Beneficial Effects of Probiotic Bifidobacterium longum in a Lithium–Pilocarpine Model of Temporal Lobe Epilepsy in Rats
Abstract
:1. Introduction
2. Results
2.1. Dynamics of Body Weight, Survival, and SRSs
2.2. Probiotic Treatment Reduces Neuronal Loss in the Amygdala, but Not in the Hippocampus or Temporal Neocortex, in Rats with TLE
2.3. The Expression of Anti-Inflammatory and Neuroprotective Genes in Brain Cells Is Increased after 30 Days of Treatment with B. longum
2.4. Probiotic Treatment Does Not Significantly Affect Astrogliosis and Microgliosis in Temporal Lobe Structures in Rats with TLE
2.5. Effects of B. longum Treatment on the Behavior of TLE and Control Rats
2.5.1. Motor Hyperactivity
2.5.2. Anxiety
2.5.3. Depressive-like Behavior
2.5.4. Memory
2.5.5. Social Behavior
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. LiCl–Pilocarpine Model of TLE
4.3. Probiotic Treatment
4.4. Survival and Body Weight Dynamics
4.5. mRNA Expression Analysis
4.6. Histological and Immunohistochemical Procedures
4.7. Behavioral Tests
4.7.1. Open Field Test (OFT)
4.7.2. Elevated Plus Maze (EPM)
4.7.3. Social Interaction Test (SIT)
4.7.4. Forced Swim Test (FST)
4.7.5. Fear Conditioning Test (FCT)
4.8. Evaluation of SRSs
4.9. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Appendix B. Results of Statistical Analysis
Structures | Factors | Ppara | Ppard | Pparg |
---|---|---|---|---|
Dorsal hippocampus | Seizures | F1,25 = 11.9, p = 0.002 | F1,24 = 1.6, p = 0.22 | F1,24 = 0.0, p = 0.99 |
B. longum | F1,25 = 1.3, p = 0.26 | F1,24 = 1.9, p = 0.18 | F1,24 = 1.8, p = 0.19 | |
Interaction | F1,25 = 1.4, p = 0.25 | F1,24 = 0.03, p = 0.86 | F1,24 = 0.08, p = 0.73 | |
Ventral hippocampus | Seizures | F1,22 = 0.5, p = 0.49 | F1,23 = 4.3, p = 0.05 | F1,19 = 6.2, p = 0.020 |
B. longum | F1,22 = 0.04, p = 0.85 | F1,23 = 0.0, p = 0.94 | F1,19 = 13.3, p = 0.002 | |
Interaction | F1,22 = 0.6, p = 0.45 | F1,23 = 0.0, p = 0.95 | F1,19 = 1.7, p = 0.21 | |
Temporal cortex | Seizures | F1,26 = 0.7, p = 0.41 | F1,27 = 0.6, p = 0.45 | F1,25 = 0.1, p = 0.77 |
B. longum | F1,26 = 0.06, p = 0.81 | F1,27 = 0.03, p = 0.86 | F1,25 = 1.8, p = 0.20 | |
Interaction | F1,26 = 2.1, p = 0.16 | F1,27 = 0.35, p = 0.56 | F1,25 = 0.5, p = 0.48 | |
Amygdala | Seizures | F1,25 = 2.1, p = 0.16 | F1,24 = 0.1, p = 0.70 | F1,25 = 0.9, p = 0.36 |
B. longum | F1,25 = 0.06, p = 0.82 | F1,24 = 0.8, p = 0.39 | F1,25 = 2.9, p = 0.10 | |
Interaction | F1,25 = 0.1, p = 0.79 | F1,24 = 3.0, p = 0.10 | F1,25 = 0.8, p = 0.38 |
Indicators | Factors | ||
---|---|---|---|
TLE | B. longum | Interaction | |
Climbing time | F1,65 = 16.30; p < 0.001 | F1,65 = 1.33; p = 0.25 | F1,65 = 0.002; p = 0.96 |
Grooming time | F1,61 = 4.45; p = 0.04 | F1,61 = 0.15; p = 0.69 | F1,61 = 0.12; p = 0.73 |
Rearing, number * | H = 5.2; p = 0.16 | ||
Rearing, time (s) * | H = 2.6; p = 0.46 | ||
Freezing, time (s) * | H = 0.9; p = 0.82 |
Factors | |||
---|---|---|---|
TLE | B. longum | Interaction | |
EPM, time in closed arms | F1,54 = 0.11; p = 0.74 | F1,54 = 10.09; p = 0.30 | F1,54 = 3.24; p = 0.08 |
EPM, time in open arms | F1,54 = 10.77; p = 0.002 | F1,54 = 2.84; p = 0.10 | F1,54 = 1.48; p = 0.23 |
EPM, ratio time in open arms/total time in arms * | H = 14.1; p = 0.003. | ||
FST, time of immobilization, s | F1,29 = 6.46; p = 0.02 | F1,29 = 0.22; p = 0.64 | F1,29 = 0.06; p = 0.81 |
Factors | |||
---|---|---|---|
TLE | B. longum | Interaction | |
Familiar cage | F1,32 = 23.1; p < 0.001 | F1,32 = 2.7; p = 0.11 | F1,32 = 0.9; p = 0.34 |
Novel cage, test 1, time of freezing during adaptation | F1,32 = 4.1; p = 0.051 | F1,32 = 0.9; p = 0.35 | F1,32 = 1.2; p = 0.28 |
Novel cage, test 2, time of freezing during the conditioned stimulus (sound) | F1,32 = 19.5; p < 0.001 | F1,32 = 0.3; p = 0.59 | F1,32 = 0.2; p = 0.89 |
Novel cage, test 3, time of freezing after the conditioned stimulus | F1,33 = 1.9; p = 0.17 | F1,33 = 0.01; p = 0.93 | F1,33 = 0.01; p = 0.96 |
Factors | |||
---|---|---|---|
TLE | B. longum | Interaction | |
Time of communication, s | F1,34 = 6.80; p = 0.01 | F1,34 = 1.42; p = 0.24 | F1,34 = 0.18; p = 0.68 |
Time of self-grooming, s | F1,34 = 13.8; p = 0.001 | F1,34 = 1.35; p = 0.25 | F1,34 = 2.19; p = 0.15 |
Average time of one self-grooming, s | F1,32 = 20.24; p < 0.001 | F1,32 = 1.61; p = 0.21 | F1,32 = 4.33; p = 0.045 |
Number of self-grooming episodes | F1,35 = 0.98; p = 0.32 | F1,35 = 0.10; p = 0.75 | F1,35 = 0.27; p = 0.61 |
Time of aggressive behavior, s * | H = 4.05; p = 0.26 |
Appendix C
Gene Symbol RefSeq Accession Number | Nucleotide Sequences (Forward, Reverse, TaqMan Probe) | Reference |
---|---|---|
Ppara NM_013196.2 | AATCCACGAAGCCTACCTGA GTCTTCTCAGCCATGCACAA FAM-AGGCCCGGGTCATACTCGCAGGAA-BHQ1 | [114] (primers) This work (probe) |
Ppard NM_013141.2 | CAAACCCACGGTAAAGGCGG TGGCTGTTCCATGACTGACC HEX-CCAGGCCTGCAGGCGCCACGCCA-BHQ2 | This work |
Pparg NM_013124.3 | CCTGAAGCTCCAAGAATACC GATGCTTTATCCCCACAGAC HEX-CCCTCATGGCCATCGAGTGCC-BHQ2 | [115] (primers) This work (probe) |
Gfap NM_017009.2 | TGGCCACCAGTAACATGCAA CAGTTGGCGGCGATAGTCAT HEX-CGGTCCAAGTTTGCAGACCTCACAG-BHQ2 | [116] (primers) [60] (probe) |
Il1b NM_031512 | CACCTCTCAAGCAGAGCACAG GGGTTCCATGGTGAAGTCAAC FAM-TGTCCCGACCATTGCTGTTTCCTAG-BHQ1 | [117] |
Aif1 NM_017196.3 | CAACACACTGCAGCCTCATC AAGCTTTTCCTCCCTGCAAA Cy5-CCCCACCTAAGGCCACCAGCGTCTGA-BHQ3 | This work |
Il1rn NM_022194.2 | GGGGACCTTACAGTCACCTAAT GGTTAGTATCCCAGATTCTGAAGG ROX-AGTCAGCTGGCCACCCTGCTGGGA-BHQ2 | This work |
Actb NM_031144 | TGTCACCAACTGGGACGATA GGGGTGTTGAAGGTCTCAAA FAM-CGTGTGGCCCCTGAGGAGCAC-BHQ1 | [118] (primers) [108] (probe) |
Gapdh NM_017008 | TGCACCACCAACTGCTTAG GGATGCAGGGATGATGTTC R6G-ATCACGCCACAGCTTTCCAGAGGG-BHQ2 | [119] |
B2m NM_012512 | TGCCATTCAGAAAACTCCCC GAGGAAGTTGGGCTTCCCATT ROX-ATTCAAGTGTACTCTCGCCATCCACCG-BHQ1 | [120] |
Rpl13a NM_173340 | GGATCCCTCCACCCTATGACA CTGGTACTTCCACCCGACCTC FAM-CTGCCCTCAAGGTTGTGCGGCT-BHQ1 | [121] (primers) [108] (probe) |
Sdha NM_130428 | AGACGTTTGACAGGGGAATG TCATCAATCCGCACCTTGTA R6G-ACCTGGTGGAGACGCTGGAGCT-BHQ2 | [122] (primers) [108] (probe) |
Ppia NM_017101 | AGGATTCATGTGCCAGGGTG CTCAGTCTTGGCAGTGCAGA ROX-CACGCCATAATGGCACTGGTGGCA-BHQ1 | [123] |
Hprt1 NM_012583 | TCCTCAGACCGCTTTTCCCGC TCATCATCACTAATCACGACGCTGG FAM-CCGACCGGTTCTGTCATGTCGACCCT-BHQ1 | [124] (primers) [108] (probe) |
Pgk1 NM_053291 | ATGCAAAGACTGGCCAAGCTAC AGCCACAGCCTCAGCATATTTC R6G-TGCTGGCTGGATGGGCTTGGA-BHQ2 | [125] (primers) [108] (probe) |
Ywhaz NM_013011 | GATGAAGCCATTGCTGAACTTG GTCTCCTTGGGTATCCGATGTC ROX-TGAAGAGTCGTACAAAGACAGCACGC-BHQ1 | [125] (primers) [108] (probe) |
References
- Fiest, K.M.; Sauro, K.M.; Wiebe, S.; Patten, S.B.; Kwon, C.-S.; Dykeman, J.; Pringsheim, T.; Lorenzetti, D.L.; Jetté, N. Prevalence and incidence of epilepsy. Neurology 2017, 88, 296–303. [Google Scholar] [CrossRef]
- Al Sufiani, F.; Ang, L.C. Neuropathology of Temporal Lobe Epilepsy. Epilepsy Res. Treat. 2012, 2012, 624519. [Google Scholar] [CrossRef]
- Vrinda, M.; Arun, S.; Srikumar, B.N.; Kutty, B.M.; Shankaranarayana Rao, B.S. Temporal lobe epilepsy-induced neurodegeneration and cognitive deficits: Implications for aging. J. Chem. Neuroanat. 2019, 95, 146–153. [Google Scholar] [CrossRef]
- Johnson, A.M.; Sugo, E.; Barreto, D.; Hiew, C.-C.; Lawson, J.A.; Connolly, A.M.; Somerville, E.; Hasic, E.; Bye, A.M.; Cunningham, A.M. The Severity of Gliosis in Hippocampal Sclerosis Correlates with Pre-Operative Seizure Burden and Outcome after Temporal Lobectomy. Mol. Neurobiol. 2016, 53, 5446–5456. [Google Scholar] [CrossRef]
- Tramoni-Negre, E.; Lambert, I.; Bartolomei, F.; Felician, O. Long-term memory deficits in temporal lobe epilepsy. Rev. Neurol. 2017, 173, 490–497. [Google Scholar] [CrossRef]
- Rini, J.F.; Ochoa, J. Behavioral implications of temporal lobe epilepsy on social contingency. Epilepsy Behav. 2020, 110, 107101. [Google Scholar] [CrossRef]
- Vinti, V.; Dell’Isola, G.B.; Tascini, G.; Mencaroni, E.; Cara, G.D.; Striano, P.; Verrotti, A. Temporal Lobe Epilepsy and Psychiatric Comorbidity. Front. Neurol. 2021, 12, 2155. [Google Scholar] [CrossRef]
- Fattorusso, A.; Matricardi, S.; Mencaroni, E.; Dell’Isola, G.B.; Di Cara, G.; Striano, P.; Verrotti, A. The Pharmacoresistant Epilepsy: An Overview on Existant and New Emerging Therapies. Front. Neurol. 2021, 12, 1030. [Google Scholar] [CrossRef]
- Walia, K.S.; Khan, E.A.; Ko, D.H.; Raza, S.S.; Khan, Y.N. Side Effects of Antiepileptics—A Review. Pain Pract. 2004, 4, 194–203. [Google Scholar] [CrossRef]
- Löscher, W. The holy grail of epilepsy prevention: Preclinical approaches to antiepileptogenic treatments. Neuropharmacology 2020, 167, 107605. [Google Scholar] [CrossRef]
- Parashar, A.; Udayabanu, M. Gut microbiota: Implications in Parkinson’s disease. Parkinsonism Relat. Disord. 2017, 38, 1–7. [Google Scholar] [CrossRef]
- Mangiola, F. Gut microbiota in autism and mood disorders. World J. Gastroenterol. 2016, 22, 361. [Google Scholar] [CrossRef]
- Limbana, T.; Khan, F.; Eskander, N. Gut Microbiome and Depression: How Microbes Affect the Way We Think. Cureus 2020, 12, e9966. [Google Scholar] [CrossRef]
- Mörkl, S.; Butler, M.I.; Holl, A.; Cryan, J.F.; Dinan, T.G. Probiotics and the Microbiota-Gut-Brain Axis: Focus on Psychiatry. Curr. Nutr. Rep. 2020, 9, 171–182. [Google Scholar] [CrossRef]
- Shaikh, M.F.; Lee, C.Y.; Chen, W.N.; Shaikh, F.A. The Gut-Brain-Axis on the Manifestation of Depressive Symptoms in Epilepsy: An Evidence-Driven Hypothesis. Front. Pharmacol. 2020, 11, 465. [Google Scholar] [CrossRef]
- Iannone, L.F.; Preda, A.; Blottière, H.M.; Clarke, G.; Albani, D.; Belcastro, V.; Carotenuto, M.; Cattaneo, A.; Citraro, R.; Ferraris, C.; et al. Microbiota-gut brain axis involvement in neuropsychiatric disorders. Expert Rev. Neurother. 2019, 19, 1037–1050. [Google Scholar] [CrossRef]
- Yue, Q.; Cai, M.; Xiao, B.; Zhan, Q.; Zeng, C. The Microbiota–Gut–Brain Axis and Epilepsy. Cell. Mol. Neurobiol. 2022, 42, 439–453. [Google Scholar] [CrossRef]
- De Caro, C.; Iannone, L.F.; Citraro, R.; Striano, P.; De Sarro, G.; Constanti, A.; Cryan, J.F.; Russo, E. Can we ‘seize’ the gut microbiota to treat epilepsy? Neurosci. Biobehav. Rev. 2019, 107, 750–764. [Google Scholar] [CrossRef]
- Chen, C.-H.; Lin, C.-L.; Kao, C.-H. Irritable Bowel Syndrome Increases the Risk of Epilepsy. Medicine 2015, 94, e1497. [Google Scholar] [CrossRef]
- Pittayanon, R.; Lau, J.T.; Yuan, Y.; Leontiadis, G.I.; Tse, F.; Surette, M.; Moayyedi, P. Gut Microbiota in Patients with Irritable Bowel Syndrome—A Systematic Review. Gastroenterology 2019, 157, 97–108. [Google Scholar] [CrossRef]
- Holmes, M.; Flaminio, Z.; Vardhan, M.; Xu, F.; Li, X.; Devinsky, O.; Saxena, D. Cross talk between drug-resistant epilepsy and the gut microbiome. Epilepsia 2020, 61, 2619–2628. [Google Scholar] [CrossRef]
- Gong, X.; Liu, X.; Chen, C.; Lin, J.; Li, A.; Guo, K.; An, D.; Zhou, D.; Hong, Z. Alteration of Gut Microbiota in Patients with Epilepsy and the Potential Index as a Biomarker. Front. Microbiol. 2020, 11, 517797. [Google Scholar] [CrossRef]
- Peng, A.; Qiu, X.; Lai, W.; Li, W.; Zhang, L.; Zhu, X.; He, S.; Duan, J.; Chen, L. Altered composition of the gut microbiome in patients with drug-resistant epilepsy. Epilepsy Res. 2018, 147, 102–107. [Google Scholar] [CrossRef]
- Xie, G.; Zhou, Q.; Qiu, C.-Z.; Dai, W.-K.; Wang, H.-P.; Li, Y.-H.; Liao, J.-X.; Lu, X.-G.; Lin, S.-F.; Ye, J.-H.; et al. Ketogenic diet poses a significant effect on imbalanced gut microbiota in infants with refractory epilepsy. World J. Gastroenterol. 2017, 23, 6164–6171. [Google Scholar] [CrossRef]
- Huang, C.; Li, Y.; Feng, X.; Li, D.; Li, X.; Ouyang, Q.; Dai, W.; Wu, G.; Zhou, Q.; Wang, P.; et al. Distinct Gut Microbiota Composition and Functional Category in Children with Cerebral Palsy and Epilepsy. Front. Pediatr. 2019, 7, 394. [Google Scholar] [CrossRef]
- Lee, K.; Kim, N.; Shim, J.O.; Kim, G.-H. Gut Bacterial Dysbiosis in Children with Intractable Epilepsy. J. Clin. Med. 2020, 10, 5. [Google Scholar] [CrossRef]
- Şafak, B.; Altunan, B.; Topçu, B.; Eren Topkaya, A. The gut microbiome in epilepsy. Microb. Pathog. 2020, 139, 103853. [Google Scholar] [CrossRef]
- Gómez-Eguílaz, M.; Ramón-Trapero, J.L.; Pérez-Martínez, L.; Blanco, J.R. The beneficial effect of probiotics as a supplementary treatment in drug-resistant epilepsy: A pilot study. Benef. Microbes 2018, 9, 875–881. [Google Scholar] [CrossRef]
- Socała, K.; Doboszewska, U.; Szopa, A.; Serefko, A.; Włodarczyk, M.; Zielińska, A.; Poleszak, E.; Fichna, J.; Wlaź, P. The role of microbiota-gut-brain axis in neuropsychiatric and neurological disorders. Pharmacol. Res. 2021, 172, 105840. [Google Scholar] [CrossRef]
- Hingray, C.; McGonigal, A.; Kotwas, I.; Micoulaud-Franchi, J.-A. The Relationship between Epilepsy and Anxiety Disorders. Curr. Psychiatry Rep. 2019, 21, 40. [Google Scholar] [CrossRef]
- Bagheri, S.; Heydari, A.; Alinaghipour, A.; Salami, M. Effect of probiotic supplementation on seizure activity and cognitive performance in PTZ-induced chemical kindling. Epilepsy Behav. 2019, 95, 43–50. [Google Scholar] [CrossRef]
- Tahmasebi, S.; Oryan, S.; Mohajerani, H.R.; Akbari, N.; Palizvan, M.R. Probiotics and Nigella sativa extract supplementation improved behavioral and electrophysiological effects of PTZ-induced chemical kindling in rats. Epilepsy Behav. 2020, 104, 106897. [Google Scholar] [CrossRef]
- Aygun, H.; Akin, A.T.; Kızılaslan, N.; Sumbul, O.; Karabulut, D. Probiotic supplementation alleviates absence seizures and anxiety- and depression-like behavior in WAG/Rij rat by increasing neurotrophic factors and decreasing proinflammatory cytokines. Epilepsy Behav. 2022, 128, 108588. [Google Scholar] [CrossRef]
- Yu, L.W.; Agirman, G.; Hsiao, E.Y. The Gut Microbiome as a Regulator of the Neuroimmune Landscape. Annu. Rev. Immunol. 2022, 40, 143–167. [Google Scholar] [CrossRef]
- Pracucci, E.; Pillai, V.; Lamers, D.; Parra, R.; Landi, S. Neuroinflammation: A Signature or a Cause of Epilepsy? Int. J. Mol. Sci. 2021, 22, 6981. [Google Scholar] [CrossRef]
- Rana, A.; Musto, A.E. The role of inflammation in the development of epilepsy. J. Neuroinflamm. 2018, 15, 144. [Google Scholar]
- Mendiola, A.S.; Cardona, A.E. The IL-1β phenomena in neuroinflammatory diseases. J. Neural Transm. 2018, 125, 781–795. [Google Scholar] [CrossRef]
- Soltani Khaboushan, A.; Yazdanpanah, N.; Rezaei, N. Neuroinflammation and Proinflammatory Cytokines in Epileptogenesis. Mol. Neurobiol. 2022, 59, 1724–1743. [Google Scholar] [CrossRef]
- Hutchinson, P.J.; O’Connell, M.T.; Rothwell, N.J.; Hopkins, S.J.; Nortje, J.; Carpenter, K.L.H.; Timofeev, I.; Al-Rawi, P.G.; Menon, D.K.; Pickard, J.D. Inflammation in Human Brain Injury: Intracerebral Concentrations of IL-1 α, IL-1 β, and Their Endogenous Inhibitor IL-1ra. J. Neurotrauma 2007, 24, 1545–1557. [Google Scholar] [CrossRef]
- Vezzani, A.; Moneta, D.; Richichi, C.; Aliprandi, M.; Burrows, S.J.; Ravizza, T.; Perego, C.; De Simoni, M.G. Functional Role of Inflammatory Cytokines and Antiinflammatory Molecules in Seizures and Epileptogenesis. Epilepsia 2002, 43, 30–35. [Google Scholar] [CrossRef]
- Frank, M.G.; Fonken, L.K.; Watkins, L.R.; Maier, S.F.; Lowry, C.A. Could Probiotics Be Used to Mitigate Neuroinflammation? ACS Chem. Neurosci. 2019, 10, 13–15. [Google Scholar] [CrossRef]
- Zolezzi, J.M.; Santos, M.J.; Bastías-Candia, S.; Pinto, C.; Godoy, J.A.; Inestrosa, N.C. PPARs in the central nervous system: Roles in neurodegeneration and neuroinflammation. Biol. Rev. 2017, 92, 2046–2069. [Google Scholar] [CrossRef]
- Hong, F.; Pan, S.; Guo, Y.; Xu, P.; Zhai, Y. PPARs as Nuclear Receptors for Nutrient and Energy Metabolism. Molecules 2019, 24, 2545. [Google Scholar] [CrossRef]
- Zubareva, O.E.; Melik-Kasumov, T.B. The Gut–Brain Axis and Peroxisome Proliferator-Activated Receptors in the Regulation of Epileptogenesis. J. Evol. Biochem. Physiol. 2021, 57, 743–760. [Google Scholar] [CrossRef]
- Di Paola, M.; Bonechi, E.; Provensi, G.; Costa, A.; Clarke, G.; Ballerini, C.; De Filippo, C.; Passani, M.B. Oleoylethanolamide treatment affects gut microbiota composition and the expression of intestinal cytokines in Peyer’s patches of mice. Sci. Rep. 2018, 8, 14881. [Google Scholar] [CrossRef]
- Kim, S.; Park, S.; Choi, T.G.; Kim, S.S. Role of Short Chain Fatty Acids in Epilepsy and Potential Benefits of Probiotics and Prebiotics: Targeting “Health” of Epileptic Patients. Nutrients 2022, 14, 2982. [Google Scholar] [CrossRef]
- Wang, X.; Ma, R.; Liu, X.; Zhang, Y. Effects of long-term supplementation of probiotics on cognitive function and emotion in temporal lobe epilepsy. Front. Neurol. 2022, 13, 1575. [Google Scholar] [CrossRef]
- Allen, A.P.; Hutch, W.; Borre, Y.E.; Kennedy, P.J.; Temko, A.; Boylan, G.; Murphy, E.; Cryan, J.F.; Dinan, T.G.; Clarke, G. Bifidobacterium longum 1714 as a translational psychobiotic: Modulation of stress, electrophysiology and neurocognition in healthy volunteers. Transl. Psychiatry 2016, 6, e939. [Google Scholar] [CrossRef]
- Curia, G.; Longo, D.; Biagini, G.; Jones, R.S.G.; Avoli, M. The pilocarpine model of temporal lobe epilepsy. J. Neurosci. Methods 2008, 172, 143–157. [Google Scholar] [CrossRef]
- Plata, A.; Lebedeva, A.; Denisov, P.; Nosova, O.; Postnikova, T.Y.; Pimashkin, A.; Brazhe, A.; Zaitsev, A.V.; Rusakov, D.A.; Semyanov, A. Astrocytic Atrophy Following Status Epilepticus Parallels Reduced Ca2+ Activity and Impaired Synaptic Plasticity in the Rat Hippocampus. Front. Mol. Neurosci. 2018, 11, 215. [Google Scholar] [CrossRef]
- Kong, Q.; Chen, Q.; Mao, X.; Wang, G.; Zhao, J.; Zhang, H.; Chen, W. Bifidobacterium longum CCFM1077 Ameliorated Neurotransmitter Disorder and Neuroinflammation Closely Linked to Regulation in the Kynurenine Pathway of Autistic-like Rats. Nutrients 2022, 14, 1615. [Google Scholar] [CrossRef]
- Chakir, A.; Fabene, P.F.; Ouazzani, R.; Bentivoglio, M. Drug resistance and hippocampal damage after delayed treatment of pilocarpine-induced epilepsy in the rat. Brain Res. Bull. 2006, 71, 127–138. [Google Scholar] [CrossRef]
- Postnikova, T.Y.; Diespirov, G.P.; Amakhin, D.V.; Vylekzhanina, E.N.; Soboleva, E.B.; Zaitsev, A.V. Impairments of Long-Term Synaptic Plasticity in the Hippocampus of Young Rats during the Latent Phase of the Lithium-Pilocarpine Model of Temporal Lobe Epilepsy. Int. J. Mol. Sci. 2021, 22, 13355. [Google Scholar] [CrossRef]
- Borges, K. Neuronal and glial pathological changes during epileptogenesis in the mouse pilocarpine model. Exp. Neurol. 2003, 182, 21–34. [Google Scholar] [CrossRef]
- Borges, K.; McDermott, D.; Irier, H.; Smith, Y.; Dingledine, R. Degeneration and proliferation of astrocytes in the mouse dentate gyrus after pilocarpine-induced status epilepticus. Exp. Neurol. 2006, 201, 416–427. [Google Scholar] [CrossRef]
- Eid, T.; Lee, T.S.W.; Patrylo, P.; Zaveri, H.P. Astrocytes and Glutamine Synthetase in Epileptogenesis. J. Neurosci. Res. 2019, 97, 1345–1362. [Google Scholar] [CrossRef]
- Victor, T.R.; Tsirka, S.E. Microglial contributions to aberrant neurogenesis and pathophysiology of epilepsy. Neuroimmunol. Neuroinflamm. 2020, 7, 234. [Google Scholar] [CrossRef]
- Zaitsev, А.V.; Amakhin, D.V.; Dyomina, A.V.; Zakharova, M.V.; Ergina, J.L.; Postnikova, T.Y.; Diespirov, G.P.; Magazanik, L.G. Synaptic Dysfunction in Epilepsy. J. Evol. Biochem. Physiol. 2021, 57, 542–563. [Google Scholar] [CrossRef]
- Smolensky, I.V.; Zubareva, O.E.; Kalemenev, S.V.; Lavrentyeva, V.V.; Dyomina, A.V.; Karepanov, A.A.; Zaitsev, A.V. Impairments in cognitive functions and emotional and social behaviors in a rat lithium-pilocarpine model of temporal lobe epilepsy. Behav. Brain Res. 2019, 372, 112044. [Google Scholar] [CrossRef]
- Dyomina, A.V.; Zubareva, O.E.; Smolensky, I.V.; Vasilev, D.S.; Zakharova, M.V.; Kovalenko, A.A.; Schwarz, A.P.; Ischenko, A.M.; Zaitsev, A.V. Anakinra Reduces Epileptogenesis, Provides Neuroprotection, and Attenuates Behavioral Impairments in Rats in the Lithium–Pilocarpine Model of Epilepsy. Pharmaceuticals 2020, 13, 340. [Google Scholar] [CrossRef]
- Kalueff, A.V.; Stewart, A.M.; Song, C.; Berridge, K.C.; Graybiel, A.M.; Fentress, J.C. Neurobiology of rodent self-grooming and its value for translational neuroscience. Nat. Rev. Neurosci. 2016, 17, 45–59. [Google Scholar] [CrossRef]
- Ma, T.; Jin, H.; Kwok, L.-Y.; Sun, Z.; Liong, M.-T.; Zhang, H. Probiotic consumption relieved human stress and anxiety symptoms possibly via modulating the neuroactive potential of the gut microbiota. Neurobiol. Stress 2021, 14, 100294. [Google Scholar] [CrossRef]
- Wang, H.; Lee, I.-S.; Braun, C.; Enck, P. Effect of Probiotics on Central Nervous System Functions in Animals and Humans: A Systematic Review. J. Neurogastroenterol. Motil. 2016, 22, 589–605. [Google Scholar] [CrossRef]
- Garrido, D.; Ruiz-Moyano, S.; Jimenez-Espinoza, R.; Eom, H.-J.; Block, D.E.; Mills, D.A. Utilization of galactooligosaccharides by Bifidobacterium longum subsp. infantis isolates. Food Microbiol. 2013, 33, 262–270. [Google Scholar] [CrossRef]
- Li, Y.; Wang, S.; Sun, Y.; Zheng, H.; Tang, Y.; Gao, X.; Song, C.; Liu, J.; Long, Y.; Liu, L.; et al. Apple polysaccharide could promote the growth of Bifidobacterium longum. Int. J. Biol. Macromol. 2020, 152, 1186–1193. [Google Scholar] [CrossRef]
- Chaskiel, L.; Bristow, A.D.; Bluthé, R.-M.; Dantzer, R.; Blomqvist, A.; Konsman, J.P. Interleukin-1 reduces food intake and body weight in rat by acting in the arcuate hypothalamus. Brain. Behav. Immun. 2019, 81, 560–573. [Google Scholar] [CrossRef]
- Zubareva, O.E.; Krasnova, I.N.; Abdurasulova, I.N.; Bluthe, R.-M.; Dantzer, R.; Klimenko, V.M. Effects of serotonin synthesis blockade on interleukin-1β action in the brain of rats. Brain Res. 2001, 915, 244–247. [Google Scholar] [CrossRef]
- Takao, T.; Tracey, D.E.; Mark Mitchell, W.; de Souza, E.B. Interleukin-1 receptors in mouse brain: Characterization and neuronal localization. Endocrinology 1990, 127, 3070–3078. [Google Scholar] [CrossRef]
- Basu, A.; Krady, J.K.; Levison, S.W. Interleukin-1: A master regulator of neuroinflammation. J. Neurosci. Res. 2004, 78, 151–156. [Google Scholar] [CrossRef]
- Shimada, T.; Takemiya, T.; Sugiura, H.; Yamagata, K. Role of Inflammatory Mediators in the Pathogenesis of Epilepsy. Mediators Inflamm. 2014, 2014, 901902. [Google Scholar] [CrossRef]
- Vezzani, A.; Balosso, S.; Ravizza, T. The role of cytokines in the pathophysiology of epilepsy. Brain. Behav. Immun. 2008, 22, 797–803. [Google Scholar] [CrossRef]
- Underwood, M.A.; Arriola, J.; Gerber, C.W.; Kaveti, A.; Kalanetra, K.M.; Kananurak, A.; Bevins, C.L.; Mills, D.A.; Dvorak, B. Bifidobacterium longum subsp. infantis in experimental necrotizing enterocolitis: Alterations in inflammation, innate immune response, and the microbiota. Pediatr. Res. 2014, 76, 326–333. [Google Scholar] [CrossRef]
- Abrantes, F.A.; Nascimento, B.B.; Andrade, M.E.R.; de Barros, P.A.V.; Cartelle, C.T.; Martins, F.S.; Nicoli, J.R.; Arantes, R.M.E.; Generoso, S.V.; Fernandes, S.O.A.; et al. Treatment with Bifidobacterium longum 5 1A attenuates intestinal damage and inflammatory response in experimental colitis. Benef. Microbes 2020, 11, 47–57. [Google Scholar] [CrossRef]
- Mohammadi, G.; Dargahi, L.; Peymani, A.; Mirzanejad, Y.; Alizadeh, S.A.; Naserpour, T.; Nassiri-Asl, M. The Effects of Probiotic Formulation Pretreatment (Lactobacillus helveticus R0052 and Bifidobacterium longum R0175) on a Lipopolysaccharide Rat Model. J. Am. Coll. Nutr. 2019, 38, 209–217. [Google Scholar] [CrossRef]
- Kim, H.; Kim, S.; Park, S.; Park, G.; Shin, H.; Park, M.S.; Kim, J. Administration of Bifidobacterium bifidum BGN4 and Bifidobacterium longum BORI Improves Cognitive and Memory Function in the Mouse Model of Alzheimer’s Disease. Front. Aging Neurosci. 2021, 13, 709091. [Google Scholar] [CrossRef]
- Grygiel-Górniak, B. Peroxisome proliferator-activated receptors and their ligands: Nutritional and clinical implications—A review. Nutr. J. 2014, 13, 17. [Google Scholar] [CrossRef]
- Gervois, P.; Torra, I.P.; Fruchart, J.-C.; Staels, B. Regulation of Lipid and Lipoprotein Metabolism by PPAR Activators. Clin. Chem. Lab. Med. 2000, 38, 3–11. [Google Scholar] [CrossRef]
- Kim, D.; Lee, K.R.; Kim, N.R.; Park, S.-J.; Lee, M.; Kim, O.-K. Combination of Bifidobacterium longum and Galacto-Oligosaccharide Protects the Skin from Photoaging. J. Med. Food 2021, 24, 606–616. [Google Scholar] [CrossRef]
- Saha, L.; Bhandari, S.; Bhatia, A.; Banerjee, D.; Chakrabarti, A. Anti-kindling Effect of Bezafibrate, a Peroxisome Proliferator-activated Receptors Alpha Agonist, in Pentylenetetrazole Induced Kindling Seizure Model. J. Epilepsy Res. 2014, 4, 45–54. [Google Scholar] [CrossRef]
- Porta, N.; Vallée, L.; Lecointe, C.; Bouchaert, E.; Staels, B.; Bordet, R.; Auvin, S. Fenofibrate, a peroxisome proliferator-activated receptor-α agonist, exerts anticonvulsive properties. Epilepsia 2009, 50, 943–948. [Google Scholar] [CrossRef]
- Adabi Mohazab, R.; Javadi-Paydar, M.; Delfan, B.; Dehpour, A.R. Possible involvement of PPAR-gamma receptor and nitric oxide pathway in the anticonvulsant effect of acute pioglitazone on pentylenetetrazole-induced seizures in mice. Epilepsy Res. 2012, 101, 28–35. [Google Scholar] [CrossRef]
- Sun, H.; Huang, Y.; Yu, X.; Li, Y.; Yang, J.; Li, R.; Deng, Y.; Zhao, G. Peroxisome proliferator-activated receptor gamma agonist, rosiglitazone, suppresses CD40 expression and attenuates inflammatory responses after lithium pilocarpine-induced status epilepticus in rats. Int. J. Dev. Neurosci. 2008, 26, 505–515. [Google Scholar] [CrossRef]
- Yu, X.; Shao, X.-G.; Sun, H.; Li, Y.-N.; Yang, J.; Deng, Y.-C.; Huang, Y.-G. Activation of cerebral peroxisome proliferator-activated receptors gamma exerts neuroprotection by inhibiting oxidative stress following pilocarpine-induced status epilepticus. Brain Res. 2008, 1200, 146–158. [Google Scholar] [CrossRef]
- Peng, J.; Wang, K.; Xiang, W.; Li, Y.; Hao, Y.; Guan, Y. Rosiglitazone polarizes microglia and protects against pilocarpine-induced status epilepticus. CNS Neurosci. Ther. 2019, 25, 1363–1372. [Google Scholar] [CrossRef]
- Wong, S.-B.; Cheng, S.-J.; Hung, W.-C.; Lee, W.-T.; Min, M.-Y. Rosiglitazone Suppresses In Vitro Seizures in Hippocampal Slice by Inhibiting Presynaptic Glutamate Release in a Model of Temporal Lobe Epilepsy. PLoS ONE 2015, 10, e0144806. [Google Scholar] [CrossRef]
- Simeone, T.A.; Matthews, S.A.; Samson, K.K.; Simeone, K.A. Regulation of brain PPARgamma2 contributes to ketogenic diet anti-seizure efficacy. Exp. Neurol. 2017, 287, 54–64. [Google Scholar] [CrossRef]
- Toscano, E.C.d.B.; Vieira, É.L.M.; Portela, A.C.D.C.; Caliari, M.V.; Brant, J.A.S.; Giannetti, A.V.; Suemoto, C.K.; Leite, R.E.P.; Nitrini, R.; Rachid, M.A.; et al. Microgliosis is associated with visual memory decline in patients with temporal lobe epilepsy and hippocampal sclerosis: A clinicopathologic study. Epilepsy Behav. 2020, 102, 106643. [Google Scholar] [CrossRef]
- Sharma, A.K.; Jordan, W.H.; Reams, R.Y.; Hall, D.G.; Snyder, P.W. Temporal Profile of Clinical Signs and Histopathologic Changes in an F-344 Rat Model of Kainic Acid–induced Mesial Temporal Lobe Epilepsy. Toxicol. Pathol. 2008, 36, 932–943. [Google Scholar] [CrossRef]
- Kim, J.-E.; Choi, H.-C.; Song, H.-K.; Jo, S.-M.; Kim, D.-S.; Choi, S.-Y.; Kim, Y.-I.; Kang, T.-C. Levetiracetam inhibits interleukin-1β inflammatory responses in the hippocampus and piriform cortex of epileptic rats. Neurosci. Lett. 2010, 471, 94–99. [Google Scholar] [CrossRef]
- Puttachary, S.; Sharma, S.; Verma, S.; Yang, Y.; Putra, M.; Thippeswamy, A.; Luo, D.; Thippeswamy, T. 1400W, a highly selective inducible nitric oxide synthase inhibitor is a potential disease modifier in the rat kainate model of temporal lobe epilepsy. Neurobiol. Dis. 2016, 93, 184–200. [Google Scholar] [CrossRef]
- Orihuela, R.; McPherson, C.A.; Harry, G.J. Microglial M1/M2 polarization and metabolic states. Br. J. Pharmacol. 2016, 173, 649–665. [Google Scholar] [CrossRef]
- Guo, S.; Wang, H.; Yin, Y. Microglia Polarization from M1 to M2 in Neurodegenerative Diseases. Front. Aging Neurosci. 2022, 14, 75. [Google Scholar] [CrossRef]
- Fan, Y.-Y.; Huo, J. A1/A2 astrocytes in central nervous system injuries and diseases: Angels or devils? Neurochem. Int. 2021, 148, 105080. [Google Scholar] [CrossRef]
- Liu, J.-T.; Wu, S.-X.; Zhang, H.; Kuang, F. Inhibition of MyD88 Signaling Skews Microglia/Macrophage Polarization and Attenuates Neuronal Apoptosis in the Hippocampus After Status Epilepticus in Mice. Neurotherapeutics 2018, 15, 1093–1111. [Google Scholar] [CrossRef]
- Messaoudi, M.; Lalonde, R.; Violle, N.; Javelot, H.; Desor, D.; Nejdi, A.; Bisson, J.-F.; Rougeot, C.; Pichelin, M.; Cazaubiel, M.; et al. Assessment of psychotropic-like properties of a probiotic formulation (Lactobacillus helveticus R0052 and Bifidobacterium longum R0175) in rats and human subjects. Br. J. Nutr. 2011, 105, 755–764. [Google Scholar] [CrossRef]
- Savignac, H.M.; Kiely, B.; Dinan, T.G.; Cryan, J.F. Bifidobacteria exert strain-specific effects on stress-related behavior and physiology in BALB/c mice. Neurogastroenterol. Motil. 2014, 26, 1615–1627. [Google Scholar] [CrossRef]
- Hu, P.; Lu, Y.; Pan, B.-X.; Zhang, W.-H. New Insights into the Pivotal Role of the Amygdala in Inflammation-Related Depression and Anxiety Disorder. Int. J. Mol. Sci. 2022, 23, 11076. [Google Scholar] [CrossRef]
- Tian, P.; O’Riordan, K.J.; Lee, Y.; Wang, G.; Zhao, J.; Zhang, H.; Cryan, J.F.; Chen, W. Towards a psychobiotic therapy for depression: Bifidobacterium breve CCFM1025 reverses chronic stress-induced depressive symptoms and gut microbial abnormalities in mice. Neurobiol. Stress 2020, 12, 100216. [Google Scholar] [CrossRef]
- Bercik, P.; Park, A.J.; Sinclair, D.; Khoshdel, A.; Lu, J.; Huang, X.; Deng, Y.; Blennerhassett, P.A.; Fahnestock, M.; Moine, D.; et al. The anxiolytic effect of Bifidobacterium longum NCC3001 involves vagal pathways for gut-brain communication. Neurogastroenterol. Motil. 2011, 23, 1132–1139. [Google Scholar] [CrossRef]
- Graham, B.M.; Daher, M. Estradiol and Progesterone have Opposing Roles in the Regulation of Fear Extinction in Female Rats. Neuropsychopharmacology 2016, 41, 774–780. [Google Scholar] [CrossRef]
- Galeeva, A.Y.; Tuohimaa, P.; Shalyapina, V.G. The role of sex steroids in forming anxiety states in female mice. Neurosci. Behav. Physiol. 2003, 33, 415–420. [Google Scholar] [CrossRef]
- Arakawa, K.; Arakawa, H.; Hueston, C.M.; Deak, T. Effects of the Estrous Cycle and Ovarian Hormones on Central Expression of Interleukin-1 Evoked by Stress in Female Rats. Neuroendocrinology 2014, 100, 162–177. [Google Scholar] [CrossRef]
- Kovalenko, A.A.; Zakharova, M.V.; Schwarz, A.P.; Dyomina, A.V.; Zubareva, O.E.; Zaitsev, A.V. Changes in Metabotropic Glutamate Receptor Gene Expression in Rat Brain in a Lithium–Pilocarpine Model of Temporal Lobe Epilepsy. Int. J. Mol. Sci. 2022, 23, 2752. [Google Scholar] [CrossRef]
- Zubareva, O.E.; Kovalenko, A.A.A.; Kalemenev, S.V.; Schwarz, A.P.; Karyakin, V.B.; Zaitsev, A.V. Alterations in mRNA expression of glutamate receptor subunits and excitatory amino acid transporters following pilocarpine-induced seizures in rats. Neurosci. Lett. 2018, 686, 94–100. [Google Scholar] [CrossRef]
- Racine, R.J. Modification of seizure activity by electrical stimulation. II. Motor seizure. Electroencephalogr. Clin. Neurophysiol. 1972, 32, 281–294. [Google Scholar] [CrossRef]
- Paxinos, G.; Watson, C. The Rat Brain in Stereotaxic Coordinates, 6th ed.; Elsevier Academic Press: London, UK, 2007; Volume 170, ISBN 9780125476126. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Schwarz, A.P.; Malygina, D.A.; Kovalenko, A.A.; Trofimov, A.N.; Zaitsev, A.V. Multiplex qPCR assay for assessment of reference gene expression stability in rat tissues/samples. Mol. Cell. Probes 2020, 53, 101611. [Google Scholar] [CrossRef]
- Bercik, P.; Verdu, E.F.; Foster, J.A.; Macri, J.; Potter, M.; Huang, X.; Malinowski, P.; Jackson, W.; Blennerhassett, P.; Neufeld, K.A.; et al. Chronic Gastrointestinal Inflammation Induces Anxiety-like Behavior and Alters Central Nervous System Biochemistry in Mice. Gastroenterology 2010, 139, 2102–2112.e1. [Google Scholar] [CrossRef]
- Walsh, R.N.; Cummins, R.A. The open-field test: A critical review. Psychol. Bull. 1976, 83, 482–504. [Google Scholar] [CrossRef]
- Pellow, S.; Chopin, P.; File, S.E.; Briley, M. Validation of open: Closed arm entries in an elevated plus-maze as a measure of anxiety in the rat. J. Neurosci. Methods 1985, 14, 149–167. [Google Scholar] [CrossRef]
- File, S.E.; Hyde, J.R. Can social interaction be used to measure anxiety? Br. J. Pharmacol. 1978, 62, 19–24. [Google Scholar] [CrossRef]
- Bogdanova, O.V.; Kanekar, S.; D’Anci, K.E.; Renshaw, P.F. Factors influencing behavior in the forced swim test. Physiol. Behav. 2013, 118, 227–239. [Google Scholar] [CrossRef]
- Cernecka, H.; Doka, G.; Srankova, J.; Pivackova, L.; Malikova, E.; Galkova, K.; Kyselovic, J.; Krenek, P.; Klimas, J. Ramipril restores PPARβ/δ and PPARγ expressions and reduces cardiac NADPH oxidase but fails to restore cardiac function and accompanied myosin heavy chain ratio shift in severe anthracycline-induced cardiomyopathy in rat. Eur. J. Pharmacol. 2016, 791, 244–253. [Google Scholar] [CrossRef]
- Chistyakov, D.V.; Aleshin, S.E.; Astakhova, A.A.; Sergeeva, M.G.; Reiser, G. Regulation of peroxisome proliferator-activated receptors (PPAR) α and -γ of rat brain astrocytes in the course of activation by toll-like receptor agonists. J. Neurochem. 2015, 134, 113–124. [Google Scholar] [CrossRef]
- Raghavendra, V.; Tanga, F.Y.; DeLeo, J.A. Attenuation of Morphine Tolerance, Withdrawal-Induced Hyperalgesia, and Associated Spinal Inflammatory Immune Responses by Propentofylline in Rats. Neuropsychopharmacology 2004, 29, 327–334. [Google Scholar] [CrossRef]
- Rioja, I.; Bush, K.A.; Buckton, J.B.; Dickson, M.C.; Life, P.F. Joint cytokine quantification in two rodent arthritis models: Kinetics of expression, correlation of mRNA and protein levels and response to prednisolone treatment. Clin. Exp. Immunol. 2004, 137, 65–73. [Google Scholar] [CrossRef]
- Bonefeld, B.E.; Elfving, B.; Wegener, G. Reference genes for normalization: A study of rat brain tissue. Synapse 2008, 62, 302–309. [Google Scholar] [CrossRef]
- Lin, W.; Burks, C.A.; Hansen, D.R.; Kinnamon, S.C.; Gilbertson, T.A. Taste receptor cells express pH-sensitive leak K+ channels. J. Neurophysiol. 2004, 92, 2909–2919. [Google Scholar] [CrossRef]
- Yamaguchi, M.; Yamauchi, A.; Nishimura, M.; Ueda, N.; Naito, S. Soybean oil fat emulsion prevents cytochrome P450 mRNA down-regulation induced by fat-free overdose total parenteral nutrition in infant rats. Biol. Pharm. Bull. 2005, 28, 143–147. [Google Scholar] [CrossRef]
- Swijsen, A.; Nelissen, K.; Janssen, D.; Rigo, J.M.; Hoogland, G. Validation of reference genes for quantitative real-time PCR studies in the dentate gyrus after experimental febrile seizures. BMC Res. Notes 2012, 5, 685. [Google Scholar] [CrossRef]
- Pohjanvirta, R.; Niittynen, M.; Lindén, J.; Boutros, P.C.; Moffat, I.D.; Okey, A.B. Evaluation of various housekeeping genes for their applicability for normalization of mRNA expression in dioxin-treated rats. Chem. Biol. Interact. 2006, 160, 134–149. [Google Scholar] [CrossRef]
- Malkin, S.L.; Amakhin, D.V.; Veniaminova, E.A.; Kim, K.K.; Zubareva, O.E.; Magazanik, L.G.; Zaitsev, A.V. Changes of AMPA receptor properties in the neocortex and hippocampus following pilocarpine-induced status epilepticus in rats. Neuroscience 2016, 327, 146–155. [Google Scholar] [CrossRef]
- Cook, N.L.; Vink, R.; Donkin, J.J.; van den Heuvel, C. Validation of reference genes for normalization of real-time quantitative RT-PCR data in traumatic brain injury. J. Neurosci. Res. 2009, 87, 34–41. [Google Scholar] [CrossRef]
- Langnaese, K.; John, R.; Schweizer, H.; Ebmeyer, U.; Keilhoff, G. Selection of reference genes for quantitative real-time PCR in a rat asphyxial cardiac arrest model. BMC Mol. Biol. 2008, 9, 53. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zubareva, O.E.; Dyomina, A.V.; Kovalenko, A.A.; Roginskaya, A.I.; Melik-Kasumov, T.B.; Korneeva, M.A.; Chuprina, A.V.; Zhabinskaya, A.A.; Kolyhan, S.A.; Zakharova, M.V.; et al. Beneficial Effects of Probiotic Bifidobacterium longum in a Lithium–Pilocarpine Model of Temporal Lobe Epilepsy in Rats. Int. J. Mol. Sci. 2023, 24, 8451. https://doi.org/10.3390/ijms24098451
Zubareva OE, Dyomina AV, Kovalenko AA, Roginskaya AI, Melik-Kasumov TB, Korneeva MA, Chuprina AV, Zhabinskaya AA, Kolyhan SA, Zakharova MV, et al. Beneficial Effects of Probiotic Bifidobacterium longum in a Lithium–Pilocarpine Model of Temporal Lobe Epilepsy in Rats. International Journal of Molecular Sciences. 2023; 24(9):8451. https://doi.org/10.3390/ijms24098451
Chicago/Turabian StyleZubareva, Olga E., Alexandra V. Dyomina, Anna A. Kovalenko, Anna I. Roginskaya, Tigran B. Melik-Kasumov, Marina A. Korneeva, Alesya V. Chuprina, Alesya A. Zhabinskaya, Stepan A. Kolyhan, Maria V. Zakharova, and et al. 2023. "Beneficial Effects of Probiotic Bifidobacterium longum in a Lithium–Pilocarpine Model of Temporal Lobe Epilepsy in Rats" International Journal of Molecular Sciences 24, no. 9: 8451. https://doi.org/10.3390/ijms24098451