The Significance of the DUF283 Domain for the Activity of Human Ribonuclease Dicer
Abstract
:1. Introduction
2. Results
2.1. Production of the hDicer DUF283 Deletion Variant
2.2. RNase Activity of the hDicer DUF283 Deletion Variant
2.3. The RNA-RNA Base Pairing Potential of the hDicer DUF283 Domain Deletion Variant
3. Discussion
4. Materials and Methods
4.1. Oligonucleotides
4.2. 32P Labeling of Oligonucleotides
4.3. Preparation of dsRNA
4.4. Preparation of the ∆DUF(625-752) and ΔDUF(630-709) Expression Plasmids
4.5. Cell Culture and Transfection
4.6. Immunoprecipitation
4.7. Western Blot Analysis
4.8. The RNA Cleavage Assay
4.9. Reverse Transcription and Quantitative PCR
4.10. Annealing Assay
4.11. Gel Imaging and Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tili, E.; Michaille, J.-J.; Costinean, S.; Croce, C.M. MicroRNAs, the immune system and rheumatic disease. Nat. Clin. Pract. Rheumatol. 2008, 4, 534–541. [Google Scholar] [CrossRef]
- Song, M.-S.; Rossi, J.J. Molecular mechanisms of Dicer: Endonuclease and enzymatic activity. Biochem. J. 2017, 474, 1603–1618. [Google Scholar] [CrossRef] [Green Version]
- Rybak-Wolf, A.; Jens, M.; Murakawa, Y.; Herzog, M.; Landthaler, M.; Rajewsky, N. A Variety of Dicer Substrates in Human and C. elegans. Cell 2014, 159, 1153–1167. [Google Scholar] [CrossRef] [Green Version]
- Bartel, D.P. MicroRNAs: Target Recognition and Regulatory Functions. Cell 2009, 136, 215–233. [Google Scholar] [CrossRef] [Green Version]
- Valencia-Sanchez, M.A.; Liu, J.; Hannon, G.J.; Parker, R. Control of translation and mRNA degradation by miRNAs and siRNAs. Genes Dev. 2006, 20, 515–524. [Google Scholar] [CrossRef] [Green Version]
- Grishok, A.; Pasquinelli, A.E.; Conte, D.; Li, N.; Parrish, S.; Ha, I.; Baillie, D.L.; Fire, A.; Ruvkun, G.; Mello, C.C. Genes and Mechanisms Related to RNA Interference Regulate Expression of the Small Temporal RNAs that Control C. elegans Developmental Timing. Cell 2001, 106, 23–34. [Google Scholar] [CrossRef] [Green Version]
- Volpe, T.A.; Kidner, C.; Hall, I.M.; Teng, G.; Grewal, S.I.S.; Martienssen, R.A. Regulation of Heterochromatic Silencing and Histone H3 Lysine-9 Methylation by RNAi. Science 2002, 297, 1833–1837. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kurzynska-Kokorniak, A.; Jackowiak, P.; Figlerowicz, M.; Figlerowicz, M. Human- and virus-encoded microRNAs as potential targets of antiviral therapy. Mini Rev. Med. Chem. 2009, 9, 927–937. [Google Scholar] [CrossRef] [PubMed]
- Calin, G.; Croce, C.M. MicroRNA Signatures in Human Cancers. Nat. Rev. Cancer 2006, 6, 857–866. [Google Scholar] [CrossRef]
- Esquela-Kerscher, A.; Slack, F. Oncomirs—microRNAs with a role in cancer. Nat. Rev. Cancer 2006, 6, 259–269. [Google Scholar] [CrossRef] [PubMed]
- Hebert, S.; de Strooper, B. Alterations of the microRNA network cause neurodegenerative disease. Trends Neurosci. 2009, 32, 199–206. [Google Scholar] [CrossRef] [PubMed]
- Macrae, I.; Li, F.; Zhou, K.; Cande, W.; Doudna, J. Structure of Dicer and Mechanistic Implications for RNAi. Cold Spring Harb. Symp. Quant. Biol. 2006, 71, 73–80. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- MacRae, I.J.; Doudna, J.A. Ribonuclease revisited: Structural insights into ribonuclease III family enzymes. Curr. Opin. Struct. Biol. 2007, 17, 138–145. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Kolb, F.A.; Jaskiewicz, L.; Westhof, E.; Filipowicz, W. Single Processing Center Models for Human Dicer and Bacterial RNase III. Cell 2004, 118, 57–68. [Google Scholar] [CrossRef] [Green Version]
- Taylor, D.W.; Ma, E.; Shigematsu, H.; Cianfrocco, M.A.; Noland, C.L.; Nagayama, K.; Nogales, E.; Doudna, J.A.; Wang, H.-W. Substrate-specific structural rearrangements of human Dicer. Nat. Struct. Mol. Biol. 2013, 20, 662–670. [Google Scholar] [CrossRef]
- Ciechanowska, K.; Pokornowska, M.; Kurzyńska-Kokorniak, A. Genetic Insight into the Domain Structure and Functions of Dicer-Type Ribonucleases. Int. J. Mol. Sci. 2021, 22, 616. [Google Scholar] [CrossRef]
- Kurzynska-Kokorniak, A.; Pokornowska, M.; Koralewska, N.; Hoffmann, W.; Bieńkowska-Szewczyk, K.; Figlerowicz, M. Revealing a new activity of the human Dicer DUF283 domain in vitro. Sci. Rep. 2016, 6, 23989. [Google Scholar] [CrossRef] [Green Version]
- Liu, Z.; Wang, J.; Cheng, H.; Ke, X.; Sun, L.; Zhang, Q.C.; Wang, H.-W. Cryo-EM Structure of Human Dicer and Its Complexes with a Pre-miRNA Substrate. Cell 2018, 173, 1191–1203.e12. [Google Scholar] [CrossRef] [Green Version]
- Tian, Y.; Simanshu, D.; Ma, J.-B.; Park, J.-E.; Heo, I.; Kim, V.N.; Patel, D.J. A Phosphate-Binding Pocket within the Platform-PAZ-Connector Helix Cassette of Human Dicer. Mol. Cell 2014, 53, 606–616. [Google Scholar] [CrossRef] [Green Version]
- Wostenberg, C.; Lary, J.W.; Sahu, D.; Acevedo, R.; Quarles, K.A.; Cole, J.L.; Showalter, S.A. The role of human Dic-er-dsRBD in processing small regulatory RNAs. PLoS ONE 2012, 7, e51829. [Google Scholar] [CrossRef]
- Qin, H.; Chen, F.; Huan, X.; Machida, S.; Song, J.; Yuan, Y.A. Structure of the Arabidopsis thaliana DCL4 DUF283 domain reveals a noncanonical double-stranded RNA-binding fold for protein-protein interaction. RNA 2010, 16, 474–481. [Google Scholar] [CrossRef] [Green Version]
- Dlakić, M. DUF283 domain of Dicer proteins has a double-stranded RNA-binding fold. Bioinformatics 2006, 22, 2711–2714. [Google Scholar] [CrossRef]
- Ota, H.; Sakurai, M.; Gupta, R.; Valente, L.; Wulff, B.-E.; Ariyoshi, K.; Iizasa, H.; Davuluri, R.V.; Nishikura, K. ADAR1 Forms a Complex with Dicer to Promote MicroRNA Processing and RNA-Induced Gene Silencing. Cell 2013, 153, 575–589. [Google Scholar] [CrossRef] [Green Version]
- Pokornowska, M.; Milewski, M.C.; Ciechanowska, K.; Szczepańska, A.; Wojnicka, M.; Radogostowicz, Z.; Figlerowicz, M.; Kurzynska-Kokorniak, A. The RNA–RNA base pairing potential of human Dicer and Ago2 proteins. Cell. Mol. Life Sci. 2019, 77, 3231–3244. [Google Scholar] [CrossRef] [Green Version]
- Wojnicka, M.; Szczepanska, A.; Kurzynska-Kokorniak, A. Unknown Areas of Activity of Human Ribonuclease Dicer: A Putative Deoxyribonuclease Activity. Molecules 2020, 25, 1414. [Google Scholar] [CrossRef] [Green Version]
- Bogerd, H.P.; Whisnant, A.W.; Kennedy, E.M.; Flores, O.; Cullen, B.R. Derivation and characterization of Dicer- and microRNA-deficient human cells. RNA 2014, 20, 923–937. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, E.; MacRae, I.J.; Kirsch, J.F.; Doudna, J.A. Autoinhibition of Human Dicer by Its Internal Helicase Domain. J. Mol. Biol. 2008, 380, 237–243. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Koralewska, N.; Hoffmann, W.; Pokornowska, M.; Milewski, M.; Bienkowska-Szewczyk, K.; Figlerowicz, M.; Lipinska, A.; Kurzynska-Kokorniak, A. How short RNAs impact the human ribonuclease Dicer activity: Putative regulatory feedback-loops and other RNA-mediated mechanisms controlling microRNA processing. Acta Biochim. Pol. 2017, 63, 773–783. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kurzyńska-Kokorniak, A.; Koralewska, N.; Tyczewska, A.; Twardowski, T.; Figlerowicz, M. A New Short Oligonucleotide-Based Strategy for the Precursor-Specific Regulation of microRNA Processing by Dicer. PLoS ONE 2013, 8, e77703. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tyczewska, A.; Kurzynska-Kokorniak, A.; Koralewska, N.; Szopa, A.; Kietrys, A.M.; Wrzesinski, J.; Twardowski, T.; Figlerowicz, M. Selection of RNA Oligonucleotides That Can Modulate Human Dicer Activity In Vitro. Nucleic Acid Ther. 2011, 21, 333–346. [Google Scholar] [CrossRef]
- Ye, X.; Paroo, Z.; Liu, Q. Functional Anatomy of the Drosophila MicroRNA-generating Enzyme. J. Biol. Chem. 2007, 282, 28373–28378. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, Y.; Hur, I.; Park, S.-Y.; Kim, Y.K.; Suh, M.R.; Kim, V.N. The role of PACT in the RNA silencing pathway. EMBO J. 2006, 25, 522–532. [Google Scholar] [CrossRef] [PubMed]
- Lau, P.-W.; Guiley, K.Z.; De, N.; Potter, C.S.; Carragher, B.; Macrae, I.J. The molecular architecture of human Dicer. Nat. Struct. Mol. Biol. 2012, 19, 436–440. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Name | Sequence (5′ → 3′) |
---|---|
RNA_sense * | GUGCAUUGUAGUUGCAUUGCAUGUUCUGGUCA |
RNA_ov | ACCAGAACAUGCAAUGCAACUACAAUGCACAU |
pre-mir-16-1 | UAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUAAAAUUAUCUCCAGUAUUAACUGUGCUGCUGAA |
pre-mir-21 | AGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGU |
RNA21 | UCGAAGUAUUCCGCGUACGUG |
RNA50 | GGUUGAACUAUUUCGUGUAUCUGGAAACACGUACGCGGAAUACUUCGAUU |
f_∆DUF(625-752) | ATTCCAGAGTGTTTGAGGGATAGTTATCCCAGACCTG |
r_∆DUF(625-752) | TCGTGGACCACCATCGTCAGGCCTCAACAC |
f_∆DUF(630-709) | GACCATTTGATGCCAGTTGGGAAAGAGACT |
r_∆DUF(630-709) | GGCCGTGTTGATTGTGACTCGTGGACCAC |
f.miR-21-5p | GCTTATCAGACTGATGTTGAAA |
f.miR-16-1-5p | GCACGTAAATATTGGCGAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Szczepanska, A.; Wojnicka, M.; Kurzynska-Kokorniak, A. The Significance of the DUF283 Domain for the Activity of Human Ribonuclease Dicer. Int. J. Mol. Sci. 2021, 22, 8690. https://doi.org/10.3390/ijms22168690
Szczepanska A, Wojnicka M, Kurzynska-Kokorniak A. The Significance of the DUF283 Domain for the Activity of Human Ribonuclease Dicer. International Journal of Molecular Sciences. 2021; 22(16):8690. https://doi.org/10.3390/ijms22168690
Chicago/Turabian StyleSzczepanska, Agnieszka, Marta Wojnicka, and Anna Kurzynska-Kokorniak. 2021. "The Significance of the DUF283 Domain for the Activity of Human Ribonuclease Dicer" International Journal of Molecular Sciences 22, no. 16: 8690. https://doi.org/10.3390/ijms22168690
APA StyleSzczepanska, A., Wojnicka, M., & Kurzynska-Kokorniak, A. (2021). The Significance of the DUF283 Domain for the Activity of Human Ribonuclease Dicer. International Journal of Molecular Sciences, 22(16), 8690. https://doi.org/10.3390/ijms22168690