Abstract
The OsNRT2.3a and OsNRT2.3b isoforms play important roles in the uptake and transport of nitrate during rice growth. However, it is unclear which cis-acting element controls the transcription of OsNRT2.3 into these specific isoforms. In this study, we used a yeast one-hybrid assay to obtain the TATA-box binding protein OsTBP2.1, which binds to the TATA-box of OsNRT2.3, and verified its important role through transient expression and RNA-seq. We found that the TATA-box of OsNRT2.3 mutants and binding protein OsTBP2.1 together increased the transcription ratio of OsNRT2.3b to OsNRT2.3a. The overexpression of OsTBP2.1 promoted nitrogen uptake and increased rice yield compared with the wild-type; however, the OsTBP2.1 T-DNA mutant lines exhibited the opposite trend. Detailed analyses demonstrated that the TATA-box was the key cis-regulatory element for OsNRT2.3 to be transcribed into OsNRT2.3a and OsNRT2.3b. Additionally, this key cis-regulatory element, together with the binding protein OsTBP2.1, promoted the development of rice and increased grain yield.
1. Introduction
Although the green revolution has made great progress in increasing the yield of grain crops, particularly rice, wheat, and maize, augmented cereal production has been accompanied by a huge increase in nitrogen fertilizer input that causes adverse effects to the environment [,]. With the continuous growth of the world’s population, increasing crop yield through environment-friendly and sustainable agriculture activities is vital to feed future populations []. Molecular breeding technology is a technological revolution that, in comparison to traditional breeding technology, can greatly improve the accuracy of crop breeding []. Therefore, a clear understanding of the mechanisms through which genes perform their functions is critical to optimize crops to effectively absorb nutrients.
The 5′ untranslated region (UTR) plays an important role in transcription and translation [,,]. mRNA splicing and polyadenylation not only mutually affect efficiency and specificity but are also highly coordinated during transcription []. The interaction between alternative splicing (AS) and polyadenylation determines the outcome of gene expression []. In eukaryotes, AS is a key mechanism of post-transcriptional regulation that produces mRNAs with different stabilities, localizations, and translation efficiencies, thereby regulating gene expression [,,] and greatly enhancing the diversity of the proteome [,]. AS can produce mRNAs with different UTRs or coding sequences, and these differences may lead to the synthesis of different isoforms of a protein or affect the stability/translatability of mRNA. The process of AS is deeply embedded in the regulatory networks that control development and differentiation processes in eukaryotes, and disorders in RNA splicing are the cause of several diseases in mammals [,]. Intron retention is the most frequent type of AS []. In the human nucleus, TARBP2 binding to pre-mRNAs leads to an increase in intron retention, which allows m6A to be recruited and deposited onto the target transcript, thereby affecting mRNA stability []. In plants, AS also affects developmental processes, and mutations affecting AS can be favorable for crop production. For example, in sweet maize, a C/GT mutation leading to intron retention in the 5′UTR of tiller number 1 (Zmtin1) enhances its transcript levels, consequently increasing tin1 expression []. In Arabidopsis, intron retention in the 5′UTR of ZIF2 promotes the response to zinc, enhancing tolerance to these metal ions [].
In eukaryotes, there are one or more conserved sequences, such as TATA-box and T/A-rich sequences, bound by proteins in the promoter [,]. Moreover, the number of conserved motifs and mutations will affect the regulation or transcriptional activity of the gene and even affect the absorption and utilization of nutrients by plants. For example, the insertion of a TATA-box on the promoter of the iron-regulated transporter 1 (IRT1) gene in apples increases the expression of the gene IRT1. The greater the number of TATA-box insertions, the more the increase in multiple, thereby increasing iron uptake []. In cotton, when the TATA-box is absent from the gene PRE1D, cotton fiber elongation is reduced as the transcriptional activity of PRE1D decreases. In contrast, when the TATA-box is present, the upregulation of the transcriptional activity of the gene PRE1D increases cotton fiber elongation [].
Nitrogen (N) is a key element in plant growth and development [,,,]. Plants absorb nutrients in different environments; this is closely related to the transcription and translation of their internal genes. However, in natural evolution, transcription factors play an important regulatory role in gene transcription and translation by binding to cis-acting elements on promoters [,]. Thus, studying the transcription factors and cis-acting elements can provide a better understanding of gene transcription and translation []. Previous studies have revealed that the mutation or deletion of a cis-acting element in a gene promoter can affect the binding ability of a transcription factor to a binding site, thereby affecting the transcriptional translation of the gene and even affecting the plant’s ability to absorb and utilize nutrients in different environments [,,,,,,]. For example, OsNhd1 can directly bind to NBS-containing fragments (AAAAATCT and AGATTTTT), which, in the OsNRT2.4 and OsAMT1.3 promoters, activate their expression and affect N uptake efficiency in rice []. OsGhd7 (the rice grain number, plant height, and heading date 7 protein) directly binds to two evening element-like motifs in the promoter and intron 1 of OsARE1 to repress its expression and regulate rice nitrogen utilization []. Therefore, transcription factors play an important role in the nitrogen uptake and utilization network in rice.
In addition, in the nitrogen regulatory network, the OsNRT2.3 gene plays a key role in rice growth, yield, and nitrogen utilization [,,,,,]. The OsNRT2.3 gene, which encodes for a high-affinity nitrate transporter, produces two transcript isoforms, OsNRT2.3a and OsNRT2.3b [,]. We have reported the functional characterization of OsNRT2.3a and OsNRT2.3b in previous studies [,,,,,]. The products encoded by OsNRT2.3a and OsNRT2.3b are different, and the product encoded by OsNRT2.3a is 516 amino acids, which is 30 amino acids longer than that of OsNRT2.3b []. Additionally, the 5′UTRs of OsNRT2.3a and OsNRT2.3b are different, and the 5′UTR of OsNRT2.3a is 42 bp, while OsNRT2.3b has a 247 bp 5′UTR []. Rice genotypes with higher levels of OsNRT2.3b than OsNRT2.3a altered N absorption and transport efficiency factors that influence N-use efficiency (NUE) []. OsNRT2.3a reportedly participates in long-distance nitrate transport from root to shoot. However, OsNRT2.3b, which is primarily expressed in the phloem of the shoot, plays a role in pH and ion homeostasis and can cause membrane potential depolarization and cytoplasmic acidification under NO3− supply conditions []. However, the mechanisms that regulate the transcription of OsNRT2.3a and OsNRT2.3b remain unknown. In this study, we show that the TATA-box binding protein OsTBP2.1 modulates the efficiency of the transcription initiation and splicing of OsNRT2.3 to produce different levels of OsNRT2.3a and OsNRT2.3b isoforms. Our results uncover a mechanism for the regulation of OsNRT2.3 that has a great impact on rice growth and yield, thereby offering novel directions for the molecular breeding of rice with improved yields.
2. Results
2.1. OsTBP2.1 Positively Regulates Rice Growth and Grain Yield in the Field
To determine whether OsTBP2.1 influenced the growth and yield of rice, we produced transgenic rice lines that overexpressed OsTBP2.1 (OE, OE198, and OE399) as well as OsTBP2.1 knockout lines (ostbp2.1, 1A-19324, and 2B-30161) (Figure 1A,B; Figures S1 and S2). OsTBP2.1 expression was evidently increased in the OE lines compared with the wild-type Wuyunjing 27 (WT-W27) and declined in the ostbp2.1 lines compared with the wild-type HuangYang (WT-HY) (Figure 1B). In the field, we analyzed the agricultural traits of the OE and ostbp2.1 lines and found that the overexpression of OsTBP2.1 improved rice growth and increased tiller number, plant height, and dry weight; however, the knockdown of OsTBP2.1 elicited the opposite results (Figure S3; Figure 1C). Dry weight increased by approximately 43.2% in OE compared with that in WT-W27 but decreased in ostbp2.1 by approximately 34.8% (Figure 1C). Rice yield is inextricably linked to panicle shape, and we analyzed the phenotype of the panicle at the maturity stage of rice. Grain number per panicle increased by approximately 30.2% in OE compared with that in WT-W27 but decreased in ostbp2.1 by approximately 39.0% (Figure 1D). The panicle length of OE was increased by approximately 26.3% compared with that of WT-W27 but decreased in ostbp2.1 by approximately 34.5% (Figure 1E). The seed setting rate of OE was increased by approximately 17.7% compared with that of WT-W27 but declined in ostbp2.1 by approximately 66.2% (Figure 1F). The changes in panicle shape and seed setting rate can affect rice yield. This ultimately resulted in a 45.3% increase in the OE yield compared with that of WT-W27 and a 49.4% decrease in the yield of ostbp2.1 compared with that of WT-HY (Figure 1G).
Figure 1.
Phenotype of OsTBP2.1 T-DNA insertion mutant and OsTBP2.1 overexpression lines. (A) Characterization of T-DNA insertion mutant lines (ostbp2.1, 1A-19324 and 2B-30161) and OsTBP2.1 overexpression lines (OE, OE198 and OE399) in a field experiment. Wild-type, Huangyang (WT-HY) and Wuyunjing27 (WT-W27). (Bar = 20 cm). (B) The expression of OsTBP2.1 in the OE lines and ostbp2.1 lines. Error bars: SE (n = 3). At the maturity stage of OE lines and ostbp2.1 lines, dry weight (C), grain number per panicle (D), panicle length (E), seed setting rate (F), and grain yield per plant (G) were taken from the field. Error bars: SE (n = 5). The different letters indicate a significant difference between each other (p < 0.05).
2.2. OsTBP2.1 Affects Nitrogen Uptake by Regulating the Transcription of OsNRT2.3a and OsNRT2.3b
To analyze the molecular biological functions of OsTBP2.1, we performed RNA-seq experiments using the OE lines and the ostbp2.1 lines (Mu). The analysis of the differentially expressed genes (DEGs) revealed that there were 468 genes downregulated in the OE lines and upregulated in the ostbp2.1 lines. However, 506 genes were downregulated in ostbp2.1 and upregulated in the OE lines in the root (Figure 2A). However, in the shoots, 509 genes were downregulated in the OE lines and upregulated in the ostbp2.1 lines, and 318 genes were upregulated in the opposite case (Figure 2A). After filtering the gene expression data |log2FC| ≥2, Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) analyses revealed that 25 genes were regulated by OsTBP2.1 in the rice roots and shoots (Figure 2B). Among the DEGs, OsTBP2.1 affected genes that regulate N uptake or transport. OsTBP2.1, OsNRT2.1, OsNRT2.2, OsNRT2.3a, and OsNRT2.3b (Figure 2B; Figure S4) also had a strong effect on the transcription of OsNRT2.3 in both the roots and shoots (Figure 2B and Figure 3).
Figure 2.
RNA-seq analysis of OsTBP2.1 overexpression lines and T-DNA insertion mutant lines. (A) The number of different expression genes (DEGs) identified by the RNA-seq dataset in the roots and shoots of OE and ostbp2.1. The samples taken from the shoots and roots of OsTBP2.1 overexpression lines (OE) and T-DNA insertion mutant lines (ostbp2.1). Blue arrow, downregulated genes in OE and ostbp2.1. Red arrow, upregulated genes in OE and ostbp2.1. (B) Individual accession number, putative function, and relative expression of the 25 genes selected from (A). Log fold change |log2FC|≥2 of the RNA-seq analysis (n = 3).
Figure 3.
The expression of OsNRT2.3a and OsNRT2.3b in the T-DNA insertion mutant lines and OsTBP2.1 overexpression lines. The expression of OsNRT2.3a (A) and OsNRT2.3b (B) in the OE lines and ostbp2.1 lines. (C) The expression ratio of OsNRT2.3b to OsNRT2.3a in the OE lines and ostbp2.1 lines. Error bars: SE (n = 3). Significant differences between ostbp2.1 and WT-HY, OE, and WT-W27 are indicated by different letters (p < 0.05).
To determine whether the expression of OsTBP2.1 impacted the expressions of the OsNRT2.3a and OsNRT2.3b transcript isoforms, we analyzed the expression of OsNRT2.3a and OsNRT2.3b (Figure 3). We found that the OE lines exhibited increased overall expressions of OsNRT2.3a and OsNRT2.3b; however, the ostbp2.1 lines exhibited the opposite trend (Figure 3A,B). Additionally, we observed that the OE lines increased the ratio of OsNRT2.3b to OsNRT2.3a, whereas the ostbp2.1 lines decreased the ratio (Figure 3C). Overall, these results suggest that OsTBP2.1 regulates OsNRT2.3 transcription, specifically enhancing the transcription of the OsNRT2.3b isoform, and that OsTBP2.1 overexpression promotes rice growth.
As most of the N uptake by rice is distributed in the grain, rice with a higher N uptake capacity generally produces a higher yield. To explore how OsTBP2.1 modulates N uptake in rice, we measured and analyzed the 15N-NH4+ and 15N-NO3− influx rates in OE and ostbp2.1. The influx rate of 15N was decreased in ostbp2.1 compared with that in WT-HY; however, it was increased under all 15N treatments in the OE lines compared with that in WT-W27 (Figure 4). Under the four treatments of 0.2 mM 15N-NH4+, 2.5 mM 15N-NH4+, 0.2 mM 15N-NO3−, and 2.5 mM 15N-NO3−, the influx rate of 15N in OE increased by approximately 110.0%, 62.5%, 306.0%, and 154.0%, respectively; however, in ostbp2.1, the 15N influx rate decreased by approximately 52.4%, 60.8%, 79.1%, and 75.6%, respectively (Figure 4). These results indicate that OsTBP2.1 affects NH4+ and NO3− uptake, particularly at low concentrations of N-NO3−.
Figure 4.
Effects of OsTBP2.1 overexpression lines and T-DNA insertion mutant lines on the root influx of 15N for 5 min. OsTBP2.1 overexpression lines (OE) and T-DNA insertion mutant lines (ostbp2.1) were grown in 1.25 mM NH4NO3 for 3 weeks and nitrogen starved for 3 days. The 15N influx rate was then measured at 0.25 mM 15NH4+, 2.5 mM 15NH4+, 0.25 mM 15NO3−, and 2.5 mM 15NO3− over a 5 min period. Error bars: SE (n = 5). The different letters indicate a significant difference between the transgenic line and the wild-type (p < 0.05).
2.3. OsTBP2.1 Bound to Cis-Element TATA-Box of OsNRT2.3
To verify OsTBP2.1, combined with the cis-acting elements of OsNRT2.3, we used the Softberry website (accessed on 1 May 2019) to analyze the sequence before the ATG of OsNRT2.3. We identified that the sequence of ATGCTATAAGAGC (from −89 to −77 bp upstream of OsNRT2.3 ATG) was the motif for the TATA-box. We performed a yeast one-hybrid assay, using OsTBP2.1 as a DNA-binding protein and the TATA-box of OsNRT2.3 as the binding site, to determine whether a TATA-box binding protein interacted with ATGCTATAAGAGC within the OsNRT2.3 promoter. The results show that OsTBP2.1 can bind to the TATA-box of OsNRT2.3, indicated by growth in the SD/-Leu medium containing 800 ng/mL aureobasidin A (AbAr) (Figure 5A). To further determine whether OsTBP2.1 plays a role in the transcriptional activity of OsNRT2.3 promoters and whether this effect is dependent on the TATA-box, we conducted transient expression assays using a dual-luciferase reporter assay system (Figure 5B). OsTPB2.1 expression was controlled by the ubiquitin1 promoter, and the luciferase coding sequence was controlled by the OsNRT2.3 promoter with C or T at position −83 bp upstream of OsNRT2.3 ATG (Figure 5B). Both reporter and effector vectors were co-transformed into rice protoplasts. We found that OsTBP2.1 enhanced the expression of the pNRT2.3-LUC fusion genes in the WT promoter (pNRT2.3) but not in the mutant promoter (mpNRT2.3) (Figure 5C). These results showed that OsTBP2.1 promotes the transcriptional activity of the OsNRT2.3 promoter and that the TATA-box of OsNRT2.3 acts as a regulatory switch.
Figure 5.
OsTBP2.1 binds to the cis-acting element of OsNRT2.3 (A) OsTBP2.1 binding to the TATA-box of OsNRT2.3. Yeast cells were co-transformed with pTATA-box::AbAi and pGADT7::OsTBP2.1. p53::AbAi and pGADT7::P53 were the positive controls. pTACA-box::AbAi and pGADT7::OsTBP2.1 were the negative controls. Cells were grown on the media with selection for interaction (SD, -Leu) and (800 ng/mL) AbAr to suppress background growth. (B) Constructs of the rice protoplast transient assay. The OsNRT2.3 promoter (pNRT2.3::LUC) or TATA-box mutated (TATA-box mutant to TACA-box) promoter (mpNRT2.3::LUC) drove the reporter. pUbi::TBP2.1 was the effector. The effector of OsTBP2.1 was driven by the Ubi promoter. The reporter and effector were co-transformed into the rice protoplast. (C) OsTBP2.1 affected the OsNRT2.3 promoter’s activation. Error bars: SE (n = 3). The different letters indicate a significant difference between each other (p < 0.05).
2.4. TATA-Box of OsNRT2.3 as a Regulatory Switch for OsNRT2.3 Transcription
To determine the mechanism through which OsTBP2.1 regulates the transcription of OsNRT2.3a and OsNRT2.3b, we structured expression vectors with different lengths of OsNRT2.3 promoter fragments (Figure 6A). Transgenic seedlings of rice (Nipponbare) with promoter fragments of OsNRT2.3 were obtained and transplanted into a hydroponic system supplied with 1.25 mM NH4NO3. The results showed that OsNRT2.3a expression was downregulated in the seedlings containing short promoter fragments, 141 and 180 bp. Moreover, OsNRT2.3a expression was upregulated in the seedlings containing long promoter fragments, 243, 697, and 1505 bp (Figure 6B). However, the relationship between promoter length and gene expression of OsNRT2.3b was the exact opposite of that observed for OsNRT2.3a (Figure 6C). By analyzing the ratio of OsNRT2.3b to OsNRT2.3a, we found that the short promoter fragments of OsNRT2.3 promoted an increase in the ratio of OsNRT2.3b to OsNRT2.3a, whereas the long promoter fragments inhibited this effect (Figure 6D). Therefore, we can conclude that the transcription of OsNRT2.3 to OsNRT2.3b is inhibited by the long fragment promoters of OsNRT2.3.
Figure 6.
Effect of different OsNRT2.3 promoter lengths on OsNRT2.3a and OsNRT2.3b expression in rice. (A) Schematic representation of the different OsNRT2.3 promoter fragments 141, 180, 243, 697, and 1505 bp, driving the expression of the 437 bp open reading frames (ORF) of OsNRT2.3 and the ZIIIB reporter gene. Black frames, spliced intron. Brown frames, ORF of OsNRT2.3a and OsNRT2.3b. Yellow frames, promoters of OsNRT2.3. Green frames, ZIIIB reporter gene, division OsNRT2.3a and OsNRT2.3b. Obtained transgenic lines planted in a solution containing 1.25 mM NH4NO3 of IRRI. The expression of OsNRT2.3a (B) and OsNRT2.3b (C) in the lines of different lengths of OsNRT2.3 promoters was derived. (D) The expression ratio of OsNRT2.3b to OsNRT2.3a in the lines of different lengths of OsNRT2.3 promoters was derived. Error bars: SE (n = 3). Significant differences between the lines are indicated by different letters (p < 0.05).
To explore the effect of TATA-box mutations on the transcription of OsNRT2.3 into OsNRT2.3a and OsNRT2.3b, we obtained transgenic rice containing a TATA-box mutant (−83 bp mutation, ATGCTATAAGAGC mutant to ATGCTAcAAGAGC) with OsNRT2.3 promoters of different lengths. The TATA-box mutant on the 141 bp fragment inhibited the transcription of both OsNRT2.3a and OsNRT2.3b compared with the natural 141 bp fragment (Figure 7A–C). However, the TATA-box mutant on the 697 bp fragment inhibited OsNRT2.3a transcription but promoted OsNRT2.3b transcription compared with the natural 697 bp fragment (Figure 7A–C). The proportion of OsNRT2.3b to OsNRT2.3a was increased when the TATA-box mutant was on fragments of 141 and 697 bp (Figure 7D). The results showed that the expression ratio of OsNRT2.3b to OsNRT2.3a was strongly correlated with the promoter length and specific TATA-box motif.
Figure 7.
Effects of TATA-box mutation at different length promoters influence the transcription of OsNRT2.3 in rice. (A) Schematic representation of the diagram of different lengths of OsNRT2.3 promoter fragments; TATA-box mutation fragments promote the 437 bp ORF of OsNRT2.3 and the ZIIIB reporter gene; 141 and 697 bp are the different lengths of the original OsNRT2.3 promoter; 141M and 697M are the different lengths of the OsNRT2.3 promoter containing the TATA-box mutation site. Yellow frames, promoters of OsNRT2.3. Black frames, spliced intron. Brown frames, ORF of OsNRT2.3a and OsNRT2.3b. Green frames, ZIIIB reporter gene. Blue line, TATA-box mutation site, −83 bp upstream of OsNRT2.3 ATG. Obtained transgenic lines planted in a solution containing 1.25 mM NH4NO3 of IRRI. The expression of OsNRT2.3a (B) and OsNRT2.3b (C) in the transgenic lines. (D) The expression ratio of OsNRT2.3b to OsNRT2.3a in the transgenic lines. Error bars: SE (n = 3). The different letters indicate a significant difference between the transgenic lines (p < 0.05).
3. Discussion
The green revolution has improved crop yields, thereby meeting the demands of the growing world population [,,,]. Rice is one of the major cereals in demand, consumed by more than 1 billion people every day []. Therefore, understanding the molecular mechanisms underlying the transcription of genes that regulate rice productivity is important.
During plant growth, the response of plants to various environmental and developmental signals requires the precise expression of functional genes. Transcription factors play important roles in this process. For example, NLP transcription factors play a key role in nitrate regulation in higher plants []. In Arabidopsis, NLP7, a member of the RWPPK TF family, can bind to many nitrate signaling and assimilation genes to regulate their expression and response to plant primary nitrate [,,,]. The transcription factor TCP20 regulates root foraging for nitrate by binding to the nitrate enhancer fragment of NIA1 and NRT2.1 [,,]. In rice, the TATA-box binding protein OsTBP2.1, a ubiquitous transcription factor, combines with the cis-acting element −89 to −77 bp upstream of the gene OsNRT2.3 ATG and regulates the transcription of OsNRT2.3 to OsNRT2.3a and OsNRT2.3b (Figure 3; Figure 5). Transcription factors regulate gene transcription by binding to cis-acting elements. Therefore, these cis-acting elements play an important role in the transcriptional regulation of each gene, and mutations in key cis-acting elements affect gene regulation. For example, OsMADS57, a MADS-box transcription factor, can bind to the CArG motif [CATTTTATAG] on the OsNRT2.3a promoter and regulate nitrate translocation from roots to shoots []. The cis-acting element TATA-box controls the transcription of OsNRT2.3 via binding with OsTBP2.1. In this study, when the TATA-box was mutated, OsTBP2.1 decreased the binding ability and altered the transcription pattern of OsNRT2.3, thereby increasing the proportion of OsNRT2.3b to OsNRT2.3a Figure 5B,C and Figure 7). The TATA-box in OsNRT2.3b plays an important regulatory role in the splicing pattern of OsNRT2.3 to OsNRT2.3a and OsNRT2.3b, and the OsNRT2.3 5′UTR mutation changed the splicing mode of OsNRT2.3.
In addition, the 5′UTR plays regulatory roles in RNA translation, stability, and transcription. The number and length of introns in the 5′UTR can influence gene expression []. Key cis-acting elements that are also on the 5′UTR containing the first intron exist on the promoter, and introns can enhance transcription in plants [,]. The 5′UTR containing the first intron upstream of ZmBCH2 can enhance gusA expression in transgenic rice []. In our study, we found that a complete promoter of OsNRT2.3 promoted the expression of both OsNRT2.3a and OsNRT2.3b; however, the presence of the intron at the 5′UTR of OsNRT2.3a promoted OsNRT2.3a expression and inhibited OsNRT2.3b transcription. However, when there was a mutation in the TATA-box of OsNRT2.3, the natural balance was disrupted (Figure 6 and Figure 7). In natural variation and selection, species tend to develop in favorable directions. Mutations in OsNRT2.3b 5′UTR can accelerate breeding and increase NUE. The different isoforms of OsNRT2.3 are expressed in different locations, with OsNRT2.3b primarily expressed at the shoot and OsNRT2.3a primarily expressed at the root []. This mechanism also reveals how OsNRT2.3 is efficiently transcribed into its two isoforms. This mechanism may be affected by other factors, such as the length of the OsNRT2.3 promoter and the binding ability of OsTBP2.1 (Figure 5B,C, Figure 6 and Figure 7). Rice genotypes with higher levels of OsNRT2.3b than OsNRT2.3a can alter N absorption and transport efficiency factors that influence NUE and yield []. High expression of OsTBP2.1 promoted rice growth and increased yield, whereas low expression exhibited the opposite trend ( Figure 1, Figures S1 and S3). Therefore, OsTBP2.1 positively regulates rice growth, yield, and N uptake by changing the ratio of OsNRT2.3 transcription to OsNRT2.3b and OsNRT2.3a (Figure 1, Figure 3 and Figure 4).
Additionally, it is generally believed that transcription factor IID (TFIID), including TBP-associated factor (TAFs) and TATA-binding protein (TBP) genes, is mandatory for the precise transcription initiation of core promoters, which limited their role only to transcriptional activity. However, this was disproved; it was revealed that TAFs are required for plant growth. Moreover, each TAF is needed for the transcription of a limited subset of genes, ranging from 3% to 67% of the total number of expressed genes []. Alterations in conserved transcription factors typically alter transcription patterns or transcription levels of multiple genes. For example, the knockdown of OsTBP2.2, a gene belonging to the same family as OsTBP2.1, affects multiple main pathways and downregulates the expression of OsPIP2;6, OsPAO, and OsRCCR1 genes, thereby inhibiting photosynthesis and growth in rice []. Altering the transcript abundance of OsTBP2.1 altered the expression of nitrogen-related genes, such as OsNRT2.1 (Os02g0112100), OsNRT2.2 (Os02g0112600), OsNRT2.3a, and OsNRT2.3b, thereby affecting nitrogen uptake and yield in rice (Figure 2, Figure 3, Figure 4 and Figure S4). OsTBP2.1 is the regulatory switch for the transcription of OsNRT2.3, OsNRT2.3a, and OsNRT2.3b.
Another way in which OsTBP2.1 regulates rice yield may be through the regulation of the F-box/FBD/LRR-repeat protein gene Os070158900. The spatial and temporal gene expression of F-box proteins is induced during seed development and panicle formation [], regulated by the mRNA expression of OsTBP2.1 (Figure 1 and Figure 2). These possible pathways between growth-regulating proteins from the F-Box and LRR families are upregulated by OsTBP2.1 in accordance with GO and KEGG and predict the role of OsTBP2.1 in reproductive growth and seed formation.
4. Conclusions
In summary, this study reveals that the length of the OsNRT2.3 promoter and the TATA-box cis-acting element together affect the ratio of OsNRT2.3 transcription to OsNRT2.3b and OsNRT2.3a. Additionally, the TATA-box binding protein OsTBP2.1 can affect the growth and yield of rice by combining with the OsNRT2.3 TATA-box to regulate the transcription of OsNRT2.3a and OsNRT2.3b. This comprehensive understanding of how OsNRT2.3a and OsNRT2.3b are regulated reveals a novel path for molecular research and the molecular breeding of plants.
5. Materials and Methods
5.1. Plant Materials
In this study, the Huang Yang (WT-HY), Wuyunjing 27 (WT-W27), and Nipponbare (WT-N) rice ecotypes were used. The T-DNA insertion mutant lines, 1A-19324 and 2B-30161, belong to the WT-HY ecotype. T-DNA insertion mutant lines were obtained from Hyung Hee University, Korea. We used the WT-W27 ecotype to create the OsTBP2.1 overexpression lines, OE198 and OE399. We used the pUbi promoter to construct the OsTBP2.1 overexpression vector (pUbi::OsTBP2.1) in the pTCK303 expression vector and transcribed this into the WT-W27 ecotype to obtain the OsTBP2.1 overexpression lines.
The OsNRT2.3 promoters were obtained from the WT-N ecotype. We amplified different lengths (such as 697 and 141 bp) of the OsNRT2.3 promoter from Nipponbare. We generated a −83 bp mutant in the 141 and 697 bp promoters to investigate whether this affected the expression ratio of OsNRT2.3a and OsNRT2.3b. The promoters of different lengths drove the 437 bp open reading frame (ORF) of OsNRT2.3. To better differentiate between OsNRT2.3a and OsNRT2.3b, we linked the 437 bp ORF with the sequence of ZǀǀǀB (cctgcaggtcgccac attagcaatgccacattagcaatgccgactctagaggatccc) in pCAMBIA1300. The expression vectors were transferred into Agrobacterium tumefaciens (EHA105) via electroporation and then transformed into rice. The primers are shown in Table S1.
5.2. Plant Growth Conditions
For the field experiments, the lines used in this study were grown in plots at Nanjing Agricultural University in Nanjing, Jiangsu. The chemical properties of the soils in the plots have been described by Chen et al. [].
For hydroponic experiments, the lines used in this study were surface-sterilized with 30% (v/v) NaClO for 30 min and then rinsed thoroughly with water. Seedlings were grown in an artificial climate chamber with a 16 h light (30 °C) and 8 h dark (26 °C) cycle.
5.3. Southern Blot Analysis
Southern blotting was performed as described []. Briefly, genomic DNAs of OsTBP2.1 overexpression lines and WT-W27 were extracted and digested with the restriction enzymes Hind III and EcoR I overnight. The digested genomic DNAs were then transferred to a Hybond-N+ nylon membrane. A hygromycin-resistant probe was used to hybridize the digested genomic DNAs onto a Hybond-N+ nylon membrane.
5.4. 15N Uptake Experiments
15N influx was conducted to determine 15NH4+ and 15NO3− uptake in the lines of the T-DNA insertion mutant, OsTBP2.1 overexpression lines, and wild-type plants (WT-HY and WT-W27). The plants were grown in hydroponics with IRRI nutrient solution for two weeks, followed by N starvation for three days. After N starvation, the plants were initially moved to 0.1 mM CaSO4 for 1 min, and they were then separately exposed to 0.2 mM 15NH4+, 0.2 mM 15NO3−, 2.5 mM 15NH4+, and 2.5 mM 15NO3− for 5 min each. The seedlings were then transferred to 0.1 mM CaSO4 for 1 min before sampling. All plants were maintained at 105 °C for 30 min to inactivate the enzymes. The powder of each sample was analyzed using an isotope ratio mass spectrometer system (Flash 2000 HT, Thermo Fisher Scientific, Brunswick, Germany).
5.5. RNA-Seq Analysis
Total RNA was extracted from the shoots and roots of the wild-type plants (WT-27, WT-HY), OsTBP2.1 overexpression lines (OE), and OsTBP2.1 T-DNA insertion mutant lines (Mu), with three biological replicates. The samples were tested using Genepioneer software. RNA-seq analysis was performed using an Illumina HiSeq 2000 Plus instrument. The filtered values and reads were aligned with the reference genome using HISAT2 software. HTSeq was used to align the read count values for every gene in comparison to the original expression level of the gene, and the expression level was then normalized using FPKM or fragments differentially expressed between wild-type and transgenic lines. DEGs were defined as genes with an expression difference of (log2FoldChange) >2 and a p-value < 0.05. The identified DEGs were further analyzed using KEGG, GO, nr-annotations, and Swissport annotations [,].
5.6. Quantitative Real-Time PCR
Total RNA was extracted from the field and hydroponic experiments using TRIzol reagent. The extracted RNA was converted into cDNA using the Hiscript Q RT SuperMix for qPCR (+dDNA wiper) kit (Vazyme, Co. R323-01, Nanjing, China). The synthesized cDNA was used as a template in real-time PCR reactions using the AceQ qPCR SYBR Green Master Mix kit (Vazyme, Co. Q311-02, Nanjing, China) and the Step One Plus real-time PCR system (Applied Biosystems, Foster City, CA, USA). The primers are shown in Figure S5 and Table S2.
5.7. Yeast One-Hybrid Assay
The yeast one-hybrid assay was performed according to the manufacturer’s protocol in the “Matchmaker Gold Yeast One-Hybrid Library Screening System User Manual” (Clontech). Briefly, the pTATA-box-pAbAi vector was transferred into the yeast strain and grown on medium lacking uracil (Ura). We used different concentrations of aureobasidin A (AbAr) to test the bait strain in a medium lacking Ura. The vectors of pGADT7:OsTBP2.1 were then transferred to the strains with pTATA-box-pAbAi, and the strains were grown on a medium lacking leucine with 800 ng mL−1 AbAr.
5.8. Promoter Activity Analysis
The 1.5 kb promoter and -83 bp mutation on the 1.5 kb promoter fragments of OsNRT2.3 were amplified from Nipponbare and inserted into the luciferase reporter. The plasmids were transferred into rice protoplasts together with pUbi::OsTBP2.1 and harvested 24 h later. The protoplasts were analyzed using the dual-luciferase reporter assay system (Promega, Cat. E2920) to calculate the ratio of firefly luciferase (LUC) to Renilla (REN) luciferase.
5.9. Statistical Analysis
Data are presented as mean ± standard error (SE) and were analyzed by ANOVA using the statistical software SPSS (version 11.0; SPSS Inc., Chicago, IL, USA). Significant differences were determined using the SPSS Statistics 20 program and one-way ANOVA, followed by Tukey’s test (p < 0.05, one-way ANOVA).
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms231810795/s1.
Author Contributions
X.F. conceptualized and guided the study. Y.Z. performed the statistical analyses and validations and drafted the manuscript. Y.Z. and M.F.I. performed the experiments. X.F., Y.W., K.Q., and J.X. revised the manuscript. G.X. and X.F. performed data interpretation. All authors have read and agreed to the published version of the manuscript.
Funding
This work was supported by National Natural Science Foundation of China (32172665) and the Introduction Project of High-level Talents in Xinjiang Uygur Autonomous Region.
Institutional Review Board Statement
Not applicable.
Data Availability Statement
All data in this article is available from the corresponding author upon reasonable request.
Acknowledgments
We would like to thank the funding sources of National Natural Science Foundation of China (32172665), and the Introduction Project of High-level Talents in Xinjiang Uygur Autonomous Region.
Conflicts of Interest
The authors declare that there are no conflict of interest.
References
- Pingali, P.L. Green revolution: Impacts, limits, and the path ahead. Proc. Natl. Acad. Sci. USA 2012, 109, 12302–12308. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.L.; Zhang, M.; Feng, F.; Tian, Z.X. Toward a “Green Revolution” for Soybean. Mol. Plant 2020, 13, 688–697. [Google Scholar] [CrossRef] [PubMed]
- Evans, J.R.; Lawson, T. From green to gold: Agricultural revolution for food security. J. Exp. Bot. 2020, 71, 2211–2215. [Google Scholar] [CrossRef] [PubMed]
- Chen, K.L.; Wang, Y.P.; Zhang, R.; Zhang, H.W.; Gao, C.X. CRISPR/Cas Genome Editing and Precision Plant Breeding in Agriculture. Annu. Rev. Plant Biol. 2019, 70, 667–697. [Google Scholar] [CrossRef] [PubMed]
- Saunders, C.; Cohen, R.S. The role of oocyte transcription, the 5’UTR, and translation repression and derepression in Drosophila gurken mRNA and protein localization. Mol. Cell 1999, 3, 43–54. [Google Scholar] [CrossRef]
- Yang, N.; Zhang, L.; Zhang, Y.; Kazazian, H.H. An important role for RUNX3 in human L1 transcription and retrotransposition. Nucleic Acids Res. 2003, 31, 4929–4940. [Google Scholar] [CrossRef] [PubMed]
- Popovitchenko, T.; Park, Y.; Page, N.F.; Luo, X.B.; Krsnik, Z.; Liu, Y.; Salamon, I.; Stephenson, J.D.; Kraushar, M.L.; Volk, N.L.; et al. Translational derepression of Elavl4 isoforms at their alternative 5’UTRs determines neuronal development. Nat. Commun. 2020, 11, 1674. [Google Scholar] [CrossRef] [PubMed]
- Proudfoot, N.J.; Furger, A.; Dye, M.J. Integrating mRNA processing with transcription. Cell 2002, 108, 501–512. [Google Scholar] [CrossRef]
- Li, Q.Q.; Liu, Z.; Lu, W.; Man, L.J.R. Interplay between Alternative Splicing and Alternative Polyadenylation Defines the Expression Outcome of the Plant Unique OXIDATIVE TOLERANT-6 Gene. Sci. Rep. 2017, 7, 2052. [Google Scholar] [CrossRef] [PubMed]
- Leviatan, N.; Alkan, N.; Leshkowitz, D.; Fluhr, R. Genome-wide survey of cold stress regulated alternative splicing in Arabidopsis thaliana with tiling microarray. PLoS ONE 2013, 8, e66511. [Google Scholar]
- Baralle, F.E.; Giudice, J. Alternative splicing as a regulator of development and tissue identity. Nat. Rev. Mol. Cell Biol. 2017, 18, 437–451. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Yu, X.; Cheng, Z.; Zeng, C.; Li, W.; Zhang, L.; Peng, M. Large-scale analysis of the cassava transcriptome reveals the impact of cold stress on alternative splicing. J. Exp. Bot. 2020, 71, 422–434. [Google Scholar] [CrossRef] [PubMed]
- Graveley, B.R. Alternative splicing: Increasing diversity in the proteomic world. Trends Genet. 2001, 17, 100–107. [Google Scholar] [CrossRef]
- Nakka, K.; Ghigna, C.; Gabellini, D.; Dilworth, F.J. Diversification of the muscle proteome through alternative splicing. Skelet. Muscle 2018, 8, 8. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.K.; Cooper, T.A. Pre-mRNA splicing in disease and therapeutics. Trends Mol. Med. 2012, 18, 472–482. [Google Scholar] [CrossRef] [PubMed]
- Park, E.; Pan, Z.; Zhang, Z.; Lin, L.; Xing, Y. The Expanding Landscape of Alternative Splicing Variation in Human Populations. Am. J. Hum. Genet. 2018, 102, 11–26. [Google Scholar] [CrossRef] [PubMed]
- Kim, E.; Goren, A.; Ast, G. Alternative splicing: Current perspectives. Bioessays 2008, 30, 38–47. [Google Scholar] [CrossRef] [PubMed]
- Fish, L.; Navickas, A.; Culbertson, B.; Xu, Y.; Nguyen, H.C.B.; Zhang, S.; Hochman, M.; Okimoto, R.; Dill, B.D.; Molina, H.; et al. Nuclear TARBP2 Drives Oncogenic Dysregulation of RNA Splicing and Decay. Mol. Cell 2019, 75, 967–981. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Lin, Z.; Wang, J.; Liu, H.; Zhou, L.; Zhong, S.; Li, Y.; Zhu, C.; Liu, J.; Lin, Z. The tin1 gene retains the function of promoting tillering in maize. Nat. Commun. 2019, 10, 5608. [Google Scholar] [CrossRef] [PubMed]
- Remy, E.; Cabrito, T.R.; Batista, R.A.; Hussein, M.A.; Teixeira, M.C.; Athanasiadis, A.; Sa-Correia, I.; Duque, P. Intron retention in the 5′UTR of the novel ZIF2 transporter enhances translation to promote zinc tolerance in arabidopsis. PLoS Genet. 2014, 10, e1004375. [Google Scholar] [CrossRef] [PubMed]
- Breathnach, R.; Chambon, P. Organization and Expression of Eucaryotic Split Genes Coding for Proteins. Annu. Rev. Biochem. 2003, 50, 349–383. [Google Scholar] [CrossRef] [PubMed]
- Joshi, C.P. An inspection of the domain between putative TATA box and translation start site in 79 plant genes. Nucleic Acids Res. 1987, 15, 6643–6653. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Lv, Y.; Wang, Y.; Rose, J.K.C.; Shen, F.; Han, Z.; Zhang, X.; Xu, X.; Wu, T.; Han, Z. TATA Box Insertion Provides a Selection Mechanism Underpinning Adaptations to Fe Deficiency. Plant Physiol. 2017, 173, 715–727. [Google Scholar] [CrossRef] [PubMed]
- Zhao, B.; Cao, J.F.; Hu, G.J.; Chen, Z.W.; Wang, L.Y.; Shangguan, X.X.; Wang, L.J.; Mao, Y.B.; Zhang, T.Z.; Wendel, J.F. Core cis-element variation confers subgenome-biased expression of a transcription factor that functions in cotton fiber elongation. New Phytol. 2018, 218, 1061–1075. [Google Scholar] [CrossRef] [PubMed]
- Crawford, N.M. Nitrate: Nutrient and signal for plant growth. Plant Cell 1995, 7, 859–868. [Google Scholar] [PubMed]
- Scheible, W.R.; Gonzalez-Fontes, A.; Lauerer, M.; Muller-Rober, B.; Caboche, M.; Stitt, M. Nitrate Acts as a Signal to Induce Organic Acid Metabolism and Repress Starch Metabolism in Tobacco. Plant Cell 1997, 9, 783–798. [Google Scholar] [CrossRef] [PubMed]
- Scheible, W.R.; Morcuende, R.; Czechowski, T.; Fritz, C.; Osuna, D.; Palacios-Rojas, N.; Schindelasch, D.; Thimm, O.; Udvardi, M.K.; Stitt, M. Genome-wide reprogramming of primary and secondary metabolism, protein synthesis, cellular growth processes, and the regulatory infrastructure of Arabidopsis in response to nitrogen. Plant Physiol. 2004, 136, 2483–2499. [Google Scholar] [CrossRef] [PubMed]
- Stitt, M. Nitrate regulation of metabolism and growth. Curr. Opin. Plant Biol. 1999, 2, 178–186. [Google Scholar] [CrossRef]
- Wittkopp, P.J.; Kalay, G. Cis-regulatory elements: Molecular mechanisms and evolutionary processes underlying divergence. Nat. Rev. Genet. 2011, 13, 59–69. [Google Scholar] [CrossRef] [PubMed]
- Torbey, P.; Thierion, E.; Collombet, S.; de Cian, A.; Desmarquet-Trin-Dinh, C.; Dura, M.; Concordet, J.P.; Charnay, P.; Gilardi-Hebenstreit, P. Cooperation, cis-interactions, versatility and evolutionary plasticity of multiple cis-acting elements underlie krox20 hindbrain regulation. PLoS Genet. 2018, 14, e1007581. [Google Scholar] [CrossRef] [PubMed]
- Kinniburgh, A.J. A cis-acting transcription element of the c-myc gene can assume an H-DNA conformation. Nucleic Acids Res. 1989, 17, 7771–7778. [Google Scholar] [CrossRef] [PubMed]
- Li, K.; Zhang, S.; Tang, S.; Zhang, J.; Dong, H.; Yang, S.; Qu, H.; Xuan, W.; Gu, M.; Xu, G. The rice transcription factor Nhd1 regulates root growth and nitrogen uptake by activating nitrogen transporters. Plant Physiol. 2022, 189, 1608–1624. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Su, Q.; Nian, J.; Zhang, J.; Guo, M.; Dong, G.; Hu, J.; Wang, R.; Wei, C.; Li, G.; et al. The Ghd7 transcription factor represses ARE1 expression to enhance nitrogen utilization and grain yield in rice. Mol. Plant 2021, 14, 1012–1023. [Google Scholar] [CrossRef] [PubMed]
- Akmakjian, G.; Bailey-Serres, J. Nitrogen-responsive transcription factor kinetics meter plant growth. Proc. Natl. Acad. Sci. USA 2020, 117, 13196–13198. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Wang, H.; Chen, Y.; Sun, M.; Wang, Y.; Chen, Y. The Transcription Factor NIGT1.2 Modulates Both Phosphate Uptake and Nitrate Influx during Phosphate Starvation in Arabidopsis and Maize. Plant Cell 2020, 32, 3519–3534. [Google Scholar] [CrossRef] [PubMed]
- Iwamoto, M. The transcription factor gene RDD1 promotes carbon and nitrogen transport and photosynthesis in rice. Plant Physiol. Biochem. 2020, 55, 735–742. [Google Scholar] [CrossRef] [PubMed]
- Hu, B.; Jiang, Z.; Wang, W.; Qiu, Y.; Zhang, Z.; Liu, Y.; Li, A.; Gao, X.; Liu, L.; Qian, Y.; et al. Nitrate-NRT1.1B-SPX4 cascade integrates nitrogen and phosphorus signalling networks in plants. Nat. Plants 2019, 5, 401–413. [Google Scholar] [CrossRef] [PubMed]
- Fan, X.; Tang, Z.; Tan, Y.; Zhang, Y.; Luo, B.; Yang, M.; Lian, X.; Shen, Q.; Miller, A.J.; Xu, G. Overexpression of a pH-sensitive nitrate transporter in rice increases crop yields. Proc. Natl. Acad. Sci. USA 2016, 113, 7118–7123. [Google Scholar] [CrossRef] [PubMed]
- Tang, Z.; Fan, X.; Li, Q.; Feng, H.; Miller, A.J.; Shen, Q.; Xu, G. Knockdown of a rice stelar nitrate transporter alters long-distance translocation but not root influx. Plant Physiol. 2012, 160, 2052–2063. [Google Scholar] [CrossRef] [PubMed]
- Yan, M.; Fan, X.; Feng, H.; Miller, A.J.; Shen, Q.; Xu, G. Rice OsNAR2.1 interacts with OsNRT2.1, OsNRT2.2 and OsNRT2.3a nitrate transporters to provide uptake over high and low concentration ranges. Plant Cell Environ. 2011, 34, 1360–1372. [Google Scholar] [CrossRef] [PubMed]
- Feng, H.; Li, B.; Zhi, Y.; Chen, J.; Li, R.; Xia, X.; Xu, G.; Fan, X. Overexpression of the nitrate transporter, OsNRT2.3b, improves rice phosphorus uptake and translocation. Plant Cell Rep. 2017, 36, 1287–1296. [Google Scholar] [CrossRef] [PubMed]
- Luo, B.; Xu, M.; Zhao, L.; Xie, P.; Chen, Y.; Harwood, W.; Xu, G.; Fan, X.; Miller, A.J. Overexpression of the High-Affinity Nitrate Transporter OsNRT2.3b Driven by Different Promoters in Barley Improves Yield and Nutrient Uptake Balance. Int. J. Mol. Sci. 2020, 21, 1320. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Liu, X.; Liu, S.; Fan, X.; Zhao, L.; Song, M.; Fan, X.; Xu, G. Co-Overexpression of OsNAR2.1 and OsNRT2.3a Increased Agronomic Nitrogen Use Efficiency in Transgenic Rice Plants. Front. Plant Sci. 2020, 11, 1245. [Google Scholar] [CrossRef] [PubMed]
- Khush, G.S. Green revolution: Preparing for the 21st century. Genome 1999, 42, 646–655. [Google Scholar] [CrossRef] [PubMed]
- Evenson, R.E.; Gollin, D. Assessing the impact of the green revolution, 1960 to 2000. Science 2003, 300, 758–762. [Google Scholar] [CrossRef] [PubMed]
- Hedden, P. The genes of the Green Revolution. Trends Genet. 2003, 19, 5–9. [Google Scholar] [CrossRef]
- Wing, R.A.; Purugganan, M.D.; Zhang, Q. The rice genome revolution: From an ancient grain to Green Super Rice. Nat. Rev. Genet. 2018, 19, 505–517. [Google Scholar] [CrossRef] [PubMed]
- Konishi, M.; Yanagisawa, S. The role of protein-protein interactions mediated by the PB1 domain of NLP transcription factors in nitrate-inducible gene expression. BMC Plant Biol. 2019, 19, 90. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Xing, X.; Wang, Y.; Tran, A.; Crawford, N.M. A genetic screen for nitrate regulatory mutants captures the nitrate transporter gene NRT1.1. Plant Physiol. 2009, 151, 472–478. [Google Scholar] [CrossRef] [PubMed]
- Castaings, L.; Camargo, A.; Pocholle, D.; Gaudon, V.; Texier, Y.; Boutet-Mercey, S.; Taconnat, L.; Renou, J.P.; Daniel-Vedele, F.; Fernandez, E.; et al. The nodule inception-like protein 7 modulates nitrate sensing and metabolism in Arabidopsis. Plant J. 2009, 57, 426–435. [Google Scholar] [CrossRef] [PubMed]
- Konishi, M.; Yanagisawa, S. Arabidopsis NIN-like transcription factors have a central role in nitrate signalling. Nat. Commun. 2013, 4, 1617. [Google Scholar] [CrossRef] [PubMed]
- Marchive, C.; Roudier, F.; Castaings, L.; Brehaut, V.; Blondet, E.; Colot, V.; Meyer, C.; Krapp, A. Nuclear retention of the transcription factor NLP7 orchestrates the early response to nitrate in plants. Nat. Commun. 2013, 4, 1713. [Google Scholar] [CrossRef] [PubMed]
- Girin, T.; Lejay, L.; Wirth, J.; Widiez, T.; Palenchar, P.M.; Nazoa, P.; Touraine, B.; Gojon, A.; Lepetit, M. Identification of a 150 bp cis-acting element of the AtNRT2.1 promoter involved in the regulation of gene expression by the N and C status of the plant. Plant Cell Environ. 2007, 30, 1366–1380. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Guan, P.; Chen, M.; Xing, X.; Zhang, Y.; Crawford, N.M. Multiple regulatory elements in the Arabidopsis NIA1 promoter act synergistically to form a nitrate enhancer. Plant Physiol. 2010, 154, 423–432. [Google Scholar] [CrossRef] [PubMed]
- Guan, P.; Wang, R.; Nacry, P.; Breton, G.; Kay, S.A.; Pruneda-Paz, J.L.; Davani, A.; Crawford, N.M. Nitrate foraging by Arabidopsis roots is mediated by the transcription factor TCP20 through the systemic signaling pathway. Proc. Natl. Acad. Sci. USA 2014, 111, 15267–15272. [Google Scholar] [CrossRef] [PubMed]
- Huang, S.; Liang, Z.; Chen, S.; Sun, H.; Fan, X.; Wang, C.; Xu, G.; Zhang, Y. A Transcription Factor, OsMADS57, Regulates Long-Distance Nitrate Transport and Root Elongation. Plant Physiol. 2019, 180, 882–895. [Google Scholar] [CrossRef] [PubMed]
- Chung, B.Y.; Simons, C.; Firth, A.E.; Brown, C.M.; Hellens, R.P.J.B.G. Effect of 5′UTR introns on gene expression in Arabidopsis thaliana. BMC Genom. 2006, 7, 120. [Google Scholar] [CrossRef] [PubMed]
- Hernandez-Garcia, C.M.; Finer, J.J. Identification and validation of promoters and cis-acting regulatory elements. Plant Sci. 2014, 217–218, 109–119. [Google Scholar] [CrossRef] [PubMed]
- Gallegos, J.E.; Rose, A.B. The enduring mystery of intron-mediated enhancement. Plant Sci. 2015, 237, 8–15. [Google Scholar] [CrossRef] [PubMed]
- Xin, J.; Chao, B.; Bassie, L.; Nogareda, C.; Romagosa, I.; Twyman, R.M.; Christou, P.; Zhu, C.J.N.P. ZmPBF and ZmGAMYB transcription factors independently transactivate the promoter of the maize (Zea mays) β-arotene hydroxylase 2 gene. New Phytol. 2019, 222, 793–804. [Google Scholar]
- Green, M.R. TBP-associated factors (TAFIIs): Multiple, selective transcriptional mediators in common complexes. Trends Biochem. Sci. 2000, 25, 59–63. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhao, L.; Xiao, H.; Chew, J.; Xiang, J.; Qian, K.; Fan, X. Knockdown of a Novel Gene OsTBP2.2 Increases Sensitivity to Drought Stress in Rice. Genes 2020, 11, 629. [Google Scholar] [CrossRef] [PubMed]
- Jain, M.; Nijhawan, A.; Arora, R.; Agarwal, P.; Ray, S.; Sharma, P.; Kapoor, S.; Tyagi, A.K.; Khurana, J.P. F-box proteins in rice. Genome-wide analysis, classification, temporal and spatial gene expression during panicle and seed development, and regulation by light and abiotic stress. Plant Physiol. 2007, 143, 1467–1483. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Zhang, Y.; Tan, Y.; Zhang, M.; Zhu, L.; Xu, G.; Fan, X. Agronomic nitrogen-use efficiency of rice can be increased by driving OsNRT2.1 expression with the OsNAR2.1 promoter. Plant Biotechnol. J. 2016, 14, 1705–1715. [Google Scholar] [CrossRef] [PubMed]
- Jia, H.; Ren, H.; Gu, M.; Zhao, J.; Sun, S.; Zhang, X.; Chen, J.; Wu, P.; Xu, G. The phosphate transporter gene OsPht1;8 is involved in phosphate homeostasis in rice. Plant Physiol. 2011, 156, 1164–1175. [Google Scholar] [PubMed]
- Zhang, S.; Zhang, Y.; Li, K.; Yan, M.; Zhang, J.; Yu, M.; Tang, S.; Wang, L.; Qu, H.; Luo, L.; et al. Nitrogen Mediates Flowering Time and Nitrogen Use Efficiency via Floral Regulators in Rice. Curr. Biol. 2021, 31, 671–683. [Google Scholar] [CrossRef] [PubMed]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).