Combination of Peroxisome Proliferator-Activated Receptor (PPAR) Alpha and Gamma Agonists Prevents Corneal Inflammation and Neovascularization in a Rat Alkali Burn Model
Abstract
1. Introduction
2. Results
2.1. Corneal Wound Healing after Alkali Burn
2.2. PPARα and PPARγ mRNA Expression in the Cornea
2.3. Anti-Inflammatory Effects of the PPAR Agonist Ophthalmic Solution
2.4. Suppression of Neovascularization by Instillation of PPAR Agonists
2.5. Anti-Fibrotic Effects of PPAR Agonist Instillation
3. Discussion
4. Materials and Methods
4.1. Animals and Ethics Statement
4.2. Alkali Burn Model and TREATMent with PPAR Agonist Ophthalmic Solution
4.3. Histological and Immunohistochemical Analysis
4.4. Real-Time RT-PCR
4.5. Statistical Analyses
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
PPAR | Peroxisome proliferator-activated receptor |
HE | Hematoxylin and eosin |
RT-PCR | Reverse transcription polymerase chain reaction |
EST | Esterase |
IL | Interleukin |
NF-κB | Nuclear factor-kappa B |
ΙκB-α | nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor alpha |
TNF-α | Tumor necrosis factor-α |
TGF-β | Transforming growth factor-β |
VEGF | Vascular endothelial growth factor |
Ang | Angiopoietin |
References
- Wagoner, M.D. Chemical injuries of the eye: Current concepts in pathophysiology and therapy. Surv. Ophthalmol. 1997, 41, 275–313. [Google Scholar] [CrossRef]
- Sharma, N.; Kaur, M.; Agarwal, T.; Sangwan, V.S.; Vajpayee, R.B. Treatment of acute ocular chemical burns. Surv. Ophthalmol. 2018, 63, 214–235. [Google Scholar] [CrossRef] [PubMed]
- Abdelrahman, M.; Sivarajah, A.; Thiemermann, C. Beneficial effects of PPAR-gamma ligands in ischemia-reperfusion injury, inflammation and shock. Cardiovasc. Res. 2005, 65, 772–781. [Google Scholar] [CrossRef] [PubMed]
- Evans, R.M. The steroid and thyroid hormone receptor superfamily. Science 1988, 240, 889–895. [Google Scholar] [CrossRef] [PubMed]
- Lee, C.-H.; Olson, P.; Evans, R.M. Minireview: Lipid metabolism, metabolic diseases, and peroxisome proliferator-activated receptors. Endocrinology 2003, 144, 2201–2207. [Google Scholar] [CrossRef] [PubMed]
- Barbier, O.; Torra, I.P.; Duguay, Y.; Blanquart, C.; Fruchart, J.-C.; Glineur, C.; Staels, B. Pleiotropic actions of peroxisome proliferator-activated receptors in lipid metabolism and atherosclerosis. Arterioscler. Thromb. Vasc. Biol. 2002, 22, 717–726. [Google Scholar] [CrossRef]
- Zhang, S.; Gu, H.; Hu, N. Role of Peroxisome Proliferator-Activated Receptor γ in Ocular Diseases. J. Ophthalmol. 2015, 2015, 275435. [Google Scholar] [CrossRef]
- Uchiyama, M.; Shimizu, A.; Masuda, Y.; Nagasaka, S.; Fukuda, Y.; Takahashi, H. An ophthalmic solution of a peroxisome proliferator-activated receptor gamma agonist prevents corneal inflammation in a rat alkali burn model. Mol. Vis. 2013, 19, 2135–2150. [Google Scholar]
- Arima, T.; Uchiyama, M.; Nakano, Y.; Nagasaka, S.; Kang, D.; Shimizu, A.; Takahashi, H. Peroxisome proliferator-activated receptor alpha agonist suppresses neovascularization by reducing both vascular endothelial growth factor and angiopoietin-2 in corneal alkali burn. Sci. Rep. 2017, 7, 1–11. [Google Scholar] [CrossRef]
- Tanabe, J.; Tamasawa, N.; Yamashita, M.; Matsuki, K.; Murakami, H.; Matsui, J.; Sugimoto, K.; Yasujima, M.; Suda, T. Effects of combined PPARgamma and PPARalpha agonist therapy on reverse cholesterol transport in the Zucker diabetic fatty rat. Diabetes Obes. Metab. 2008, 10, 772–779. [Google Scholar] [CrossRef]
- Abd El-Haleim, E.A.; Bahgat, A.K.; Saleh, S. Effects of combined PPAR-γ and PPAR-α agonist therapy on fructose induced NASH in rats: Modulation of gene expression. Eur. J. Pharmacol. 2016, 773, 59–70. [Google Scholar] [CrossRef] [PubMed]
- Pargament, J.M.; Armenia, J.; Nerad, J.A. Physical and chemical injuries to eyes and eyelids. Clin. Dermatol. 2015, 33, 234–237. [Google Scholar] [CrossRef]
- Zhou, H.; Zhang, W.; Bi, M.; Wu, J. The molecular mechanisms of action of PPAR-γ agonists in the treatment of corneal alkali burns (Review). Int. J. Mol. Med. 2016, 38, 1003–1011. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Sotozono, C.; He, J.; Matsumoto, Y.; Kita, M.; Imanishi, J.; Kinoshita, S. Cytokine expression in the alkali-burned cornea. Curr. Eye Res. 1997, 16, 670–676. [Google Scholar] [CrossRef] [PubMed]
- Baeuerle, P.A.; Baltimore, D. NF-kappa B: Ten years after. Cell 1996, 87, 13–20. [Google Scholar] [CrossRef]
- Verma, I.M.; Stevenson, J.K.; Schwarz, E.M.; Van Antwerp, D.; Miyamoto, S. Rel/NF-kappa B/I kappa B family: Intimate tales of association and dissociation. Genes Dev. 1995, 9, 2723–2735. [Google Scholar] [CrossRef]
- Consoli, A.; Devangelio, E. Thiazolidinediones and inflammation. Lupus 2005, 14, 794–797. [Google Scholar] [CrossRef]
- Scirpo, R.; Fiorotto, R.; Villani, A.; Amenduni, M.; Spirli, C.; Strazzabosco, M. Stimulation of nuclear receptor peroxisome proliferator-activated receptor-γ limits NF-κB-dependent inflammation in mouse cystic fibrosis biliary epithelium. Hepatology 2015, 62, 1551–1562. [Google Scholar] [CrossRef]
- Ajmone-Cat, M.A.; Bernardo, A.; Greco, A.; Minghetti, L. Non-Steroidal Anti-Inflammatory Drugs and Brain Inflammation: Effects on Microglial Functions. Pharmaceuticals 2010, 3, 1949–1965. [Google Scholar] [CrossRef]
- Delerive, P.; Gervois, P.; Fruchart, J.-C.; Staels, B. Induction of IkappaBalpha expression as a mechanism contributing to the anti-inflammatory activities of peroxisome proliferator-activated receptor-alpha activators. J. Biol. Chem. 2000, 275, 36703–36707. [Google Scholar] [CrossRef]
- Ricardo, S.D.; Van Goor, H.; Eddy, A.A. Macrophage diversity in renal injury and repair. J. Clin. Investig. 2008, 118, 3522–3530. [Google Scholar] [CrossRef] [PubMed]
- Mosser, D.M. The many faces of macrophage activation. J. Leukoc. Biol. 2003, 73, 209–212. [Google Scholar] [CrossRef] [PubMed]
- Bouhlel, M.A.; Derudas, B.; Rigamonti, E.; Dièvart, R.; Brozek, J.; Haulon, S.; Zawadzki, C.; Jude, B.; Torpier, G.; Marx, N.; et al. PPARgamma activation primes human monocytes into alternative M2 macrophages with anti-inflammatory properties. Cell Metab. 2007, 6, 137–143. [Google Scholar] [CrossRef] [PubMed]
- Charo, I.F. Macrophage polarization and insulin resistance: PPARgamma in control. Cell Metab. 2007, 6, 96–98. [Google Scholar] [CrossRef] [PubMed]
- Amparo, F.; Sadrai, Z.; Jin, Y.; Alfonso-Bartolozzi, B.; Wang, H.; Shikari, H.; Ciolino, J.B.; Chodosh, J.; Jurkunas, U.; Schaumberg, D.A.; et al. Safety and efficacy of the multitargeted receptor kinase inhibitor pazopanib in the treatment of corneal neovascularization. Investig. Ophthalmol. Vis. Sci. 2013, 54, 537–544. [Google Scholar] [CrossRef]
- Suri, C.; Jones, P.F.; Patan, S.; Bartunkova, S.; Maisonpierre, P.C.; Davis, S.; Sato, T.N.; Yancopoulos, G.D. Requisite role of angiopoietin-1, a ligand for the TIE2 receptor, during embryonic angiogenesis. Cell 1996, 87, 1171–1180. [Google Scholar] [CrossRef]
- Maisonpierre, P.C.; Suri, C.; Jones, P.F.; Bartunkova, S.; Wiegand, S.J.; Radziejewski, C.; Compton, D.; McClain, J.; Aldrich, T.H.; Papadopoulos, N.; et al. Angiopoietin-2, a natural antagonist for Tie2 that disrupts In Vivo angiogenesis. Science 1997, 277, 55–60. [Google Scholar] [CrossRef]
- Daly, C.; Wong, V.; Burova, E.; Wei, Y.; Zabski, S.; Griffiths, J.; Lai, K.-M.; Lin, H.C.; Ioffe, E.; Yancopoulos, G.D.; et al. Angiopoietin-1 modulates endothelial cell function and gene expression via the transcription factor FKHR (FOXO1). Genes Dev. 2004, 18, 1060–1071. [Google Scholar] [CrossRef]
- Asahara, T.; Chen, D.; Takahashi, T.; Fujikawa, K.; Kearney, M.; Magner, M.; Yancopoulos, G.D.; Isner, J.M. Tie2 receptor ligands, angiopoietin-1 and angiopoietin-2, modulate VEGF-induced postnatal neovascularization. Circ. Res. 1998, 83, 233–240. [Google Scholar] [CrossRef]
- Qiu, F.; Matlock, G.; Chen, Q.; Zhou, K.; Du, Y.; Wang, X.; Ma, J.-X. Therapeutic Effects of PPARα Agonist on Ocular Neovascularization in Models Recapitulating Neovascular Age-Related Macular Degeneration. Investig. Ophthalmol. Vis. Sci. 2017, 58, 5065–5075. [Google Scholar] [CrossRef]
- Xin, X.; Yang, S.; Kowalski, J.; Gerritsen, M.E. Peroxisome proliferator-activated receptor gamma ligands are potent inhibitors of angiogenesis In Vitro and In Vivo. J. Biol. Chem. 1999, 274, 9116–9121. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Mienaltowski, M.J.; Birk, D.E. Regulation of corneal stroma extracellular matrix assembly. Exp. Eye Res. 2015, 133, 69–80. [Google Scholar] [CrossRef] [PubMed]
- Meek, K.M.; Knupp, C. Corneal structure and transparency. Prog. Retin. Eye Res. 2015, 49, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Shah, M.; Foreman, D.M.; Ferguson, M.W. Neutralisation of TGF-beta 1 and TGF-beta 2 or exogenous addition of TGF-beta 3 to cutaneous rat wounds reduces scarring. J. Cell. Sci. 1995, 108, 985–1002. [Google Scholar] [PubMed]
- Ask, K.; Bonniaud, P.; Maass, K.; Eickelberg, O.; Margetts, P.J.; Warburton, D.; Groffen, J.; Gauldie, J.; Kolb, M. Progressive pulmonary fibrosis is mediated by TGF-beta isoform 1 but not TGF-beta3. Int. J. Biochem. Cell Biol. 2008, 40, 484–495. [Google Scholar] [CrossRef] [PubMed]
- Zhang, F.; Liu, K.; Cao, M.; Qu, J.; Zhou, D.; Pan, Z.; Duan, X.; Zhou, Y. Rosiglitazone Treatment Prevents Postoperative Fibrosis in a Rabbit Model of Glaucoma Filtration Surgery. Investig. Ophthalmol. Vis. Sci. 2019, 60, 2743–2752. [Google Scholar] [CrossRef]
- Shehata, A.H.F.; Ahmed, A.-S.F.; Abdelrehim, A.B.; Heeba, G.H. The impact of single and combined PPAR-α and PPAR-γ activation on the neurological outcomes following cerebral ischemia reperfusion. Life Sci. 2020, 252, 117679. [Google Scholar] [CrossRef]
- Balakumar, P.; Mahadevan, N.; Sambathkumar, R. A Contemporary Overview of PPARα/γ Dual Agonists for the Management of Diabetic Dyslipidemia. CMP 2019, 12, 195–201. [Google Scholar] [CrossRef]
- Kaur, P.; Bhat, Z.R.; Bhat, S.; Kumar, R.; Kumar, R.; Tikoo, K.; Gupta, J.; Khurana, N.; Kaur, J.; Khatik, G.L. Synthesis and evaluation of new 1,2,4-oxadiazole based trans-acrylic acid derivatives as potential PPAR-alpha/gamma dual agonist. Bioorganic Chem. 2020, 100, 103867. [Google Scholar] [CrossRef]
- Masuda, Y.; Shimizu, A.; Mori, T.; Ishiwata, T.; Kitamura, H.; Ohashi, R.; Ishizaki, M.; Asano, G.; Sugisaki, Y.; Yamanaka, N. Vascular endothelial growth factor enhances glomerular capillary repair and accelerates resolution of experimentally induced glomerulonephritis. AJPA 2001, 159, 599–608. [Google Scholar] [CrossRef]
- Mokrý, J.; Nĕmecek, S. Immunohistochemical detection of intermediate filament nestin. Acta Med. (Hradec Kral.) 1998, 41, 73–80. [Google Scholar]
- Matsui, K.; Nagy-Bojarsky, K.; Laakkonen, P.; Krieger, S.; Mechtler, K.; Uchida, S.; Geleff, S.; Kang, D.-H.; Johnson, R.J.; Kerjaschki, D.; et al. Lymphatic microvessels in the rat remnant kidney model of renal fibrosis: Aminopeptidase p and podoplanin are discriminatory markers for endothelial cells of blood and lymphatic vessels. J. Am. Soc. Nephrol. 2003, 14, 1981–1989. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) |
---|---|---|
β-actin | GCAGGAGTACGATGAGTCCG | ACGCAGCTCAGTAACAGTCC |
PPARα | TCGTGGAGTCCTGGAACTGA | GAGTTACGCCCAAATGCACC |
PPARγ | GCGAGGGCGATCTTGACA | ATGCGGATGGCCACCTCTTT |
IL-1β | TACCTATGTCTTGCCCGTGGAG | ATCATCCCACGAGTCACAGAGG |
IL-6 | GTCAACTCCATCTGCCCTTCAG | GGCAGTGGCTGTCAACAACAT |
NF-κΒ | TGGACGATCTGTTTCCCCTC | TCGCACTTGTAACGGAAACG |
IκB-α | TGACCATGGAAGTGATTGGTCAG | GATCACAGCCAAGTGGAGTGGA |
ΤNF-α | AAATGGGCTCCCTCTCATCAGTTC | TCTGCTTGGTGGTTTGCTACGAC |
TGF-β1 | TGGCCAGATCCTGTCCAAAC | GTTGTACAAAGCGAGCACCG |
VEGF-A | GCAGCGACAAGGCAGACTAT | GCAACCTCTCCAAACCGTTG |
Ang-1 | CACCGTGAGGATGGAAGCCTA | TTCCCAAGCCAATATTCACCAGA |
Ang-2 | CTTCAGGTGCTGGTGTCCA | GTCACAGTAGGCCTTGACCTC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nakano, Y.; Arima, T.; Tobita, Y.; Uchiyama, M.; Shimizu, A.; Takahashi, H. Combination of Peroxisome Proliferator-Activated Receptor (PPAR) Alpha and Gamma Agonists Prevents Corneal Inflammation and Neovascularization in a Rat Alkali Burn Model. Int. J. Mol. Sci. 2020, 21, 5093. https://doi.org/10.3390/ijms21145093
Nakano Y, Arima T, Tobita Y, Uchiyama M, Shimizu A, Takahashi H. Combination of Peroxisome Proliferator-Activated Receptor (PPAR) Alpha and Gamma Agonists Prevents Corneal Inflammation and Neovascularization in a Rat Alkali Burn Model. International Journal of Molecular Sciences. 2020; 21(14):5093. https://doi.org/10.3390/ijms21145093
Chicago/Turabian StyleNakano, Yuji, Takeshi Arima, Yutaro Tobita, Masaaki Uchiyama, Akira Shimizu, and Hiroshi Takahashi. 2020. "Combination of Peroxisome Proliferator-Activated Receptor (PPAR) Alpha and Gamma Agonists Prevents Corneal Inflammation and Neovascularization in a Rat Alkali Burn Model" International Journal of Molecular Sciences 21, no. 14: 5093. https://doi.org/10.3390/ijms21145093
APA StyleNakano, Y., Arima, T., Tobita, Y., Uchiyama, M., Shimizu, A., & Takahashi, H. (2020). Combination of Peroxisome Proliferator-Activated Receptor (PPAR) Alpha and Gamma Agonists Prevents Corneal Inflammation and Neovascularization in a Rat Alkali Burn Model. International Journal of Molecular Sciences, 21(14), 5093. https://doi.org/10.3390/ijms21145093