRef] [PubMed]
  42. Budahn, H.; Schrader, O.; Peterka, H. Development of a complete set of disomic rape-radish chromosome-addition lines. Euphytica 2008, 162, 117–128. [Google Scholar] [CrossRef]
  43. Li, D.; Li, X.; Peng, Y.; Fang, X.; Wan, Z.; Xu, Y. Generation and identification of Chinese cabbage–cabbage type rape monomer alien addition aine. Acta Hortic. Sin. 2014, 41, 1355–1360. [Google Scholar]
  44. Zhu, B.; Tu, Y.; Zeng, P.; Ge, X.; Li, Z. Extraction of the constituent subgenomes of the natural allopolyploid rapeseed (Brassica napus L.). Genetics 2016, 204, 1015–1027. [Google Scholar] [CrossRef]
  45. Tan, C.; Cui, C.; Xiang, Y.; Ge, X.; Li, Z. Development of Brassica oleracea-nigra monosomic alien addition lines: Genotypic, cytological and morphological analyses. Theor. Appl. Genet. 2017, 130, 2491–2504. [Google Scholar] [CrossRef] [PubMed]
  46. Chung, Y.-C.; Tang, F.-Y.; Liao, J.-W.; Chung, C.; Jong, T.; Chen, S.; Tsai, C.; Chiang, E. Isatis indigotica induces hepatocellular cancer cell death via caspase-independent apoptosis-inducing factor translocation apoptotic pathway in vitro and in vivo. Integr. Cancer Ther. 2011, 10, 201–214. [Google Scholar] [CrossRef]
  47. Aboul-Maaty, N.A.-F.; Oraby, H.A.-S. Extraction of high-quality genomic DNA from different plant orders applying a modified CTAB-based method. Bull. Natl. Res. Cent. 2019, 43, 25. [Google Scholar] [CrossRef]
  48. Cai, C.; Wang, X.; Liu, B.; Wu, J.; Liang, J.; Cui, Y.; Cheng, F.; Wang, X. Brassica rapa genome 2.0: A reference upgrade through sequence re assembly and gene re-annotation. Mol. Plant 2017, 10, 649–651. [Google Scholar] [CrossRef] [PubMed]
  49. Liu, S.; Liu, Y.; Yang, X.; Tong, C.; Edwards, D.; Parkin, I.; Zhao, M.; Ma, J.; Yu, J.; Huang, S.; et al. The Brassica oleracea genome reveals the asymmetrical evolution of polyploid genomes. Nat. Commun. 2014, 5, 3930. [Google Scholar] [CrossRef]
  50. Yang, J.; Liu, D.; Wang, X.; Ji, C.; Cheng, F.; Liu, B.; Hu, Z.; Chen, S.; Pental, D.; Ju, Y.; et al. The genome sequence of allopolyploid Brassica juncea and analysis of differential homoeolog gene expression influencing selection. Nat. Genet. 2016, 48, 1225–1232. [Google Scholar] [CrossRef] [PubMed]
  51. Habibi, N.; Al Salameen, F.; Rahman, M.; Kumar, V.; Al Amad, S.; Shajan, A.; Zakir, F.; Abdul Razzack, N.; Tinwala, W.H. Draft Genome Sequence and SSR Mining Data of Acacia Pachyceras Schwartz. Data Brief 2022, 42, 108031. [Google Scholar] [CrossRef] [PubMed]
  52. Chao, J.; Li, Z.; Sun, Y.; Aluko, O.; Wu, X.; Wang, Q.; Liu, G. MG2C, a user-friendly online tool for drawing genetic maps. Mol. Hort. 2021, 1, 16. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Circle diagrams illustrating the distribution and density of IP and SSR primers developed based on the Woad-v1.0 genome. The outermost circle denotes the physical size (Mb) of Woad-v1.0, I1–I7 means chromosome name, and each is indicated by different colors. Circles II and III show the distribution positions and densities of designed SL-IP and SL-SSR Makers, respectively. Circles IV and V show the distribution density and location of developed SSL-IP and SSL-SSR Makers.
Figure 1. Circle diagrams illustrating the distribution and density of IP and SSR primers developed based on the Woad-v1.0 genome. The outermost circle denotes the physical size (Mb) of Woad-v1.0, I1–I7 means chromosome name, and each is indicated by different colors. Circles II and III show the distribution positions and densities of designed SL-IP and SL-SSR Makers, respectively. Circles IV and V show the distribution density and location of developed SSL-IP and SSL-SSR Makers.
Ijms 26 02091 g001
Figure 2. The Venn diagram representing IP (A) and SSR (B) primer statistics for single locus amplification via e-PCR analysis across three I. indigotica reference genomes.
Figure 2. The Venn diagram representing IP (A) and SSR (B) primer statistics for single locus amplification via e-PCR analysis across three I. indigotica reference genomes.
Ijms 26 02091 g002
Figure 3. Venn diagram representing numbers of e-PCR product-free IP (A) and SSR (B) markers in four Brassica genomes.
Figure 3. Venn diagram representing numbers of e-PCR product-free IP (A) and SSR (B) markers in four Brassica genomes.
Ijms 26 02091 g003
Figure 4. Screening of I. indigotica genome SSL markers against Brassica species. Note: M stands for DL2000 DNA Marker; B01–B04 represents four Brassica crops; I01–I04 represents four I. indigotica genomes.
Figure 4. Screening of I. indigotica genome SSL markers against Brassica species. Note: M stands for DL2000 DNA Marker; B01–B04 represents four Brassica crops; I01–I04 represents four I. indigotica genomes.
Ijms 26 02091 g004
Figure 5. PCR validation for I. indigotica genome SSL markers against Brassica and I. indigotica genotypes. M stands for the marker; B01-B12 represents 12 Brassica crops, and B12 represents B. napus addition line ‘Songyou No. 1’; I01-I12 represents 12 I. indigotica materials.
Figure 5. PCR validation for I. indigotica genome SSL markers against Brassica and I. indigotica genotypes. M stands for the marker; B01-B12 represents 12 Brassica crops, and B12 represents B. napus addition line ‘Songyou No. 1’; I01-I12 represents 12 I. indigotica materials.
Ijms 26 02091 g005
Figure 6. 193 genome SSL-SSR and SSL-IP markers map of I. indigotica, the unit is Mb.
Figure 6. 193 genome SSL-SSR and SSL-IP markers map of I. indigotica, the unit is Mb.
Ijms 26 02091 g006
Figure 7. SSL Marker maps of I. indigotica alien chromosome and fragments from I. indigotica genome in ‘Songyou No. 1’. (AD) represent one complete chromosome (I6), and three chromosomal fragments (I1:1.17 Mb, I5:2.61 Mb, I7:1.11 Mb) ; Isatis represents 12 I. indigotica materials; Brassica represents 11 Brassica materials; “+” represents an I. indigotica fragment; ”-” represents absence of I. indigotica fragment; the red font represents genes related to medicinal values.
Figure 7. SSL Marker maps of I. indigotica alien chromosome and fragments from I. indigotica genome in ‘Songyou No. 1’. (AD) represent one complete chromosome (I6), and three chromosomal fragments (I1:1.17 Mb, I5:2.61 Mb, I7:1.11 Mb) ; Isatis represents 12 I. indigotica materials; Brassica represents 11 Brassica materials; “+” represents an I. indigotica fragment; ”-” represents absence of I. indigotica fragment; the red font represents genes related to medicinal values.
Ijms 26 02091 g007
Figure 8. PCR validation of functional markers for bioactive genes in the alien chromosome fragments from I. indigotica genome in ‘Songyou No. 1’. M stands for marker; B01-B11 represents 11 Brassica crops; B12 represents ‘Songyou No. 1’; I01-I12 represents 12 I. indigotica materials.
Figure 8. PCR validation of functional markers for bioactive genes in the alien chromosome fragments from I. indigotica genome in ‘Songyou No. 1’. M stands for marker; B01-B11 represents 11 Brassica crops; B12 represents ‘Songyou No. 1’; I01-I12 represents 12 I. indigotica materials.
Ijms 26 02091 g008
Table 1. The e-PCR results for IP and SSR marker loci in three genomes of I. indigotica.
Table 1. The e-PCR results for IP and SSR marker loci in three genomes of I. indigotica.
Marker TypeRef. Genomee-PCR for 1 Locuse-PCR for 2 Locie-PCR for 3 Locie-PCR for More Than 3 LociTotal
IPWoad-v1.090,63618,51359825171120,302
ASM1459570v189,68614,83735563357111,436
ASM90040638v158,78512,3642359122974,737
SSRWoad-v1.048,1429237302912,35672,764
ASM1459570v142,9515905174810,70061,304
ASM90040638v119,59549991326354129,461
Table 2. The e-PCR analysis for 41,003 pairs of SL IP and 11,742 SL SSR I. indigotica markers against different Brassica genomes.
Table 2. The e-PCR analysis for 41,003 pairs of SL IP and 11,742 SL SSR I. indigotica markers against different Brassica genomes.
Marker TypeRef. Genomee-PCR for 1 Locuse-PCR for 2 LociE-PCR for 3 Locie-PCR for More Than 3 LociTotal
IPB. napus pagenome338749993403644418,233
B. rapa11,084315360712914,973
B. oleracea9728250240610812,744
B. juncea620363113025342518,964
SSRB. napus pagenome3753922353021304
B. rapa785175305995
B. oleracea674136173830
B. juncea6174241701651376
Table 3. The distribution of 193 PCR-verified genome SSL-IP and SSL-SSR markers for the I. indigotica genome.
Table 3. The distribution of 193 PCR-verified genome SSL-IP and SSL-SSR markers for the I. indigotica genome.
ChromosomeTotal Length (Mb)Counts of SSL MarkersDensity of SSL Markers/Mb
I137.14290.78
I236.13260.71
I337.85250.66
I434.44260.75
I533.15310.94
I638.22260.68
I733.37300.90
Table 4. Genes involved in the biosynthetic pathways of bioactive compounds from the alien fragments of I. indigotica in ‘Songyou No. 1’.
Table 4. Genes involved in the biosynthetic pathways of bioactive compounds from the alien fragments of I. indigotica in ‘Songyou No. 1’.
Metabolic PathwayGene IDChromosomeStart PositionEnd PositionAbbreviationDescription
Iin18475I510,901,21210,904,010SMO2plant 4alpha-monomethylsterol monooxygenase
Terpenoids and sterols biosynthetic pathwaysIin21466I623,170,01123,173,893DXS1-deoxy-D-xylulose-5-phosphate synthase
Iin2345535,110,81535,113,835HDR4-hydroxy-3-methylbut-2-en-1-yl diphosphate reductase
Iin2368936,492,48836,493,670GGPSgeranylgeranyl diphosphate synthase
Iin2397338,150,13938,151,871
Iin2348735,259,00935,262,998FDFTfarnesyl-diphosphate farnesyltransferase
Iin2348835,263,83935,267,058
Iin2377237,054,74737,057,792SQLEsqualene monooxygenase
Iin2224228,230,23428,232,417SMO1plant 4,4-dimethylsterol C-4alpha-methyl-monooxygenase
Lignans and flavonoids biosynthetic pathways Iin18350I510,107,46510,114,592C4Hcinnamate 4-hydroxylase
Iin1835310,117,91010,120,142
Iin1835410,129,17410,131,535
Iin1853111,574,24611,575,487DIRDirigent protein
Iin22645I630,755,72930,757,995CCoAOMTcaffeoyl-CoA O-methyltransferase
Iin2341934,931,45534,933,174caffeoyl-CoA O-methyltransferase
Iin2344235,032,02735,034,075CADcinnamyl-alcohol dehydrogenase
Iin2379437,202,96237,205,920
Iin2379537,207,00437,209,625
Iin2379637,216,85937,219,436
Iin2388937,744,68637,746,684
Iin205095,966,7545,967,454DIRDirigent protein
Iin2110719,140,55319,141,528
Iin2234529,074,56929,075,138
Iin2236029,163,76529,164,388
Iin2112319,340,77119,343,941PLRpinoresinol/lariciresinol reductase
Iin24104I7442,462444,628CCRcinnamoyl-CoA reductase
Indole alkaloids biosynthetic pathwaysIin22896I631,982,63531,989,149DDCaromatic-L-amino-acid/L-tryptophan decarboxylase
Iin2247929,865,59029,868,588TAAL-tryptophan---pyruvate aminotransferase
Iin2107018,226,02618,228,437YUCCAindole-3-pyruvate monooxygenase
Iin2290432,050,34232,052,237
Iin2327634,170,53734,172,463
Iin2382937,348,77437,350,974CYP79Btryptophan N-monooxygenase
Table 5. Functional markers of genes related to bioactivity compounds.
Table 5. Functional markers of genes related to bioactivity compounds.
Functional Marker Gene IDForward Primer Sequence (5′-3′)Reverse Primer Sequence (5′-3′)
I6. YUCCA-1Iin21070GACCGGTTCTTGTTACGCATCATCAACAAACTCTGCCGAA
I6. TAAIin22479CACTTTAACCATGCAAACGCTGAACGTTGCAATTTCCTTG
I6. CAD-1Iin23442ACGAGACAACCAACTCCGACTCGGCATGTCTAATTACCCC
I6. CAD-4Iin23796CAAAAGTTCAGAAGGAGGCGACATTCCCCAATCGTTCTTG
I6. CAD-5Iin23889TCTCCTTCATCCCTCCAATGGCAAAGAAGACGAAGCCATC
I6. GGPS-2Iin23973ACAAGATCAGGAGGGGTGTGGGAGATCAACCAGAAGCTCG
I7. CCRIin24104CTTGGAGAGAGGCTACACCGCTTGACCTTTGCTTTAGCGG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Guo, Y.; Han, Y.; Gao, J.; Ge, X.; Luo, Y.; Zhao, K.; Li, G.; Zu, F.; Cheng, X. Rapid Identification of Alien Chromosome Fragments and Tracing of Bioactive Compound Genes in Intergeneric Hybrid Offspring Between Brassica napus and Isatis indigotica Based on AMAC Method. Int. J. Mol. Sci. 2025, 26, 2091. https://doi.org/10.3390/ijms26052091

AMA Style

Guo Y, Han Y, Gao J, Ge X, Luo Y, Zhao K, Li G, Zu F, Cheng X. Rapid Identification of Alien Chromosome Fragments and Tracing of Bioactive Compound Genes in Intergeneric Hybrid Offspring Between Brassica napus and Isatis indigotica Based on AMAC Method. International Journal of Molecular Sciences. 2025; 26(5):2091. https://doi.org/10.3390/ijms26052091

Chicago/Turabian Style

Guo, Yanhong, Yutian Han, Jinxiang Gao, Xianhong Ge, Yanqing Luo, Kaiqin Zhao, Genze Li, Feng Zu, and Xiaomao Cheng. 2025. "Rapid Identification of Alien Chromosome Fragments and Tracing of Bioactive Compound Genes in Intergeneric Hybrid Offspring Between Brassica napus and Isatis indigotica Based on AMAC Method" International Journal of Molecular Sciences 26, no. 5: 2091. https://doi.org/10.3390/ijms26052091

APA Style

Guo, Y., Han, Y., Gao, J., Ge, X., Luo, Y., Zhao, K., Li, G., Zu, F., & Cheng, X. (2025). Rapid Identification of Alien Chromosome Fragments and Tracing of Bioactive Compound Genes in Intergeneric Hybrid Offspring Between Brassica napus and Isatis indigotica Based on AMAC Method. International Journal of Molecular Sciences, 26(5), 2091. https://doi.org/10.3390/ijms26052091

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop