Molecular Identification and Acid Stress Response of an Acidithiobacillus thiooxidans Strain Isolated from Rio Tinto (Spain)
Abstract
1. Introduction
2. Results
2.1. Isolation and Identification of A. thiooxidans Lo.19II-12
2.2. 16S-5S Ribosomal Cluster Alignment Analysis
- Clade five compiled two different groups: (i) A. ferrivorans strains (including all A. ferrivorans strains and the unclassified strain MC6.1) and (ii) A. ferriphilus strains (comprising all A. ferriphilus strains, along with the strains of A. ferrooxidans BY0502 and YQH 1).
- Clade six comprises the remaining strains of A. ferrooxidans, along with the unclassified strains PG05 and GGI 221, the strains of A. ferridurans, and the unclassified strain AMD consortium.
- Clade seven joined two groups: (i) the strains belonging to both A. thiooxidans and A. albertensis species, along with some unclassified strains such as ATCC 19,703, HP-2, HP-6, HP-11, and RW2, and (ii) two unclassified strains: GG1-14 and SH.
2.3. Determination of A. thiooxidans Lo.19II-12 Growth by qPCR
2.4. Determination of the pH-Stress Conditions by RT PCR
2.5. Proteome Analysis of A. thiooxidans Lo.19II-12 under pH Stress by 2D-DIGE Analysis
3. Discussion
4. Materials and Methods
4.1. Media and Strain Isolation
4.2. A. thiooxidans DNA Isolation and Genome Sequencing
4.3. 16S-5S Ribosomal Cluster Alignment and Analysis
4.4. A. thiooxidans Growth Determination by qPCR
4.5. Analysis of pH Stress Conditions in A. thiooxidans by Reverse Transcription PCR (RT-PCR)
4.6. A. thiooxidans Proteome Analysis under pH Stress by 2D DIGE Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Blengini, G.A.; Mathieux, F.; Mancini, L.; Nyberg, M.; Viegas, H.M. (Eds.) Recovery of Critical and Other Raw Materials from Mining Waste and Landfills; State of Play on Existing Practices; Joint Research Centre: Brussels, Belgium, 2019; Volume 129. [Google Scholar] [CrossRef]
- Mohan, S.; Joseph, C.P. Biomining: An Innovative and Practical Solution for Reclamation of Open Dumpsite. In Recent Developments in Waste Management: Select Proceedings of Recycle; Springer: Singapore, 2020; pp. 167–178. [Google Scholar]
- Spooren, J.; Binnemans, K.; Björkmalm, J.; Breemersch, K.; Dams, Y.; Folens, K.; González-Moya, M.; Horckmans, L.; Komnitsas, K.; Kurylak, W.; et al. Near-Zero-Waste Processing of Low-Grade, Complex Primary Ores and Secondary Raw Materials in Europe: Technology Development Trends. Resour. Conserv. Recycl. 2020, 160, 104919. [Google Scholar] [CrossRef]
- Steiner, G.; Geissler, B.; Watson, I.; Mew, M.C. Efficiency Developments in Phosphate Rock Mining over the Last Three Decades. Resour. Conserv. Recycl. 2015, 105, 235–245. [Google Scholar] [CrossRef]
- Thenepalli, T.; Chilakala, R.; Habte, L.; Tuan, L.Q.; Kim, C.S. A Brief Note on the Heap Leaching Technologies for the Recovery of Valuable Metals. Sustainability 2019, 11, 3347. [Google Scholar] [CrossRef]
- Taha, Y.; Elghali, A.; Hakkou, R.; Benzaazoua, M. Towards Zero Solid Waste in the Sedimentary Phosphate Industry: Challenges and Opportunities. Minerals 2021, 11, 1250. [Google Scholar] [CrossRef]
- Perlatti, F.; Martins, E.P.; de Oliveira, D.P.; Ruiz, F.; Asensio, V.; Rezende, C.F.; Otero, X.L.; Ferreira, T.O. Copper Release from Waste Rocks in an Abandoned Mine (NE, Brazil) and Its Impacts on Ecosystem Environmental Quality. Chemosphere 2021, 262, 127843. [Google Scholar] [CrossRef] [PubMed]
- Brandão, I.Y.; Munakata, A.A.; Lourenço, L.A.; Maass, D. How Biomining Has Been Used to Recover Metals from Ores and Waste? A Review. Int. J. Earth Environ. Sci. 2021, 6. [Google Scholar]
- Gumulya, Y.; Boxall, N.; Khaleque, H.; Santala, V.; Carlson, R.; Kaksonen, A. In a Quest for Engineering Acidophiles for Biomining Applications: Challenges and Opportunities. Genes 2018, 9, 116. [Google Scholar] [CrossRef]
- Jerez, C.A. Biomining of Metals: How to Access and Exploit Natural Resource Sustainably. Microb. Biotechnol. 2017, 10, 1191–1193. [Google Scholar] [CrossRef]
- Johnson, D.B. Biomining—Biotechnologies for Extracting and Recovering Metals from Ores and Waste Materials. Curr. Opin. Biotechnol. 2014, 30, 24–31. [Google Scholar] [CrossRef]
- Schippers, A.; Hedrich, S.; Vasters, J.; Drobe, M.; Sand, W.; Willscher, S. Biomining: Metal Recovery from Ores with Microorganisms. In Geobiotechnology I; Advances in Biochemical Engineering/Biotechnology; Springer: Berlin/Heidelberg, Germany, 2014; Volume 141, pp. 1–47. [Google Scholar]
- Silva, R.A.; Park, J.; Ilyas, S.; Borja, D.; Zhao, H.; Urík, M.; Rastegar, S.O.; Kim, H. Biodegradation Mechanism of Arsenopyrite Mine Tailing with Acidithiobacillus ferrooxidans and Influence of Ferric Supplements. Int. Biodeterior. Biodegradation 2020, 153, 105042. [Google Scholar] [CrossRef]
- Ilyas, S.; Srivastava, R.R.; Kim, H. O2-Enriched Microbial Activity with PH-Sensitive Solvo-Chemical and Electro-Chlorination Strategy to Reclaim Critical Metals from the Hazardous Waste Printed Circuit Boards. J. Hazard. Mater. 2021, 416, 125769. [Google Scholar] [CrossRef] [PubMed]
- Rana, K.; Rana, N.; Singh, B. Applications of Sulfur Oxidizing Bacteria. In Physiological and Biotechnological Aspects of Extremophiles; Elsevier: Amsterdam, The Netherlands, 2020; pp. 131–136. [Google Scholar]
- Jerez, C.A. Bioleaching and Biomining for the Industrial Recovery of Metals. In Reference Module in Life Sciences; Elsevier: Amsterdam, The Netherlands, 2017. [Google Scholar]
- Ibáñez, A. Development of Microbial Technologies for the Soluble Phosphorus Production by Phosphate Rock Solubilization. Doctoral Dissertation, Universidad de León, León, Spain, 2021. [Google Scholar]
- Xiao, Y.; Liu, X.; Liang, Y.; Niu, J.; Zhang, X.; Ma, L.; Hao, X.; Gu, Y.; Yin, H. Insights into Functional Genes and Taxonomical/Phylogenetic Diversity of Microbial Communities in Biological Heap Leaching System and Their Correlation with Functions. Appl. Microbiol. Biotechnol. 2016, 100, 9745–9756. [Google Scholar] [CrossRef] [PubMed]
- Garrity, G.M.; Brenner, D.J.; Krieg, N.R.; Staley, J.T. Bergey’s Manual of Systematic Bacteriology: Volume Two, Part B. The Gammaproteobacteria, 2nd ed.; Brenner, D.J., Krieg, N.R., Staley, J.T., Eds.; Springer: New York, NY, USA, 2005; ISBN 978-0-387-95041-9. [Google Scholar]
- Valdés, J.; Pedroso, I.; Quatrini, R.; Dodson, R.J.; Tettelin, H.; Blake, R.; Eisen, J.A.; Holmes, D.S. Acidithiobacillus ferrooxidans Metabolism: From Genome Sequence to Industrial Applications. BMC Genom. 2008, 9, 597. [Google Scholar] [CrossRef] [PubMed]
- Jung, H.; Inaba, Y.; Banta, S. Genetic Engineering of the Acidophilic Chemolithoautotroph Acidithiobacillus ferrooxidans. Trends Biotechnol. 2021, 40, 677–692. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Li, N.; Liu, X.; Zhou, Z.; Li, Q.; Fang, Y.; Fan, X.; Fu, X.; Liu, Y.; Yin, H. Characterization of the Acid Stress Response of Acidithiobacillus ferrooxidans ATCC 23270 Based on the Method of Microarray. J. Biol. Res. 2012, 17, 3–15. [Google Scholar]
- Zhang, S.; Yan, L.; Xing, W.; Chen, P.; Zhang, Y.; Wang, W. Acidithiobacillus ferrooxidans and Its Potential Application. Extremophiles 2018, 22, 563–579. [Google Scholar] [CrossRef]
- Zhan, Y.; Yang, M.; Zhang, S.; Zhao, D.; Duan, J.; Wang, W.; Yan, L. Iron and Sulfur Oxidation Pathways of Acidithiobacillus ferrooxidans. World J. Microbiol. Biotechnol. 2019, 35, 60. [Google Scholar] [CrossRef]
- Lee, Y.; Sethurajan, M.; van de Vossenberg, J.; Meers, E.; van Hullebusch, E.D. Recovery of Phosphorus from Municipal Wastewater Treatment Sludge through Bioleaching Using Acidithiobacillus thiooxidans. J. Environ. Manag. 2020, 270, 110818. [Google Scholar] [CrossRef]
- Naseri, T.; Bahaloo-Horeh, N.; Mousavi, S.M. Environmentally Friendly Recovery of Valuable Metals from Spent Coin Cells through Two-Step Bioleaching Using Acidithiobacillus thiooxidans. J. Environ. Manag. 2019, 235, 357–367. [Google Scholar] [CrossRef]
- Yang, L.; Zhao, D.; Yang, J.; Wang, W.; Chen, P.; Zhang, S.; Yan, L. Acidithiobacillus thiooxidans and Its Potential Application. Appl. Microbiol. Biotechnol. 2019, 103, 7819–7833. [Google Scholar] [CrossRef]
- Falagán, C.; Johnson, D.B. Acidithiobacillus ferriphilus Sp. Nov., a Facultatively Anaerobic Iron- and Sulfur-Metabolizing Extreme Acidophile. Int. J. Syst. Evol. Microbiol. 2016, 66, 206–211. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Liu, Z.; Meng, D.; Liu, X.; Li, X.; Zhang, M.; Tao, J.; Gu, Y.; Zhong, S.; Yin, H. Comparative Genomic Analysis Reveals the Distribution, Organization, and Evolution of Metal Resistance Genes in the Genus Acidithiobacillus. Appl. Environ. Microbiol. 2019, 85, e02153-18. [Google Scholar] [CrossRef] [PubMed]
- Mirete, S.; Morgante, V.; González-Pastor, J.E. Acidophiles: Diversity and Mechanisms of Adaptation to Acidic Environments. In Adaption of Microbial Life to Environmental Extremes; Stan-Lotter, H., Fendrihan, S., Eds.; Springer International Publishing: Cham, Switzerland, 2017; p. 26. ISBN 978-3-319-48325-2. [Google Scholar]
- Moya-Beltrán, A.; Beard, S.; Rojas-Villalobos, C.; Issotta, F.; Gallardo, Y.; Ulloa, R.; Giaveno, A.; Degli Esposti, M.; Johnson, D.B.; Quatrini, R. Genomic Evolution of the Class Acidithiobacillia: Deep-Branching Proteobacteria Living in Extreme Acidic Conditions. ISME J. 2021, 15, 3221–3238. [Google Scholar] [CrossRef] [PubMed]
- Nuñez, H.; Covarrubias, P.C.; Moya-Beltrán, A.; Issotta, F.; Atavales, J.; Acuña, L.G.; Johnson, D.B.; Quatrini, R. Detection, Identification and Typing of Acidithiobacillus Species and Strains: A Review. Res. Microbiol. 2016, 167, 555–567. [Google Scholar] [CrossRef] [PubMed]
- Johnson, D.B. Selective Solid Media for Isolating and Enumerating Acidophilic Bacteria. J. Microbiol. Methods 1995, 23, 205–218. [Google Scholar] [CrossRef]
- Zhang, Y.; Yang, Y.; Liu, J.; Qiu, G. Isolation and Characterization of Acidithiobacillus ferrooxidans Strain QXS-1 Capable of Unusual Ferrous Iron and Sulfur Utilization. Hydrometallurgy 2013, 136, 51–57. [Google Scholar] [CrossRef]
- Ni, Y.; Wan, D.; He, K. 16S RDNA and 16S–23S Internal Transcribed Spacer Sequence Analyses Reveal Inter- and Intraspecific Acidithiobacillus Phylogeny. Microbiology 2008, 154, 2397–2407. [Google Scholar] [CrossRef][Green Version]
- Nuñez, H.; Loyola, D.; Cárdenas, J.P.; Holmes, D.S.; Johnson, D.B.; Quatrini, R. Multi Locus Sequence Typing Scheme for Acidithiobacillus caldus Strain Evaluation and Differentiation. Res. Microbiol. 2014, 165, 735–742. [Google Scholar] [CrossRef]
- Nuñez, H.; Moya-Beltrán, A.; Covarrubias, P.C.; Issotta, F.; Cárdenas, J.P.; González, M.; Atavales, J.; Acuña, L.G.; Johnson, D.B.; Quatrini, R. Molecular Systematics of the Genus Acidithiobacillus: Insights into the Phylogenetic Structure and Diversification of the Taxon. Front. Microbiol. 2017, 8, 30. [Google Scholar] [CrossRef]
- Falagán, C.; Moya-Beltrán, A.; Castro, M.; Quatrini, R.; Johnson, D.B. Acidithiobacillus Sulfuriphilus Sp. Nov.: An Extremely Acidophilic Sulfur-Oxidizing Chemolithotroph Isolated from a Neutral PH Environment. Int. J. Syst. Evol. Microbiol. 2019, 69, 2907–2913. [Google Scholar] [CrossRef]
- Norris, P.R.; Falagán, C.; Moya-Beltrán, A.; Castro, M.; Quatrini, R.; Johnson, D.B. Acidithiobacillus ferrianus Sp. Nov.: An Ancestral Extremely Acidophilic and Facultatively Anaerobic Chemolithoautotroph. Extremophiles 2020, 24, 329–337. [Google Scholar] [CrossRef] [PubMed]
- Saitou, N.; Nei, M. The Neighbor-Joining Method: A New Method for Reconstructing Phylogenetic Trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Nei, M.; Kumar, S. Prospects for Inferring Very Large Phylogenies by Using the Neighbor-Joining Method. Proc. Natl. Acad. Sci. USA 2004, 101, 11030–11035. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Letunic, I.; Bork, P. Interactive Tree of Life (ITOL) v5: An Online Tool for Phylogenetic Tree Display and Annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef] [PubMed]
- González-García, S.; Álvarez-Pérez, J.M.; Sáenz de Miera, L.E.; Cobos, R.; Ibañez, A.; Díez-Galán, A.; Garzón-Jimeno, E.; Coque, J.J.R. Developing Tools for Evaluating Inoculation Methods of Biocontrol Streptomyces Sp. Strains into Grapevine Plants. PLoS ONE 2019, 14, e0211225. [Google Scholar] [CrossRef] [PubMed]
- Feng, S.; Yang, H.; Wang, W. System-Level Understanding of the Potential Acid-Tolerance Components of Acidithiobacillus thiooxidans ZJJN-3 under Extreme Acid Stress. Extremophiles 2015, 19, 1029–1039. [Google Scholar] [CrossRef]
- Feng, S.; Qiu, Y.; Huang, Z.; Yin, Y.; Zhang, H.; Zhu, D.; Tong, Y.; Yang, H. The Adaptation Mechanisms of Acidithiobacillus caldus CCTCC M 2018054 to Extreme Acid Stress: Bioleaching Performance, Physiology, and Transcriptomics. Environ. Res. 2021, 199, 111341. [Google Scholar] [CrossRef]
- Roncarati, D.; Scarlato, V. Regulation of Heat-Shock Genes in Bacteria: From Signal Sensing to Gene Expression Output. FEMS Microbiol. Rev. 2017, 41, 549–574. [Google Scholar] [CrossRef]
- Mykytczuk, N.C.S.; Trevors, J.T.; Ferroni, G.D.; Leduc, L.G. Cytoplasmic Membrane Fluidity and Fatty Acid Composition of Acidithiobacillus ferrooxidans in Response to PH Stress. Extremophiles 2010, 14, 427–441. [Google Scholar] [CrossRef]
- Mykytczuk, N.C.S.; Trevors, J.T.; Ferroni, G.D.; Leduc, L.G. Cytoplasmic Membrane Response to Copper and Nickel in Acidithiobacillus ferrooxidans. Microbiol. Res. 2011, 166, 186–206. [Google Scholar] [CrossRef] [PubMed]
- Bellenberg, S.; Huynh, D.; Poetsch, A.; Sand, W.; Vera, M. Proteomics Reveal Enhanced Oxidative Stress Responses and Metabolic Adaptation in Acidithiobacillus ferrooxidans Biofilm Cells on Pyrite. Front. Microbiol. 2019, 10, 592. [Google Scholar] [CrossRef] [PubMed]
- Yin, Z.; Feng, S.; Tong, Y.; Yang, H. Adaptive Mechanism of Acidithiobacillus thiooxidans CCTCC M 2012104 under Stress during Bioleaching of Low-Grade Chalcopyrite Based on Physiological and Comparative Transcriptomic Analysis. J. Ind. Microbiol. Biotechnol. 2019, 46, 1643–1656. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Lin, J.; Liu, X.; Pang, X.; Zhang, C.; Yang, C.; Gao, X.; Lin, C.; Li, Y.; Li, Y.; et al. Sulfur Oxidation in the Acidophilic Autotrophic Acidithiobacillus spp. Front. Microbiol. 2019, 9, 3290. [Google Scholar] [CrossRef] [PubMed]
- Altieri, A.S.; Kelman, Z. DNA Sliding Clamps as Therapeutic Targets. Front. Mol. Biosci. 2018, 5, 87. [Google Scholar] [CrossRef]
- Dopson, M.; Holmes, D.S.; Lazcano, M.; McCredden, T.J.; Bryan, C.G.; Mulroney, K.T.; Steuart, R.; Jackaman, C.; Watkin, E.L.J. Multiple Osmotic Stress Responses in Acidihalobacter Prosperus Result in Tolerance to Chloride Ions. Front. Microbiol. 2017, 7, 2132. [Google Scholar] [CrossRef] [PubMed]
- Mangold, S.; Rao Jonna, V.; Dopson, M. Response of Acidithiobacillus caldus toward Suboptimal PH Conditions. Extremophiles 2013, 17, 689–696. [Google Scholar] [CrossRef]
- Guan, N.; Liu, L. Microbial Response to Acid Stress: Mechanisms and Applications. Appl. Microbiol. Biotechnol. 2020, 104, 51–65. [Google Scholar] [CrossRef]
- Song, H.; Huff, J.; Janik, K.; Walter, K.; Keller, C.; Ehlers, S.; Bossmann, S.H.; Niederweis, M. Expression of the OmpATb Operon Accelerates Ammonia Secretion and Adaptation of Mycobacterium tuberculosis to Acidic Environments. Mol. Microbiol. 2011, 80, 900–918. [Google Scholar] [CrossRef]
- Yao, Y.; Barghava, N.; Kim, J.; Niederweis, M.; Marassi, F.M. Molecular Structure and Peptidoglycan Recognition of Mycobacterium tuberculosis ArfA (Rv0899). J. Mol. Biol. 2012, 416, 208–220. [Google Scholar] [CrossRef]
- Zhang, X.; Liu, X.; Li, L.; Wei, G.; Zhang, D.; Liang, Y.; Miao, B. Phylogeny, Divergent Evolution, and Speciation of Sulfur-Oxidizing Acidithiobacillus Populations. BMC Genom. 2019, 20, 438. [Google Scholar] [CrossRef] [PubMed]
- Peace, T.A.; Brock, K.V.; Stills, H.F. Comparative Analysis of the 16S rRNA Gene Sequence of the Putative Agent of Proliferative Ileitis of Hamsters. Int. J. Syst. Bacteriol. 1994, 44, 832–835. [Google Scholar] [CrossRef] [PubMed]
- Sriaporn, C.; Campbell, K.A.; Van Kranendonk, M.J.; Handley, K.M. Genomic Adaptations Enabling Acidithiobacillus Distribution across Wide-Ranging Hot Spring Temperatures and PHs. Microbiome 2021, 9, 135. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Feng, X.; Tao, J.; Ma, L.; Xiao, Y.; Liang, Y.; Liu, X.; Yin, H. Comparative Genomics of the Extreme Acidophile Acidithiobacillus thiooxidans Reveals Intraspecific Divergence and Niche Adaptation. Int. J. Mol. Sci. 2016, 17, 1355. [Google Scholar] [CrossRef] [PubMed]
- Konishi, Y.; Asai, S.; Yoshida, N. Growth Kinetics of Thiobacillus thiooxidans on the Surface of Elemental Sulfur. Appl. Environ. Microbiol. 1995, 61, 3617–3622. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Mercado, R.; Kernan, T.; West, A.C.; Banta, S. Addition of Citrate to Acidithiobacillus ferrooxidans Cultures Enables Precipitate-Free Growth at Elevated PH and Reduces Ferric Inhibition. Biotechnol. Bioeng. 2014, 111, 1940–1948. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, T.A.; Fu, C.C.; Juang, R.S. Biosorption and Biodegradation of a Sulfur Dye in High-Strength Dyeing Wastewater by Acidithiobacillus thiooxidans. J. Environ. Manag. 2016, 182, 265–271. [Google Scholar] [CrossRef]
- Méndez-Tovar, M.; García-Meza, J.V.; González, I. Electrochemical Monitoring of Acidithiobacillus thiooxidans Biofilm Formation on Graphite Surface with Elemental Sulfur. Bioelectrochemistry 2019, 128, 30–38. [Google Scholar] [CrossRef]
- Negishi, A.; Muraoka, T.; Maeda, T.; Takeuchi, F.; Kanao, T.; Kamimura, K.; Sugio, T. Growth Inhibition by Tungsten in the Sulfur-Oxidizing Bacterium Acidithiobacillus thiooxidans. Biosci. Biotechnol. Biochem. 2005, 69, 2073–2080. [Google Scholar] [CrossRef]
- Camacho, D.; Frazao, R.; Fouillen, A.; Nanci, A.; Lang, B.F.; Apte, S.C.; Baron, C.; Warren, L.A. New Insights Into Acidithiobacillus thiooxidans Sulfur Metabolism Through Coupled Gene Expression, Solution Chemistry, Microscopy, and Spectroscopy Analyses. Front. Microbiol. 2020, 11, 411. [Google Scholar] [CrossRef]
- Esparza, M.; Jedlicki, E.; González, C.; Dopson, M.; Holmes, D.S. Effect of CO2 Concentration on Uptake and Assimilation of Inorganic Carbon in the Extreme Acidophile Acidithiobacillus ferrooxidans. Front. Microbiol. 2019, 10, 603. [Google Scholar] [CrossRef] [PubMed]
- Gao, X.; Fu, C.; Hao, L.; Gu, X.; Wang, R.; Lin, J.; Liu, X.; Pang, X.; Zhang, C.; Lin, J.; et al. The Substrate-dependent Regulatory Effects of the AfeI/R System in Acidithiobacillus ferrooxidans Reveals the Novel Regulation Strategy of Quorum Sensing in Acidophiles. Environ. Microbiol. 2021, 23, 757–773. [Google Scholar] [CrossRef] [PubMed]
- Berlemont, R.; Gerday, C. Extremophiles. In Comprehensive Biotechnology; Moo-Young, M., Ed.; Elsevier: Amsterdam, The Netherlands, 2011; pp. 229–242. ISBN 978-0-08-088504-9. [Google Scholar]
- Plumb, J.J.; Muddle, R.; Franzmann, P.D. Effect of PH on Rates of Iron and Sulfur Oxidation by Bioleaching Organisms. Miner. Eng. 2008, 21, 76–82. [Google Scholar] [CrossRef]
- Kara, I.T.; Kremser, K.; Wagland, S.T.; Coulon, F. Bioleaching Metal-Bearing Wastes and by-Products for Resource Recovery: A Review. Environ. Chem. Lett. 2023. [Google Scholar] [CrossRef]
- Zhang, L.; Zhou, W.; Liu, Y.; Jia, H.; Zhou, J.; Wei, P.; Zhou, H. Bioleaching of Dewatered Electroplating Sludge for the Extraction of Base Metals Using an Adapted Microbial Consortium: Process Optimization and Kinetics. Hydrometallurgy 2020, 191, 105227. [Google Scholar] [CrossRef]
- Rouchalova, D.; Rouchalova, K.; Janakova, I.; Cablik, V.; Janstova, S. Bioleaching of Iron, Copper, Lead, and Zinc from the Sludge Mining Sediment at Different Particle Sizes, PH, and Pulp Density Using Acidithiobacillus ferrooxidans. Minerals 2020, 10, 1013. [Google Scholar] [CrossRef]
- Li, M.; Wen, J. Recent Progress in the Application of Omics Technologies in the Study of Bio-Mining Microorganisms from Extreme Environments. Microb. Cell Fact. 2021, 20, 178. [Google Scholar] [CrossRef] [PubMed]
- Travisany, D.; Cortés, M.P.; Latorre, M.; Di Genova, A.; Budinich, M.; Bobadilla-Fazzini, R.A.; Parada, P.; González, M.; Maass, A. A New Genome of Acidithiobacillus thiooxidans Provides Insights into Adaptation to a Bioleaching Environment. Res. Microbiol. 2014, 165, 743–752. [Google Scholar] [CrossRef]
- Zhang, X.; Liu, Z.; Wei, G.; Yang, F.; Liu, X. In Silico Genome-Wide Analysis Reveals the Potential Links Between Core Genome of Acidithiobacillus thiooxidans and Its Autotrophic Lifestyle. Front. Microbiol. 2018, 9, 1255. [Google Scholar] [CrossRef]
- Starosvetsky, J.; Zukerman, U.; Armon, R.H. A Simple Medium Modification for Isolation, Growth and Enumeration of Acidithiobacillus thiooxidans (Syn. Thiobacillus thiooxidans) from Water Samples. J. Microbiol. Methods 2013, 92, 178–182. [Google Scholar] [CrossRef]
- Bergamo, R.F.; Teresa, M.; Novo, M.; Veríssimo, R.V.; Paulino, L.C.; Stoppe, N.C.; Inês, M.; Sato, Z.; Manfio, G.P.; Inácio, P.; et al. Differentiation of Acidithiobacillus ferrooxidans and A. thiooxidans Strains Based on 16S—23S RDNA Spacer Polymorphism Analysis. Res. Microbiol. 2004, 155, 559–567. [Google Scholar] [CrossRef] [PubMed]
- Aziz, R.K.; Bartels, D.; Best, A.A.; DeJongh, M.; Disz, T.; Edwards, R.A.; Formsma, K.; Gerdes, S.; Glass, E.M.; Kubal, M.; et al. The RAST Server: Rapid Annotations Using Subsystems Technology. BMC Genom. 2008, 9, 75. [Google Scholar] [CrossRef] [PubMed]
- Overbeek, R.; Olson, R.; Pusch, G.D.; Olsen, G.J.; Davis, J.J.; Disz, T.; Edwards, R.A.; Gerdes, S.; Parrello, B.; Shukla, M.; et al. The SEED and the Rapid Annotation of Microbial Genomes Using Subsystems Technology (RAST). Nucleic Acids Res. 2014, 42, D206–D214. [Google Scholar] [CrossRef] [PubMed]
- Thompson, J.; Gibson, T.J.; Plewniak, F.; Jeanmougin, F.; Higgins, D.G. The CLUSTAL_X Windows Interface: Flexible Strategies for Multiple Sequence Alignment Aided by Quality Analysis Tools. Nucleic Acids Res. 1997, 25, 4876–4882. [Google Scholar] [CrossRef] [PubMed]
- Wilhelm, J.; Pingoud, A.; Hahn, M. Real-Time PCR-Based Method for the Estimation of Genome Sizes. Nucleic Acids Res. 2003, 31, e56. [Google Scholar] [CrossRef] [PubMed]
- Barreiro, C.; González-Lavado, E.; Brand, S.; Tauch, A.; Martín, J.F. Heat Shock Proteome Analysis of Wild-Type Corynebacterium glutamicum ATCC 13032 and a Spontaneous Mutant Lacking GroEL1, a Dispensable Chaperone. J. Bacteriol. 2005, 187, 884–889. [Google Scholar] [CrossRef] [PubMed]
- Bradford, M.M. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef] [PubMed]
- Candiano, G.; Bruschi, M.; Musante, L.; Santucci, L.; Ghiggeri, G.M.; Carnemolla, B.; Orecchia, P.; Zardi, L.; Righetti, P.G. Blue Silver: A Very Sensitive Colloidal Coomassie G-250 Staining for Proteome Analysis. Electrophoresis 2004, 25, 1327–1333. [Google Scholar] [CrossRef]
- Hermann, T.; Pfefferle, W.; Baumann, C.; Busker, E.; Schaffer, S.; Bott, M.; Sahm, H.; Dusch, N.; Kalinowski, J.; Pühler, A.; et al. Proteome Analysis of Corynebacterium glutamicum. Electrophoresis 2001, 22, 1712–1723. [Google Scholar] [CrossRef]
- Perkins, D.N.; Pappin, D.J.; Creasy, D.M.; Cottrell, J.S. Probability-Based Protein Identification by Searching Sequence Databases Using Mass Spectrometry Data. Electrophoresis 1999, 20, 3551–3567. [Google Scholar] [CrossRef]
- García-Calvo, L.; Ullán, R.V.; Fernández-Aguado, M.; García-Lino, A.M.; Balaña-Fouce, R.; Barreiro, C. Secreted Protein Extract Analyses Present the Plant Pathogen Alternaria alternata as a Suitable Industrial Enzyme Toolbox. J. Proteom. 2018, 177, 48–64. [Google Scholar] [CrossRef]



| Time | pH | 2−∆∆Ct | |||
|---|---|---|---|---|---|
| groEL2 | dnaJ | rpoH | dnaK | ||
| 30 min | 0.5 | 0.00 ± 0.01 | 0.31 ± 0.52 | No Ct | No Ct |
| 1.5 | 0.00 ± 0.00 | 0.00 ± 0.00 | 2.09 ± 4.46 | No Ct | |
| 3.0 | 1.00 ± 0.00 | 1.00 ± 0.00 | 1.00 ± 0.00 | 1.00 ± 0.00 | |
| 5.5 | 0.50 ± 0.063 | 0.41 ± 0.02 | 0.18 ± 0.00 | 0.37 ± 0.01 | |
| 6.0 | 0.52 ± 0.009 | 0.78 ± 0.05 | 0.48 ± 0.09 | 0.60 ± 0.08 | |
| 60 min | 0.5 | No Ct | No Ct | No Ct | No Ct |
| 1.5 | 0.00 ± 0.05 | 0.71 ± 0.51 | 0.94 ± 1.00 | No Ct | |
| 3.0 | 1.00 ± 0.00 | 1.00 ± 0.00 | 1.00 ± 0.00 | 1.00 ± 0.00 | |
| 5.5 | 1.59 ± 0.45 | 1.67 ± 1.09 | 1.26 ± 1.14 | 0.23 ± 0.01 | |
| 6.0 | 0.92 ± 0.43 | 2.34 ± 1.34 | 4.70 ± 2.93 | 0.54 ± 0.06 | |
| Gene | Primer Name | Primer Sequence | Amplicon Size (bp) | Reference |
|---|---|---|---|---|
| 16S rRNA | 27F | 5′AGAGTTTGATCCTGGCTCAG3′ | 1500 | Peace et al. 1994 [60] |
| 1492R | 5′GGTTACCTTGTTACGACTT3′ | |||
| 16S rRNA | F_16S | 5′AGAGTTTGATCCTGGCT3′ | 182 | This work |
| R_16S | 5′CGATTCTTTACCGAGTGG3′ | |||
| dnaJ | F_dnaJ | 5′TCGAAGTCAAAGTGCCGGCCGGAGTAGATA3′ | 80 | This work |
| R_dnaJ | 5′GCCGCGTTCCCCAGCTCCCCTTCACCATTCAGAC3′ | |||
| dnaK | F_dnaK | 5′GGAAGGCGACAAGGTCAAGG3′ | 262 | This work |
| R_dnaK | 5′CGCGCACTTCCACCCAGG3′ | |||
| groEL | F_groEL2 | 5′ACTGCGGCTATCTGTCGTCCTA3′ | 141 | This work |
| R_groEL2 | 5′GATCTGGCCGCCTCCTCTA3′ | |||
| rpoH | F_rpoH | 5′TGCGCAACTGGCGTATTGTCAAAGTGGCTACCA3′ | 126 | This work |
| R_rpoH | 5′CTTCAGCAATGGCCGCACTTTCCTCACCACTCAAC3′ | |||
| sdoA | F_sdoA | 5′CGAGGAAAATCTGCAGGTTGAGTGG3′ | 154 | This work |
| R_sdoA | 5′CGTTATAGATCTGGGCGAAAGTT3′ |
| Cycles | groEL2 | dnaJ | rpoH | dnaK | sdoA |
|---|---|---|---|---|---|
| ×1 | 95 °C; 2 min | ||||
| ×40 | 95 °C; 20 s | ||||
| 60 °C; 20 s | 62 °C; 20 s | 62 °C; 20 s | 60 °C; 20 s | 58 °C; 20 s | |
| ×1 | 72 °C; 1 min | ||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ibáñez, A.; Barreiro, C.; Diez-Galán, A.; Cobos, R.; Calvo-Peña, C.; Coque, J.J.R. Molecular Identification and Acid Stress Response of an Acidithiobacillus thiooxidans Strain Isolated from Rio Tinto (Spain). Int. J. Mol. Sci. 2023, 24, 13391. https://doi.org/10.3390/ijms241713391
Ibáñez A, Barreiro C, Diez-Galán A, Cobos R, Calvo-Peña C, Coque JJR. Molecular Identification and Acid Stress Response of an Acidithiobacillus thiooxidans Strain Isolated from Rio Tinto (Spain). International Journal of Molecular Sciences. 2023; 24(17):13391. https://doi.org/10.3390/ijms241713391
Chicago/Turabian StyleIbáñez, Ana, Carlos Barreiro, Alba Diez-Galán, Rebeca Cobos, Carla Calvo-Peña, and Juan José R. Coque. 2023. "Molecular Identification and Acid Stress Response of an Acidithiobacillus thiooxidans Strain Isolated from Rio Tinto (Spain)" International Journal of Molecular Sciences 24, no. 17: 13391. https://doi.org/10.3390/ijms241713391
APA StyleIbáñez, A., Barreiro, C., Diez-Galán, A., Cobos, R., Calvo-Peña, C., & Coque, J. J. R. (2023). Molecular Identification and Acid Stress Response of an Acidithiobacillus thiooxidans Strain Isolated from Rio Tinto (Spain). International Journal of Molecular Sciences, 24(17), 13391. https://doi.org/10.3390/ijms241713391

