Levetiracetam Suppresses the Infiltration of Neutrophils and Monocytes and Downregulates Many Inflammatory Cytokines during Epileptogenesis in Pilocarpine-Induced Status Epilepticus Mice
Abstract
:1. Introduction
2. Results
2.1. CD11b+CD45high Cells Infiltrate the Brain after Pilocarpine-Induced Status Epilepticus (SE)
2.2. Characterization of CD11b+CD45high Infiltrating Cells
2.3. LEV Suppresses the Infiltration of CD11b+CD45high Cells into the Brain and the Expression of Inflammatory Cytokines after SE
2.4. Depletion of Circulating Neutrophils Suppresses Increased Cytokine Expression after SE
3. Discussion
4. Materials and Methods
4.1. Experimental Animals
4.2. Pilocarpine-Induced Status Epilepticus (SE) Model and Seizure Assessment
4.3. Administration of LEV and Antibodies
4.4. Isolation of Immune Cell Fractions from the Hippocampus and Analysis of Microglia and Infiltrating Leukocytes
4.5. Flow Cytometry Analysis of Blood Samples
4.6. RNA Isolation and Real-Time PCR
4.7. Proteome Profiler Mouse Cytokine Array
4.8. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jacobs, M.P.; Leblanc, G.G.; Brooks-Kayal, A.; Jensen, F.E.; Lowenstein, D.H.; Noebels, J.L.; Spencer, D.D.; Swann, J.W. Curing epilepsy: Progress and future directions. Epilepsy Behav. 2009, 14, 438–445. [Google Scholar] [CrossRef] [Green Version]
- Temkin, N.R. Risk factors for posttraumatic seizures in adults. Epilepsia 2003, 44, 18–20. [Google Scholar] [CrossRef]
- Temkin, N.R. Preventing and treating posttraumatic seizures: The human experience. Epilepsia 2009, 50 (Suppl. 2), 10–13. [Google Scholar] [CrossRef]
- Temkin, N.R. Antiepileptogenesis and seizure prevention trials with antiepileptic drugs: Meta-analysis of controlled trials. Epilepsia 2001, 42, 515–524. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vezzani, A. Epilepsy and inflammation in the brain: Overview and pathophysiology. Epilepsy Curr. 2014, 14, 3–7. [Google Scholar] [CrossRef]
- Eyo, U.B.; Murugan, M.; Wu, L.J. Microglia-Neuron Communication in Epilepsy. Glia 2017, 65, 5–18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tian, D.-S.; Peng, J.; Murugan, M.; Feng, L.-J.; Liu, J.-L.; Eyo, U.; Zhou, L.-J.; Mogilevsky, R.; Wang, W.; Wu, L.-J. Chemokine CCL2–CCR2 Signaling Induces Neuronal Cell Death via STAT3 Activation and IL-1β Production after Status Epilepticus. J. Neurosci. 2017, 37, 7878–7892. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Avignone, E.; Ulmann, L.; Levavasseur, F.; Rassendren, F.; Audinat, E. Status epilepticus induces a particular microglial activation state characterized by enhanced purinergic signaling. J. Neurosci. 2008, 28, 9133–9144. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bosco, D.B.; Zheng, J.; Xu, Z.; Peng, J.; Eyo, U.B.; Tang, K.; Yan, C.; Huang, J.; Feng, L.; Wu, G.; et al. RNAseq analysis of hippocampal microglia after kainic acid-induced seizures. Mol. Brain 2018, 11, 34. [Google Scholar] [CrossRef] [PubMed]
- Feng, L.; Murugan, M.; Bosco, D.B.; Liu, Y.; Peng, J.; Worrell, G.A.; Wang, H.; Ta, L.E.; Richardson, J.; Shen, Y.; et al. Microglial proliferation and monocyte infiltration contribute to microgliosis following status epilepticus. Glia 2019, 67, 1434–1448. [Google Scholar] [CrossRef]
- Varvel, N.H.; Neher, J.J.; Bosch, A.; Wang, W.; Ransohoff, R.M.; Miller, R.J.; Dingledine, R. Infiltrating monocytes promote brain inflammation and exacerbate neuronal damage after status epilepticus. Proc. Natl. Acad. Sci. USA 2016, 113, E5665–E5674. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jiang, J.; Quan, Y.; Ganesh, T.; Pouliot, W.A.; Dudek, F.E.; Dingledine, R. Inhibition of the prostaglandin receptor EP2 following status epilepticus reduces delayed mortality and brain inflammation. Proc. Natl. Acad. Sci. USA 2013, 110, 3591–3596. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maroso, M.; Balosso, S.; Ravizza, T.; Iori, V.; Wright, C.I.; French, J.; Vezzani, A. Interleukin-1beta biosynthesis inhibition reduces acute seizures and drug resistant chronic epileptic activity in mice. Neurotherapeutics 2011, 8, 304–315. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rojas, A.; Ganesh, T.; Lelutiu, N.; Gueorguieva, P.; Dingledine, R. Inhibition of the prostaglandin EP2 receptor is neuroprotective and accelerates functional recovery in a rat model of organophosphorus induced status epilepticus. Neuropharmacology 2015, 93, 15–27. [Google Scholar] [CrossRef] [Green Version]
- Lyseng-Williamson, K.A. Levetiracetam: A review of its use in epilepsy. Drugs 2011, 71, 489–514. [Google Scholar] [CrossRef] [PubMed]
- Itoh, K.; Inamine, M.; Oshima, W.; Kotani, M.; Chiba, Y.; Ueno, M.; Ishihara, Y. Prevention of status epilepticus-induced brain edema and neuronal cell loss by repeated treatment with high-dose levetiracetam. Brain Res. 2015, 1608, 225–234. [Google Scholar] [CrossRef]
- Itoh, K.; Ishihara, Y.; Komori, R.; Nochi, H.; Taniguchi, R.; Chiba, Y.; Ueno, M.; Takata-Tsuji, F.; Dohgu, S.; Kataoka, Y. Levetiracetam treatment influences blood-brain barrier failure associated with angiogenesis and inflammatory responses in the acute phase of epileptogenesis in post-status epilepticus mice. Brain Res. 2016, 1652, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Lynch, B.A.; Lambeng, N.; Nocka, K.; Kensel-Hammes, P.; Bajjalieh, S.M.; Matagne, A.; Fuks, B. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA 2004, 101, 9861–9866. [Google Scholar] [CrossRef] [Green Version]
- Meehan, A.L.; Yang, X.; Yuan, L.L.; Rothman, S.M. Levetiracetam has an activity-dependent effect on inhibitory transmission. Epilepsia 2012, 53, 469–476. [Google Scholar] [CrossRef]
- Itoh, K.; Taniguchi, R.; Matsuo, T.; Oguro, A.; Vogel, C.F.A.; Yamazaki, T.; Ishihara, Y. Suppressive effects of levetiracetam on neuroinflammation and phagocytic microglia: A comparative study of levetiracetam, valproate and carbamazepine. Neurosci. Lett. 2019, 708, 134363. [Google Scholar] [CrossRef]
- Martin, E.; El-Behi, M.; Fontaine, B.; Delarasse, C. Analysis of Microglia and Monocyte-derived Macrophages from the Central Nervous System by Flow Cytometry. J. Vis. Exp. 2017, 124, e55781. [Google Scholar] [CrossRef] [PubMed]
- Brandenburg, S.; Blank, A.; Bungert, A.D.; Vajkoczy, P. Distinction of Microglia and Macrophages in Glioblastoma: Close Relatives, Different Tasks? Int. J. Mol. Sci. 2020, 22, 194. [Google Scholar] [CrossRef] [PubMed]
- Martin, E.; Boucher, C.; Fontaine, B.; Delarasse, C. Distinct inflammatory phenotypes of microglia and monocyte-derived macrophages in Alzheimer’s disease models: Effects of aging and amyloid pathology. Aging Cell 2016, 16, 27–38. [Google Scholar] [CrossRef] [PubMed]
- Zattoni, M.; Mura, M.L.; Deprez, F.; Schwendener, R.A.; Engelhardt, B.; Frei, K.; Fritschy, J.M. Brain infiltration of leukocytes contributes to the pathophysiology of temporal lobe epilepsy. J. Neurosci. 2011, 31, 4037–4050. [Google Scholar] [CrossRef] [Green Version]
- Saiwai, H.; Kumamaru, H.; Ohkawa, Y.; Kubota, K.; Kobayakawa, K.; Yamada, H.; Yokomizo, T.; Iwamoto, Y.; Okada, S. Ly6C+ Ly6G- Myeloid-derived suppressor cells play a critical role in the resolution of acute inflammation and the subsequent tissue repair process after spinal cord injury. J. Neurochem. 2013, 125, 74–88. [Google Scholar] [CrossRef]
- Rosell, A.; Cuadrado, E.; Ortega-Aznar, A.; Hernandez-Guillamon, M.; Lo, E.H.; Montaner, J. MMP-9-positive neutrophil infiltration is associated to blood-brain barrier breakdown and basal lamina type IV collagen degradation during hemorrhagic transformation after human ischemic stroke. Stroke 2008, 39, 1121–1126. [Google Scholar] [CrossRef] [Green Version]
- Justicia, C.; Panés, J.; Solé, S.; Cervera, A.; Deulofeu, R.; Chamorro, A.; Planas, A.M. Neutrophil Infiltration Increases Matrix Metalloproteinase-9 in the Ischemic Brain after Occlusion/Reperfusion of the Middle Cerebral Artery in Rats. J. Cereb. Blood Flow Metab. 2003, 23, 1430–1440. [Google Scholar] [CrossRef] [Green Version]
- Hayashi, T.; Kaneko, Y.; Yu, S.; Bae, E.; Stahl, C.E.; Kawase, T.; van Loveren, H.; Sanberg, P.R.; Borlongan, C.V. Quantitative analyses of matrix metalloproteinase activity after traumatic brain injury in adult rats. Brain Res. 2009, 1280, 172–177. [Google Scholar] [CrossRef]
- Simmons, S.B.; Liggitt, D.; Goverman, J.M. Cytokine-Regulated Neutrophil Recruitment Is Required for Brain but Not Spinal Cord Inflammation during Experimental Autoimmune Encephalomyelitis. J. Immunol. 2014, 193, 555–563. [Google Scholar] [CrossRef] [Green Version]
- Christy, A.L.; Walker, M.E.; Hessner, M.J.; Brown, M.A. Mast cell activation and neutrophil recruitment promotes early and robust inflammation in the meninges in EAE. J. Autoimmun. 2013, 42, 50–61. [Google Scholar] [CrossRef]
- Moxon-Emre, I.; Schlichter, L.C. Neutrophil Depletion Reduces Blood-Brain Barrier Breakdown, Axon Injury, and Inflammation After Intracerebral Hemorrhage. J. Neuropathol. Exp. Neurol. 2011, 70, 218–235. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gidday, J.M.; Gasche, Y.G.; Copin, J.-C.; Shah, A.R.; Perez, R.S.; Shapiro, S.D.; Chan, P.H.; Park, T.S. Leukocyte-derived matrix metalloproteinase-9 mediates blood-brain barrier breakdown and is proinflammatory after transient focal cerebral ischemia. Am. J. Physiol. Circ. Physiol. 2005, 289, H558–H568. [Google Scholar] [CrossRef] [PubMed]
- Binder, D.K.; Steinhäuser, C. Astrocytes and Epilepsy. Neurochem. Res. 2021, 46, 2687–2695. [Google Scholar] [CrossRef] [PubMed]
- Clasadonte, J.; Dong, J.; Hines, D.J.; Haydon, P.G. Astrocyte control of synaptic NMDA receptors contributes to the progressive development of temporal lobe epilepsy. Proc. Natl. Acad. Sci. USA 2013, 110, 17540–17545. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Small, C.; Dagra, A.; Martinez, M.; Williams, E.; Lucke-Wold, B. Examining the role of astrogliosis and JNK signaling in post-traumatic epilepsy. Egypt. J. Neurosurg. 2022, 37, 1. [Google Scholar] [CrossRef] [PubMed]
- Tai, T.Y.; Warner, L.N.; Jones, T.D.; Jung, S.; Concepcion, F.A.; Skyrud, D.W.; Fender, J.; Liu, Y.; Williams, A.D.; Neumaier, J.F.; et al. Antiepileptic action of c-Jun N-terminal kinase (JNK) inhibition in an animal model of temporal lobe epilepsy. Neuroscience 2017, 349, 35–47. [Google Scholar] [CrossRef] [Green Version]
- Lu, R.; Cui, S.-S.; Wang, X.-X.; Chen, L.; Liu, F.; Gao, J.; Wang, W. Astrocytic c-Jun N-terminal kinase-histone deacetylase-2 cascade contributes to glutamate transporter-1 decrease and mechanical allodynia following peripheral nerve injury in rats. Brain Res. Bull. 2021, 175, 213–223. [Google Scholar] [CrossRef]
- Lucke-Wold, B.P.; Nguyen, L.; Turner, R.C.; Logsdon, A.F.; Chen, Y.W.; Smith, K.E.; Huber, J.D.; Matsumoto, R.; Rosen, C.L.; Tucker, E.S.; et al. Traumatic brain injury and epilepsy: Underlying mechanisms leading to seizure. Seizure 2015, 33, 13–23. [Google Scholar] [CrossRef] [Green Version]
- Loscher, W.; Brandt, C. Prevention or modification of epileptogenesis after brain insults: Experimental approaches and translational research. Pharmacol. Rev. 2010, 62, 668–700. [Google Scholar] [CrossRef] [Green Version]
- Belcastro, V.; Costa, C.; Galletti, F.; Autuori, A.; Pierguidi, L.; Pisani, F.; Calabresi, P.; Parnetti, L. Levetiracetam in newly diagnosed late-onset post-stroke seizures: A prospective observational study. Epilepsy Res. 2008, 82, 223–226. [Google Scholar] [CrossRef]
- Klein, P.; Herr, D.; Pearl, P.L.; Natale, J.; Levine, Z.; Nogay, C.; Sandoval, F.; Trzcinski, S.; Atabaki, S.M.; Tsuchida, T.; et al. Results of Phase 2 Safety and Feasibility Study of Treatment With Levetiracetam for Prevention of Posttraumatic Epilepsy. Arch. Neurol. 2012, 69, 1290–1295. [Google Scholar] [CrossRef]
- Pearl, P.L.; McCarter, R.; McGavin, C.L.; Yu, Y.; Sandoval, F.; Trzcinski, S.; Atabaki, S.M.; Tsuchida, T.; Anker, J.V.D.; He, J.; et al. Results of phase II levetiracetam trial following acute head injury in children at risk for posttraumatic epilepsy. Epilepsia 2013, 54, e135–e137. [Google Scholar] [CrossRef] [PubMed]
- Zeng, T.-F.; Li, Y.-H.; An, D.-M.; Chen, L.; Lei, D.; Zhang, B.; Li, J.-M.; Zhou, N. Effectiveness of levetiracetam use following resective surgery in patients with refractory epilepsy: A prospective observational study. Epilepsy Res. 2014, 108, 1904–1911. [Google Scholar] [CrossRef] [PubMed]
- Kundu, B.; Lucke-Wold, B.; Foster, C.; Englot, D.J.; Urhie, O.; Nwafor, D.; Rolston, J.D. Fornicotomy for the Treatment of Epilepsy: An Examination of Historical Literature in the Setting of Modern Operative Techniques. Neurosurgery 2019, 87, 157–165. [Google Scholar] [CrossRef] [PubMed]
- Racine, R.J. Modification of seizure activity by electrical stimulation: II. Motor seizure. Electroencephalogr. Clin. Neurophysiol. 1972, 32, 281–294. [Google Scholar] [CrossRef]
Target | Forward Primer | Reverse Primer |
---|---|---|
Actb | CTAGGCACCAGGGTGTGATG | GGGGTACTTCAGGGTCAGGA |
Tmem119 | GTGTCTAACAGGCCCCAGAA | AGCCACGTGGTATCAAGGAG |
IL-1β | GGCTGCTTCCAAACCTTTGA | ACGGGAAAGACACAGGTAGC |
TNFα | ACGTGGAACTGGCAGAAGAG | GACCGATCACCCCGAAGTTC |
Ccr2 | TCCCTGGTATTCATCTTTGG | TTATGTTCCCAAAGACCCAC |
IL-6 | CTTCCATCCAGTTGCCTTCT | AATTAAGCCTCCGACTTGTG |
IL-10 | CTCTTACTGACTGGCATGAG | GTATGTTGTCCAGCTGGTCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Matsuo, T.; Komori, R.; Nakatani, M.; Ochi, S.; Yokota-Nakatsuma, A.; Matsumoto, J.; Takata, F.; Dohgu, S.; Ishihara, Y.; Itoh, K. Levetiracetam Suppresses the Infiltration of Neutrophils and Monocytes and Downregulates Many Inflammatory Cytokines during Epileptogenesis in Pilocarpine-Induced Status Epilepticus Mice. Int. J. Mol. Sci. 2022, 23, 7671. https://doi.org/10.3390/ijms23147671
Matsuo T, Komori R, Nakatani M, Ochi S, Yokota-Nakatsuma A, Matsumoto J, Takata F, Dohgu S, Ishihara Y, Itoh K. Levetiracetam Suppresses the Infiltration of Neutrophils and Monocytes and Downregulates Many Inflammatory Cytokines during Epileptogenesis in Pilocarpine-Induced Status Epilepticus Mice. International Journal of Molecular Sciences. 2022; 23(14):7671. https://doi.org/10.3390/ijms23147671
Chicago/Turabian StyleMatsuo, Taira, Rie Komori, Minami Nakatani, Shiori Ochi, Aya Yokota-Nakatsuma, Junichi Matsumoto, Fuyuko Takata, Shinya Dohgu, Yasuhiro Ishihara, and Kouichi Itoh. 2022. "Levetiracetam Suppresses the Infiltration of Neutrophils and Monocytes and Downregulates Many Inflammatory Cytokines during Epileptogenesis in Pilocarpine-Induced Status Epilepticus Mice" International Journal of Molecular Sciences 23, no. 14: 7671. https://doi.org/10.3390/ijms23147671
APA StyleMatsuo, T., Komori, R., Nakatani, M., Ochi, S., Yokota-Nakatsuma, A., Matsumoto, J., Takata, F., Dohgu, S., Ishihara, Y., & Itoh, K. (2022). Levetiracetam Suppresses the Infiltration of Neutrophils and Monocytes and Downregulates Many Inflammatory Cytokines during Epileptogenesis in Pilocarpine-Induced Status Epilepticus Mice. International Journal of Molecular Sciences, 23(14), 7671. https://doi.org/10.3390/ijms23147671