Exacerbated Activation of the NLRP3 Inflammasome in the Placentas from Women Who Developed Chronic Venous Disease during Pregnancy
Abstract
1. Introduction
2. Results
2.1. The Placentas of Women with CVD Exhibit Increased Expression of Canonical Inflammasome Components
2.2. The Placentas of Women with CVD Display Enhanced Expression of Non-Canonical Caspase-5 and Caspase-8
3. Discussion
4. Materials and Methods
4.1. Study Design and Participants
4.2. Sample Collection and Processing
4.3. Protein Expression by Immunohistochemistry Assays
4.4. Gene Expression Assessed by Real-Time Quantitative PCR
4.5. Histopathological Assessment
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Santler, B.; Goerge, T. Chronic Venous Insufficiency—A Review of Pathophysiology, Diagnosis, and Treatment. JDDG J. Deutsch. Dermatol. Ges. 2017, 15, 538–556. [Google Scholar] [CrossRef] [Scilit]
- Segiet, O.A.; Brzozowa-Zasada, M.; Piecuch, A.; Dudek, D.; Reichman-Warmusz, E.; Wojnicz, R. Biomolecular Mechanisms in Varicose Veins Development. Ann. Vasc. Surg. 2015, 29, 377–384. [Google Scholar] [CrossRef] [Scilit]
- Ortega, M.A.; Fraile-Martínez, O.; García-Montero, C.; Álvarez-Mon, M.A.; Chaowen, C.; Ruiz-Grande, F.; Pekarek, L.; Monserrat, J.; Asúnsolo, A.; García-Honduvilla, N.; et al. Understanding Chronic Venous Disease: A Critical Overview of Its Pathophysiology and Medical Management. J. Clin. Med. 2021, 10, 3239. [Google Scholar] [CrossRef] [Scilit]
- Cornu-Thenard, A.; Boivin, P. Chronic Venous Disease during Pregnancy—Servier—PhlebolymphologyServier—Phlebolymphology. Phlebolymphology 2014, 21, 138–145. [Google Scholar]
- Taylor, J.; Hicks, C.W.; Heller, J.A. The Hemodynamic Effects of Pregnancy on the Lower Extremity Venous System. J. Vasc. Surg. Venous Lymphat. Disord. 2018, 6, 246–255. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ortega, M.A.; Sánchez-Trujillo, L.; Bravo, C.; Fraile-Martinez, O.; García-Montero, C.; Saez, M.A.; Alvarez-Mon, M.A.; Sainz, F.; Alvarez-Mon, M.; Bujan, J.; et al. Newborns of Mothers with Venous Disease during Pregnancy Show Increased Levels of Lipid Peroxidation and Markers of Oxidative Stress and Hypoxia in the Umbilical Cord. Antioxidants 2021, 10, 980. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ortega, M.A.; Saez, M.A.; Fraile-Martínez, O.; Asúnsolo, Á.; Pekarek, L.; Bravo, C.; Coca, S.; Sainz, F.; Álvarez-Mon, M.; Buján, J.; et al. Increased Angiogenesis and Lymphangiogenesis in the Placental Villi of Women with Chronic Venous Disease during Pregnancy. Int. J. Mol. Sci. 2020, 21, 2487. [Google Scholar] [CrossRef] [Scilit]
- Ortega, M.A.; Gómez-Lahoz, A.M.; Sánchez-Trujillo, L.; Fraile-Martinez, O.; García-Montero, C.; Guijarro, L.G.; Bravo, C.; De Leon-Luis, J.A.; Saz, J.V.; Bujan, J.; et al. Chronic Venous Disease during Pregnancy Causes a Systematic Increase in Maternal and Fetal Proinflammatory Markers. Int. J. Mol. Sci. 2022, 23, 8976. [Google Scholar] [CrossRef] [Scilit]
- Ortega, M.A.; Fraile-Martínez, O.; Saez, M.A.; Álvarez-Mon, M.A.; Gómez-Lahoz, A.M.; Bravo, C.; De León Luis, J.A.; Sainz, F.; Coca, S.; Asúnsolo, Á.; et al. Abnormal Proinflammatory and Stressor Environmental with Increased the Regulatory Cellular IGF-1/PAPP-A/STC and Wnt-1/β-Catenin Canonical Pathway in Placenta of Women with Chronic Venous Disease during Pregnancy. Int. J. Med. Sci. 2021, 18, 2814–2827. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sánchez-Trujillo, L.; Fraile-Martinez, O.; García-Montero, C.; García-Puente, L.M.; Guijarro, L.G.; De Leon-Oliva, D.; Boaru, D.L.; Gardón-Alburquerque, D.; del Val Toledo Lobo, M.; Royuela, M.; et al. Chronic Venous Disease during Pregnancy Is Related to Inflammation of the Umbilical Cord: Role of Allograft Inflammatory Factor 1 (AIF-1) and Interleukins 10 (IL-10), IL-12 and IL-18. J. Pers. Med. 2023, 13, 956. [Google Scholar] [CrossRef] [Scilit]
- Gomez-Lopez, N.; Motomura, K.; Miller, D.; Garcia-Flores, V.; Galaz, J.; Romero, R. Inflammasomes: Their Role in Normal and Complicated Pregnancies. J. Immunol. 2019, 203, 2757–2769. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fang, X.; Wang, Y.; Zhang, Y.; Li, Y.; Kwak-kim, J.; Wu, L. NLRP3 Inflammasome and Its Critical Role in Gynecological Disorders and Obstetrical Complications. Front. Immunol. 2021, 11, 555826. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sánchez-Gil, M.A.; Fraile-Martinez, O.; García-Montero, C.; Toledo, M.D.V.; Guijarro, L.G.; De León-Luis, J.A.; Bravo, C.; Díaz-Pedrero, R.; López-Gonzalez, L.; Saez, M.A.; et al. Histopathological Clues of Enhanced Inflammation in the Placental Tissue of Women with Chronic Venous Disease in Lower Limbs during Pregnancy. J. Pers. Med. 2024, 14, 87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yin, Y.; Yan, Y.; Jiang, X.; Mai, J.; Chen, N.C.; Wang, H.; Yang, X.F. Inflammasomes are differentially expressed in cardiovascular and other tissues. Int. J. Immunopathol. Pharmacol. 2009, 22, 311–322. [Google Scholar] [CrossRef] [Scilit] [PubMed] [PubMed Central]
- Cushman, M.; Callas, P.W.; Allison, M.A.; Criqui, M.H. Inflammation and peripheral venous disease. The San Diego Population Study. Thromb. Haemost. 2014, 112, 566–572. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sánchez-Trujillo, L.; García-Montero, C.; Fraile-Martinez, O.; Guijarro, L.G.; Bravo, C.; De Leon-Luis, J.A.; Saez, J.V.; Bujan, J.; Alvarez-Mon, M.; García-Honduvilla, N.; et al. Considering the Effects and Maternofoetal Implications of Vascular Disorders and the Umbilical Cord. Medicina 2022, 58, 1754. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Castro-Ferreira, R.; Cardoso, R.; Leite-Moreira, A.; Mansilha, A. The Role of Endothelial Dysfunction and Inflammation in Chronic Venous Disease. Ann. Vasc. Surg. 2018, 46, 380–393. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ortega, M.A.; Chaowen, C.; Fraile-Martinez, O.; García-Montero, C.; Saez, M.A.; Cruza, I.; Pereda-Cerquella, C.; Alvarez-Mon, M.A.; Guijarro, L.G.; Fatych, Y.; et al. Chronic Venous Disease in Pregnant Women Causes an Increase in ILK in the Placental Villi Associated with a Decrease in E-Cadherin. J. Pers. Med. 2022, 12, 277. [Google Scholar] [CrossRef] [Scilit]
- Patnaik, N.; Pradhan, N. Chronic Venous Insufficiency in Pregnant Women. Indian J. Vasc. Endovasc. Surg. 2021, 8, 213–215. [Google Scholar] [CrossRef] [Scilit]
- Socha, M.W.; Malinowski, B.; Puk, O.; Dubiel, M.; Wiciński, M. The NLRP3 Inflammasome Role in the Pathogenesis of Pregnancy Induced Hypertension and Preeclampsia. Cells 2020, 9, 1642. [Google Scholar] [CrossRef] [Scilit]
- Agrawal, I.; Jha, S. Comprehensive Review of ASC Structure and Function in Immune Homeostasis and Disease. Mol. Biol. Rep. 2020, 47, 3077–3096. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, F.; Li, C.; Zhang, S.Y. NLRP3 Inflammasome: A New Therapeutic Target for High-Risk Reproductive Disorders? Chin. Med. J. 2020, 134, 20–27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ortega, M.A.; De Leon-Oliva, D.; García-Montero, C.; Fraile-Martinez, O.; Boaru, D.L.; de Castro, A.V.; Saez, M.A.; Lopez-Gonzalez, L.; Bujan, J.; Alvarez-Mon, M.A.; et al. Reframing the Link between Metabolism and NLRP3 Inflammasome: Therapeutic Opportunities. Front. Immunol. 2023, 14, 1232629. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- García-Honduvilla, N.; Ortega, M.A.; Asúnsolo, Á.; Álvarez-Rocha, M.J.; Romero, B.; De León-Luis, J.; Álvarez-Mon, M.; Buján, J. Placentas from Women with Pregnancy-Associated Venous Insufficiency Show Villi Damage with Evidence of Hypoxic Cellular Stress. Hum. Pathol. 2018, 77, 45–53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- García-Montero, C.; Fraile-Martinez, O.; Rodriguez-Martín, S.; Funes Moñux, R.M.; Saz, J.V.; Bravo, C.; De Leon-Luis, J.A.; Ruiz-Minaya, M.; Pekarek, L.; Saez, M.A.; et al. Irregular Expression of Cellular Stress Response Markers in the Placenta of Women with Chronic Venous Disease. Antioxidants 2022, 11, 2277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Blevins, H.M.; Xu, Y.; Biby, S.; Zhang, S. The NLRP3 Inflammasome Pathway: A Review of Mechanisms and Inhibitors for the Treatment of Inflammatory Diseases. Front. Aging Neurosci. 2022, 14, 879021. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ortega, M.A.; Romero, B.; Asúnsolo, Á.; Martínez-Vivero, C.; Sainz, F.; Bravo, C.; De León-Luis, J.; Álvarez-Mon, M.; Buján, J.; García-Honduvilla, N. Pregnancy-Associated Venous Insufficiency Course with Placental and Systemic Oxidative Stress. J. Cell. Mol. Med. 2020, 24, 4157–4170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhong, B.; Sun, S.; Tan, K.S.; Ong, H.H.; Du, J.; Liu, F.; Liu, Y.; Liu, S.; Ba, L.; Li, J.; et al. Hypoxia-Inducible Factor 1α Activates the NLRP3 Inflammasome to Regulate Epithelial Differentiation in Chronic Rhinosinusitis. J. Allergy Clin. Immunol. 2023, 152, 1444–1459.e14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Z.; Li, J.; Lin, S.; Wu, Y.; He, D.; Qu, P. PI3K Regulates the Activation of NLRP3 Inflammasome in Atherosclerosis through Part-Dependent AKT Signaling Pathway. Exp. Anim. 2021, 70, 488–497. [Google Scholar] [CrossRef] [Scilit]
- Masumoto, J.; Taniguchi, S.; Nakayama, J.; Shiohara, M.; Hidaka, E.; Katsuyama, T.; Murase, S.; Sagara, J. Expression of Apoptosis-Associated Speck-like Protein Containing a Caspase Recruitment Domain, a Pyrin N-Terminal Homology Domain-Containing Protein, in Normal Human Tissues. J. Histochem. Cytochem. 2001, 49, 1269–1275. [Google Scholar] [CrossRef] [Scilit]
- Compan, V.; Martín-Sánchez, F.; Baroja-Mazo, A.; López-Castejón, G.; Gomez, A.I.; Verkhratsky, A.; Brough, D.; Pelegrín, P. Apoptosis-Associated Speck-like Protein Containing a CARD Forms Specks but Does Not Activate Caspase-1 in the Absence of NLRP3 during Macrophage Swelling. J. Immunol. 2015, 194, 1261–1273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dabrowska, C.; Li, M.; Fan, Y. Apoptotic Caspases in Promoting Cancer: Implications from Their Roles in Development and Tissue Homeostasis. Adv. Exp. Med. Biol. 2016, 930, 89–112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zamaraev, A.V.; Kopeina, G.S.; Prokhorova, E.A.; Zhivotovsky, B.; Lavrik, I.N. Post-Translational Modification of Caspases: The Other Side of Apoptosis Regulation. Trends Cell Biol. 2017, 27, 322–339. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khan, R.N.; Hay, D.P. A Clear and Present Danger: Inflammasomes DAMPing down Disorders of Pregnancy. Hum. Reprod. Update 2015, 21, 388–405. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gotsch, F.; Romero, R.; Chaiworapongsa, T.; Erez, O.; Vaisbuch, E.; Espinoza, J.; Kusanovic, J.P.; Mittal, P.; Mazaki-Tovi, S.; Kim, C.J.; et al. Evidence of the Involvement of Caspase-1 under Physiologic and Pathologic Cellular Stress during Human Pregnancy: A Link Between the Inflammasome and Parturition. J. Matern. Fetal Neonatal Med. 2008, 21, 605. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Afonina, I.S.; Müller, C.; Martin, S.J.; Beyaert, R. Proteolytic Processing of Interleukin-1 Family Cytokines: Variations on a Common Theme. Immunity 2015, 42, 991–1004. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tapia, V.S.; Daniels, M.J.D.; Palazón-Riquelme, P.; Dewhurst, M.; Luheshi, N.M.; Rivers-Auty, J.; Green, J.; Redondo-Castro, E.; Kaldis, P.; Lopez-Castejon, G.; et al. The Three Cytokines IL-1β, IL-18, and IL-1α Share Related but Distinct Secretory Routes. J. Biol. Chem. 2019, 294, 8325. [Google Scholar] [CrossRef] [Scilit]
- Kelley, N.; Jeltema, D.; Duan, Y.; He, Y. The NLRP3 Inflammasome: An Overview of Mechanisms of Activation and Regulation. Int. J. Mol. Sci. 2019, 20, 3328. [Google Scholar] [CrossRef] [Scilit]
- Krishnan, S.M.; Sobey, C.G.; Latz, E.; Mansell, A.; Drummond, G.R. IL–1β and IL–18: Inflammatory Markers or Mediators of Hypertension? Br. J. Pharmacol. 2014, 171, 5589. [Google Scholar] [CrossRef] [Scilit]
- Southcombe, J.H.; Redman, C.W.G.; Sargent, I.L.; Granne, I. Interleukin-1 Family Cytokines and Their Regulatory Proteins in Normal Pregnancy and Pre-Eclampsia. Clin. Exp. Immunol. 2015, 181, 480. [Google Scholar] [CrossRef] [Scilit]
- Löb, S.; Vilsmaier, T.; Schmoeckel, E.; Mahner, S.; Wöckel, A.; Jeschke, U. The Cytokines IL-1b and IL-18 Are Upregulated in the Placenta of Recurrent Miscarriage Patients. J. Reprod. Immunol. 2023, 158, 103583. [Google Scholar] [CrossRef] [Scilit]
- Yockey, L.J.; Iwasaki, A. Interferons and Proinflammatory Cytokines in Pregnancy and Fetal Development. Immunity 2018, 49, 397–412. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Imre, G. Pyroptosis in Health and Disease. Am. J. Physiol. Cell Physiol. 2024, 326, C784–C794. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Man, S.M.; Karki, R.; Kanneganti, T.D. Molecular Mechanisms and Functions of Pyroptosis, Inflammatory Caspases and Inflammasomes in Infectious Diseases. Immunol. Rev. 2017, 277, 61–75. [Google Scholar] [CrossRef] [Scilit]
- Cheng, S.B.; Nakashima, A.; Huber, W.J.; Davis, S.; Banerjee, S.; Huang, Z.; Saito, S.; Sadovsky, Y.; Sharma, S. Pyroptosis Is a Critical Inflammatory Pathway in the Placenta from Early Onset Preeclampsia and in Human Trophoblasts Exposed to Hypoxia and Endoplasmic Reticulum Stressors. Cell Death Dis. 2019, 10, 927. [Google Scholar] [CrossRef] [Scilit]
- Abrahams, V.M.; Tang, Z.; Mor, G.; Guller, S. NLRP3 Inflammasome Function and Pyroptotic Cell Death in Human Placental Hofbauer Cells. J. Reprod. Immunol. 2020, 142, 103214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mandal, R.; Barrón, J.C.; Kostova, I.; Becker, S.; Strebhardt, K. Caspase-8: The Double-Edged Sword. Biochim. Biophys. Acta (BBA) Rev. Cancer 2020, 1873, 188357. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bolívar, B.E.; Brown-Suedel, A.N.; Rohrman, B.A.; Charendoff, C.I.; Yazdani, V.; Belcher, J.D.; Vercellotti, G.M.; Flanagan, J.M.; Bouchier-Hayes, L. Noncanonical Roles of Caspase-4 and Caspase-5 in Heme-Driven IL-1β Release and Cell Death. J. Immunol. 2021, 206, 1878–1889. [Google Scholar] [CrossRef] [Scilit]
- Matikainen, S.; Nyman, T.A.; Cypryk, W. Function and Regulation of Noncanonical Caspase-4/5/11 Inflammasome. J. Immunol. 2020, 204, 3063–3069. [Google Scholar] [CrossRef] [Scilit]
- Yi, Y.S. Regulatory Roles of the Caspase-11 Non-Canonical Inflammasome in Inflammatory Diseases. Immune Netw. 2018, 18, e41. [Google Scholar] [CrossRef] [Scilit]
- Gurung, P.; Kanneganti, T.D. Novel Roles for Caspase-8 in IL-1β and Inflammasome Regulation. Am. J. Pathol. 2015, 185, 17–25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Belousova, V.; Svitich, O.; Timokhina, E.; Ignatko, I.; Bogomazova, I.; Pesegova, S.; Silaeva, T.; Kuzmina, T.; Skorobogatova, O. Caspase-3, Caspase-8 and XIAP Gene Expression in the Placenta: Exploring the Causes of Spontaneous Preterm Labour. Int. J. Mol. Sci. 2023, 24, 1692. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salman, H.; Shah, M.; Habib, S.H.; Rapisarda, A.M.C.; Riemma, G.; Fichera, M. Pathogenesis of Preeclampsia: Implications of Apoptotic Markers and Oxidative Stress. Hum. Exp. Toxicol. 2013, 32, 27–52. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garcia-Puente, L.M.; Fraile-Martinez, O.; García-Montero, C.; Bujan, J.; De León-Luis, J.A.; Bravo, C.; Rodríguez-Benitez, P.; Pintado, P.; Ruiz-Labarta, F.J.; Álvarez-Mon, M.; et al. Placentas from Women with Late-Onset Preeclampsia Exhibit Increased Expression of the NLRP3 Inflammasome Machinery. Biomolecules 2023, 13, 1644. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lurie, F.; Passman, M.; Meisner, M.; Dalsing, M.; Masuda, E.; Welch, H.; Bush, R.L.; Blebea, J.; Carpentier, P.H.; De Maeseneer, M.; et al. The 2020 Update of the CEAP Classification System and Reporting Standards. J. Vasc. Surg. Venous Lymphat. Disord. 2020, 8, 342–352. [Google Scholar] [CrossRef] [Scilit]
- Ortega, M.A.; Sáez, M.A.; Fraile-Martínez, O.; Álvarez-Mon, M.A.; García-Montero, C.; Guijarro, L.G.; Asúnsolo, Á.; Álvarez-Mon, M.; Bujan, J.; García-Honduvilla, N.; et al. Overexpression of glycolysis markers in placental tissue of pregnant women with chronic venous disease: A histological study. Int. J. Med. Sci. 2022, 19, 186–194. [Google Scholar] [CrossRef] [Scilit] [PubMed] [PubMed Central]
- Chomczynski, P.; Sacchi, N. The Single-Step Method of RNA Isolation by Acid Guanidinium Thiocyanate-Phenol-Chloroform Extraction: Twenty-Something Years On. Nat. Protoc. 2006, 1, 581–585. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jang, S.J.; Jeon, R.H.; Kim, H.D.; Hwang, J.C.; Lee, H.J.; Bae, S.G.; Lee, S.L.; Rho, G.J.; Kim, S.J.; Lee, W.J. TATA Box Binding Protein and Ribosomal Protein 4 Are Suitable Reference Genes for Normalization during Quantitative Polymerase Chain Reaction Study in Bovine Mesenchymal Stem Cells. Asian-Australas. J. Anim. Sci. 2020, 33, 2021–2030. [Google Scholar] [CrossRef] [Scilit]
- Gatto, F.; Feelders, R.A.; Van Der Pas, R.; Kros, J.M.; Waaijers, M.; Sprij-Mooij, D.; Neggers, S.J.C.M.M.; Van Der Lelij, A.J.; Minuto, F.; Lamberts, S.W.J.; et al. Immunoreactivity Score Using an Anti-Sst2A Receptor Monoclonal Antibody Strongly Predicts the Biochemical Response to Adjuvant Treatment with Somatostatin Analogs in Acromegaly. J. Clin. Endocrinol. Metab. 2013, 98, E66–E71. [Google Scholar] [CrossRef] [Scilit]






| Clinical Features | CVD (n = 62) | HC (n = 52) |
|---|---|---|
| Median age (IQR), years | 33 (22–40) | 34 (27–41) |
| Median gestational age (IQR), weeks | 40.5 (39–41.5) | 41 (39–42) |
| Caesarean delivery, n (%) | 12 (19.4) | 9 (17.3) |
| Vaginal delivery, n (%) | 50 (80.6) | 43 (82.7) |
| CVD CEAP 1, n (%) | 37 (59.7) | 0 (0) |
| CVD CEAP 2, n (%) | 21 (33.8) | 0 (0) |
| CVD CEAP 3, n (%) | 4 (6.5) | 0 (0) |
| Prior pregnancies, n (%) | 33 (53.2) | 19 (36.5) |
| Prior abortions, n (%) | 14 (22.6) | 9 (17.3) |
| Regular periods of menstruation, n (%) | 50 (80.6) | 42 (80.7) |
| Sedentary profession, n (%) | 41 (66.1) | 40 (76.9) |
| Antigen | Species | Dilution | Provider | Protocol Specifications |
|---|---|---|---|---|
| NLRP3 | Rabbit Monoclonal | 1:500 | Abcam (Cambridge, UK) (ab263,899) | 10 mM Sodium citrate pH = 6, before incubation with blocking solution |
| ASC | Rabbit monoclonal | 1:250 | Abcam (ab283,684) | 100% Triton 0.1% in PBS for 10 min, before incubation with blocking solution |
| Caspase 1 | Rabbit Polyclonal | 1:500 | Abcam (ab62,698) | EDTA pH = 9, before incubation with blocking solution |
| Caspase 5 | Rabbit monoclonal | 1:100 | Abcam (ab40,887) | 10 mM Sodium citrate pH = 6, before incubation with blocking solution |
| Caspase 8 | Rabbit polyclonal | 1:250 | Abcam (ab25,901) | 100% Triton 0.1% in PBS for 10 min, before incubation with blocking solution |
| IL-1β | Rabbit recombinant multiclonal | 1:50 | Abcam (ab283,818) | Not Specifications |
| IgG | Hybridoma Rabbit-Mouse monoclonal | 1:1000 | Sigma-Aldrich (RG96/B5283) | Not specifications |
| Gene | Sequence Fwd (5′→3′) | Sequence Rev (5′→3′) | Temperature |
|---|---|---|---|
| TBP | TGCACAGGAGCCAAGAGTGAA | CACATCACAGCTCCCCACCA | 60 °C |
| NLRP3 | GCTGGCATCTGGATGAGGAA | GTGTGTCCTGAGCCATGGAA | 61 °C |
| ASC | ATCCAGGCCCCTCCTCAG | AGAGCTTCCGCATCTTGCTT | 60 °C |
| Caspase 1 | GAAAAGCCATGGCCGACAAG | GCTGTCAGAGGTCTTGTGCT | 57 °C |
| Caspase 5 | TGTTAGCTATGGCTGAAGACAGT | TTGATGAGCCACGCGATTCT | 58 °C |
| Caspase 8 | GTCTGTACCTTTCTGGCGGA | CTCAGGCTCTGGCAAAGTGA | 60 °C |
| IL-1β | AGCCATGGCAGAAGTACCTG | TGAAGCCCTTGCTGTAGTGG | 60 °C |
| IL-18 | GCTGAAGATGATGAAAACCTGGA | GAGGCCGATTTCCTTGGTCA | 59 °C |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sánchez-Gil, M.A.; Fraile-Martinez, O.; García-Montero, C.; De Leon-Oliva, D.; Boaru, D.L.; De Castro-Martinez, P.; Camacho-Alcázar, A.; De León-Luis, J.A.; Bravo, C.; Díaz-Pedrero, R.; et al. Exacerbated Activation of the NLRP3 Inflammasome in the Placentas from Women Who Developed Chronic Venous Disease during Pregnancy. Int. J. Mol. Sci. 2024, 25, 5528. https://doi.org/10.3390/ijms25105528
Sánchez-Gil MA, Fraile-Martinez O, García-Montero C, De Leon-Oliva D, Boaru DL, De Castro-Martinez P, Camacho-Alcázar A, De León-Luis JA, Bravo C, Díaz-Pedrero R, et al. Exacerbated Activation of the NLRP3 Inflammasome in the Placentas from Women Who Developed Chronic Venous Disease during Pregnancy. International Journal of Molecular Sciences. 2024; 25(10):5528. https://doi.org/10.3390/ijms25105528
Chicago/Turabian StyleSánchez-Gil, María Asunción, Oscar Fraile-Martinez, Cielo García-Montero, Diego De Leon-Oliva, Diego Liviu Boaru, Patricia De Castro-Martinez, Adrían Camacho-Alcázar, Juan A. De León-Luis, Coral Bravo, Raúl Díaz-Pedrero, and et al. 2024. "Exacerbated Activation of the NLRP3 Inflammasome in the Placentas from Women Who Developed Chronic Venous Disease during Pregnancy" International Journal of Molecular Sciences 25, no. 10: 5528. https://doi.org/10.3390/ijms25105528
APA StyleSánchez-Gil, M. A., Fraile-Martinez, O., García-Montero, C., De Leon-Oliva, D., Boaru, D. L., De Castro-Martinez, P., Camacho-Alcázar, A., De León-Luis, J. A., Bravo, C., Díaz-Pedrero, R., López-Gonzalez, L., Bujan, J., Cancelo, M. J., Álvarez-Mon, M., García-Honduvilla, N., Saez, M. A., & Ortega, M. A. (2024). Exacerbated Activation of the NLRP3 Inflammasome in the Placentas from Women Who Developed Chronic Venous Disease during Pregnancy. International Journal of Molecular Sciences, 25(10), 5528. https://doi.org/10.3390/ijms25105528

