Supplementation with 45S5 Bioactive Glass Reduces In Vivo Resorption of the β-Tricalcium-Phosphate-Based Bone Substitute Material Vitoss
Abstract
1. Introduction
2. Results
2.1. Impact of BG Particles on Osteoid Formation and Maturation and Osteogenic Precursor Cell Differentiation
2.2. Impact of BG Particles on Resorption Kinetics
2.3. Impact of BG Particles on Angiogenesis
3. Discussion
4. Materials and Methods
4.1. Study Ethics and Patient Demography
4.2. General Study Design: Overview
4.3. MSC Isolation and Cultivation
4.4. Scaffold Fabrication and Analysis Prior to Implantation
4.5. Cell Seeding on Scaffolds and Scaffold Number
4.6. Animal Model: Surgical Procedure
4.7. mCT Acquisition, Reconstruction, and Data Analysis
4.8. Histomorphometry, Immunohistochemistry, and In Situ Hybridization
4.9. RNA Isolation and qPCR Analysis
4.10. Statistics
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
3D | Three-dimensional |
BG | Bioactive glass |
BSA | Bovine serum albumin |
CaP | Calcium phosphate |
DAB | Diaminobenzidine |
ESM | Expansion medium |
HA | Hydroxyapatite |
hALU | Human lysozyme |
HRP | Horseradish peroxidase |
mCT | Micro-computed tomography |
MSC | Mesenchymal stromal cell |
mSINE | Murine-specific genomic short interspersed nucleotide elements |
OCN | Osteocalcin |
OD | Osteogenic differentiation |
PBS | Phosphate-buffered saline |
qPCR | Quantitative real-time polymerase chain reaction |
RANK | Receptor activator of nuclear factor κB |
RNA | Ribonucleic acid |
SCID | Severe combined immunodeficiency |
TBS | Tris-buffered saline |
TCP | Tricalcium phosphate |
TIV | Total implant volume |
TRAP | Tartrate-resistant acid phosphatase |
VEGFA | Vascular endothelial growth factor A |
YWHAZ | 14-3-3 protein zeta/delta |
References
- Wang, W.; Yeung, K.W.K. Bone grafts and biomaterials substitutes for bone defect repair: A review. Bioact. Mater. 2017, 2, 224–247. [Google Scholar] [CrossRef] [PubMed]
- Karadjian, M.; Essers, C.; Tsitlakidis, S.; Reible, B.; Moghaddam, A.; Boccaccini, A.R.; Westhauser, F. Biological Properties of Calcium Phosphate Bioactive Glass Composite Bone Substitutes: Current Experimental Evidence. Int. J. Mol. Sci. 2019, 20. [Google Scholar] [CrossRef] [PubMed]
- Zimmermann, G.; Moghaddam, A. Allograft bone matrix versus synthetic bone graft substitutes. Injury 2011, 42, S16–21. [Google Scholar] [CrossRef] [PubMed]
- Amini, A.R.; Laurencin, C.T.; Nukavarapu, S.P. Bone tissue engineering: Recent advances and challenges. Crit. Rev. Biomed. Eng. 2012, 40, 363–408. [Google Scholar] [CrossRef] [PubMed]
- Arrington, E.D.; Smith, W.J.; Chambers, H.G.; Bucknell, A.L.; Davino, N.A. Complications of iliac crest bone graft harvesting. Clin. Orthop. Relat. Res. 1996, 300–309. [Google Scholar] [CrossRef] [PubMed]
- Van der Stok, J.; Van Lieshout, E.M.M.; El-Massoudi, Y.; Van Kralingen, G.H.; Patka, P. Bone substitutes in the Netherlands—A systematic literature review. Acta Biomater. 2011, 7, 739–750. [Google Scholar] [CrossRef] [PubMed]
- Bellucci, D.; Sola, A.; Cannillo, V. Hydroxyapatite and tricalcium phosphate composites with bioactive glass as second phase: State of the art and current applications. J. Biomed. Mater. Res. A 2016, 104, 1030–1056. [Google Scholar] [CrossRef]
- LeGeros, R.Z. Calcium phosphate-based osteoinductive materials. Chem. Rev. 2008, 108, 4742–4753. [Google Scholar] [CrossRef] [PubMed]
- Samavedi, S.; Whittington, A.R.; Goldstein, A.S. Calcium phosphate ceramics in bone tissue engineering: A review of properties and their influence on cell behavior. Acta Biomater. 2013, 9, 8037–8045. [Google Scholar] [CrossRef] [PubMed]
- Cao, W.; Hench, L.L. Bioactive materials. Ceram. Int. 1996, 22, 493–507. [Google Scholar] [CrossRef]
- Bohner, M. Silicon-substituted calcium phosphates—A critical view. Biomaterials 2009, 30, 6403–6406. [Google Scholar] [CrossRef] [PubMed]
- Hannink, G.; Arts, J.J. Bioresorbability, porosity and mechanical strength of bone substitutes: What is optimal for bone regeneration? Injury 2011, 42, S22–25. [Google Scholar] [CrossRef] [PubMed]
- Wiltfang, J.; Merten, H.A.; Schlegel, K.A.; Schultze-Mosgau, S.; Kloss, F.R.; Rupprecht, S.; Kessler, P. Degradation characteristics of alpha and beta tri-calcium-phosphate (TCP) in minipigs. J. Biomed. Mater. Res. 2002, 63, 115–121. [Google Scholar] [CrossRef] [PubMed]
- Hench, L. Opening paper 2015- Some comments on Bioglass: Four Eras of Discovery and Development. Biomed. Glasses 2015, 1, 1–11. [Google Scholar] [CrossRef]
- Hench, L.L. The story of Bioglass. J. Mater. Sci Mater. Med. 2006, 17, 967–978. [Google Scholar] [CrossRef]
- Xynos, I.D.; Edgar, A.J.; Buttery, L.D.; Hench, L.L.; Polak, J.M. Gene-expression profiling of human osteoblasts following treatment with the ionic products of Bioglass 45S5 dissolution. J. Biomed. Mater. Res. 2001, 55, 151–157. [Google Scholar] [CrossRef]
- Xynos, I.D.; Edgar, A.J.; Buttery, L.D.; Hench, L.L.; Polak, J.M. Ionic products of bioactive glass dissolution increase proliferation of human osteoblasts and induce insulin-like growth factor II mRNA expression and protein synthesis. Biochem. Biophys. Res. Commun. 2000, 276, 461–465. [Google Scholar] [CrossRef]
- Day, R.M. Bioactive glass stimulates the secretion of angiogenic growth factors and angiogenesis in vitro. Tissue Eng. 2005, 11, 768–777. [Google Scholar] [CrossRef]
- Westhauser, F.; Karadjian, M.; Essers, C.; Senger, A.S.; Hagmann, S.; Schmidmaier, G.; Moghaddam, A. Osteogenic differentiation of mesenchymal stem cells is enhanced in a 45S5-supplemented beta-TCP composite scaffold: An in-vitro comparison of Vitoss and Vitoss BA. PLoS ONE 2019, 14, e0212799. [Google Scholar] [CrossRef]
- Hench, L.L.; Splinter, R.J.; Allen, W.C.; Greenlee, T.K. Bonding mechanisms at the interface of ceramic prosthetic materials. J. Biomed. Mater. Res. 1971, 5, 117–141. [Google Scholar] [CrossRef]
- Rahaman, M.N.; Day, D.E.; Bal, B.S.; Fu, Q.; Jung, S.B.; Bonewald, L.F.; Tomsia, A.P. Bioactive glass in tissue engineering. Acta Biomater. 2011, 7, 2355–2373. [Google Scholar] [CrossRef] [PubMed]
- Bellucci, D.; Sola, A.; Anesi, A.; Salvatori, R.; Chiarini, L.; Cannillo, V. Bioactive glass/hydroxyapatite composites: Mechanical properties and biological evaluation. Mater. Sci. Eng. C 2015, 51, 196–205. [Google Scholar] [CrossRef] [PubMed]
- Damron, T.A. Use of 3D beta-tricalcium phosphate (Vitoss) scaffolds in repairing bone defects. Nanomedicine 2007, 2, 763–775. [Google Scholar] [CrossRef] [PubMed]
- Stryker Corporation. Stryker Biologics Product Catalog. Available online: http://az621074.vo.msecnd.net/syk-mobile-content-cdn/global-content-system/SYKGCSDOC-2-43250/c7TSNXoiHWht_Rkvc5uSk_1pvRpGgQ/PRTBI_BR_1.pdf (accessed on 30 July 2019).
- Havener, M.B.; Brown, L.S.; Darmoc, M.M.; Owsiany, R.S.; Clineff, T.D. Improvements in Healing with a Bioactive Bone Graft Substitute in a Canine Metaphyseal Defect. In Proceedings of the 55th Annual Meeting of the Orthopaedic Research Society, Las Vegas, NV, USA, 22–25 February 2009. [Google Scholar]
- Hoppe, A.; Guldal, N.S.; Boccaccini, A.R. A review of the biological response to ionic dissolution products from bioactive glasses and glass-ceramics. Biomaterials 2011, 32, 2757–2774. [Google Scholar] [CrossRef] [PubMed]
- Bonewald, L.F. The amazing osteocyte. J. Bone Miner. Res. 2011, 26, 229–238. [Google Scholar] [CrossRef] [PubMed]
- Rutkovskiy, A.; Stenslokken, K.O.; Vaage, I.J. Osteoblast Differentiation at a Glance. Med. Sci. Monit. Basic Res. 2016, 22, 95–106. [Google Scholar] [CrossRef] [PubMed]
- Manassero, M.; Paquet, J.; Deschepper, M.; Viateau, V.; Retortillo, J.; Bensidhoum, M.; Logeart-Avramoglou, D.; Petite, H. Comparison of Survival and Osteogenic Ability of Human Mesenchymal Stem Cells in Orthotopic and Ectopic Sites in Mice. Tissue Eng. Part. A 2016, 22, 534–544. [Google Scholar] [CrossRef] [PubMed]
- Ciraldo, F.E.; Boccardi, E.; Melli, V.; Westhauser, F.; Boccaccini, A.R. Tackling bioactive glass excessive in vitro bioreactivity: Preconditioning approaches for cell culture tests. Acta Biomater. 2018. [Google Scholar] [CrossRef]
- Greenspan, D.C. Bioactive glass: Mechanisms of bone bonding. Tandläkartidningen Ǻrk 1999, 91, 1–32. [Google Scholar]
- Westhauser, F.; Senger, A.S.; Reible, B.; Moghaddam, A. (*) In Vivo Models for the Evaluation of the Osteogenic Potency of Bone Substitutes Seeded with Mesenchymal Stem Cells of Human Origin: A Concise Review. Tissue Eng. Part. C Methods 2017, 23, 881–888. [Google Scholar] [CrossRef]
- Rath, S.N.; Strobel, L.A.; Arkudas, A.; Beier, J.P.; Maier, A.K.; Greil, P.; Horch, R.E.; Kneser, U. Osteoinduction and survival of osteoblasts and bone-marrow stromal cells in 3D biphasic calcium phosphate scaffolds under static and dynamic culture conditions. J. Cell Mol. Med. 2012, 16, 2350–2361. [Google Scholar] [CrossRef] [PubMed]
- Shiwaku, Y.; Neff, L.; Nagano, K.; Takeyama, K.-I.; de Bruijn, J.; Dard, M.; Gori, F.; Baron, R. The Crosstalk between Osteoclasts and Osteoblasts Is Dependent upon the Composition and Structure of Biphasic Calcium Phosphates. PLoS ONE 2015, 10, e0132903. [Google Scholar] [CrossRef] [PubMed]
- Henriksen, K.; Karsdal, M.A.; Martin, T.J. Osteoclast-derived coupling factors in bone remodeling. Calcif. Tissue Int. 2014, 94, 88–97. [Google Scholar] [CrossRef] [PubMed]
- Frost, H.M. Tetracycline-based histological analysis of bone remodeling. Calcif. Tissue Res. 1969, 3, 211–237. [Google Scholar] [CrossRef] [PubMed]
- Martin, T.J.; Sims, N.A. Osteoclast-derived activity in the coupling of bone formation to resorption. Trends Mol. Med. 2005, 11, 76–81. [Google Scholar] [CrossRef]
- Blair, H.C.; Larrouture, Q.C.; Li, Y.; Lin, H.; Beer-Stoltz, D.; Liu, L.; Tuan, R.S.; Robinson, L.J.; Schlesinger, P.H.; Nelson, D.J. Osteoblast Differentiation and Bone Matrix Formation In Vivo and In Vitro. Tissue Eng. Part. B Rev. 2017, 23, 268–280. [Google Scholar] [CrossRef]
- Sheikh, Z.; Abdallah, M.N.; Hanafi, A.A.; Misbahuddin, S.; Rashid, H.; Glogauer, M. Mechanisms of in Vivo Degradation and Resorption of Calcium Phosphate Based Biomaterials. Materials 2015, 8, 7913–7925. [Google Scholar] [CrossRef]
- Takahashi, N.; Udagawa, N.; Suda, T. A new member of tumor necrosis factor ligand family, ODF/OPGL/TRANCE/RANKL, regulates osteoclast differentiation and function. Biochem. Biophys. Res. Commun. 1999, 256, 449–455. [Google Scholar] [CrossRef]
- Zong, C.; Xue, D.; Yuan, W.; Wang, W.; Shen, D.; Tong, X.; Shi, D.; Liu, L.; Zheng, Q.; Gao, C.; et al. Reconstruction of rat calvarial defects with human mesenchymal stem cells and osteoblast-like cells in poly-lactic-co-glycolic acid scaffolds. Eur. Cell Mater. 2010, 20, 109–120. [Google Scholar] [CrossRef]
- Pereira, M.; Petretto, E.; Gordon, S.; Bassett, J.H.D.; Williams, G.R.; Behmoaras, J. Common signalling pathways in macrophage and osteoclast multinucleation. J. Cell Sci. 2018, 131, jcs216267. [Google Scholar] [CrossRef]
- Detsch, R.; Boccaccini, A.R. The role of osteoclasts in bone tissue engineering. J. Tissue Eng. Regen. Med. 2015, 9, 1133–1149. [Google Scholar] [CrossRef] [PubMed]
- Mladenović, Ž.; Johansson, A.; Willman, B.; Shahabi, K.; Björn, E.; Ransjö, M. Soluble silica inhibits osteoclast formation and bone resorption in vitro. Acta Biomater. 2014, 10, 406–418. [Google Scholar] [CrossRef] [PubMed]
- Detsch, R.; Rübner, M.; Strissel, P.L.; Mohn, D.; Strasser, E.; Stark, W.J.; Strick, R.; Boccaccini, A.R. Nanoscale bioactive glass activates osteoclastic differentiation of RAW 264.7 cells. Nanomedicine 2016, 11, 1093–1105. [Google Scholar] [CrossRef] [PubMed]
- Bosetti, M.; Cannas, M. The effect of bioactive glasses on bone marrow stromal cells differentiation. Biomaterials 2005, 26, 3873–3879. [Google Scholar] [CrossRef] [PubMed]
- Andrade, A.L.; Andrade, S.P.; Domingues, R.Z. In vivo performance of a sol-gel glass-coated collagen. J. Biomed. Mater. Res. Part B Appl. Biomater. 2006, 79, 122–128. [Google Scholar] [CrossRef] [PubMed]
- Day, R.M.; Boccaccini, A.R. Effect of particulate bioactive glasses on human macrophages and monocytes in vitro. J. Biomed. Mater. Res. A 2005, 73, 73–79. [Google Scholar] [CrossRef] [PubMed]
- Gorustovich, A.A.; Roether, J.A.; Boccaccini, A.R. Effect of bioactive glasses on angiogenesis: A review of in vitro and in vivo evidences. Tissue Eng. Part. B Rev. 2010, 16, 199–207. [Google Scholar] [CrossRef] [PubMed]
- Udagawa, N.; Takahashi, N.; Akatsu, T.; Tanaka, H.; Sasaki, T.; Nishihara, T.; Koga, T.; Martin, T.J.; Suda, T. Origin of osteoclasts: Mature monocytes and macrophages are capable of differentiating into osteoclasts under a suitable microenvironment prepared by bone marrow-derived stromal cells. Proc. Natl. Acad. Sci. USA 1990, 87, 7260–7264. [Google Scholar] [CrossRef] [PubMed]
- Vignery, A. Osteoclasts and giant cells: Macrophage-macrophage fusion mechanism. Int. J. Exp Pathol. 2000, 81, 291–304. [Google Scholar] [CrossRef]
- Udagawa, N. The mechanism of osteoclast differentiation from macrophages: Possible roles of T lymphocytes in osteoclastogenesis. J. Bone Miner. Metab. 2003, 21, 337–343. [Google Scholar] [CrossRef]
- McGovern, J.A.; Griffin, M.; Hutmacher, D.W. Animal models for bone tissue engineering and modelling disease. Dis Model. Mech. 2018, 11, dmm033084. [Google Scholar] [CrossRef] [PubMed]
- Davies, N.; Dobner, S.; Bezuidenhout, D.; Schmidt, C.; Beck, M.; Zisch, A.H.; Zilla, P. The dosage dependence of VEGF stimulation on scaffold neovascularisation. Biomaterials 2008, 29, 3531–3538. [Google Scholar] [CrossRef] [PubMed]
- Day, R.M.; Boccaccini, A.R.; Shurey, S.; Roether, J.A.; Forbes, A.; Hench, L.L.; Gabe, S.M. Assessment of polyglycolic acid mesh and bioactive glass for soft-tissue engineering scaffolds. Biomaterials 2004, 25, 5857–5866. [Google Scholar] [CrossRef] [PubMed]
- Leu, A.; Leach, J.K. Proangiogenic potential of a collagen/bioactive glass substrate. Pharm. Res. 2008, 25, 1222–1229. [Google Scholar] [CrossRef] [PubMed]
- Qazi, T.H.; Berkmann, J.C.; Schoon, J.; Geissler, S.; Duda, G.N.; Boccaccini, A.R.; Lippens, E. Dosage and composition of bioactive glasses differentially regulate angiogenic and osteogenic response of human MSCs. J. Biomed. Mater. Res. A 2018, 106, 2827–2837. [Google Scholar] [CrossRef] [PubMed]
- Reible, B.; Schmidmaier, G.; Moghaddam, A.; Westhauser, F. Insulin-Like Growth Factor-1 as a Possible Alternative to Bone Morphogenetic Protein-7 to Induce Osteogenic Differentiation of Human Mesenchymal Stem Cells in Vitro. Int. J. Mol. Sci. 2018, 19. [Google Scholar] [CrossRef] [PubMed]
- Widholz, B.; Tsitlakidis, S.; Reible, B.; Moghaddam, A.; Westhauser, F. Pooling of Patient-Derived Mesenchymal Stromal Cells Reduces Inter-Individual Confounder-Associated Variation without Negative Impact on Cell Viability, Proliferation and Osteogenic Differentiation. Cells 2019, 8. [Google Scholar] [CrossRef] [PubMed]
- Westhauser, F.; Weis, C.; Prokscha, M.; Bittrich, L.A.; Li, W.; Xiao, K.; Kneser, U.; Kauczor, H.U.; Schmidmaier, G.; Boccaccini, A.R.; et al. Three-dimensional polymer coated 45S5-type bioactive glass scaffolds seeded with human mesenchymal stem cells show bone formation in vivo. J. Mater. Sci. Mater. Med. 2016, 27, 119. [Google Scholar] [CrossRef] [PubMed]
- Westhauser, F.; Reible, B.; Hollig, M.; Heller, R.; Schmidmaier, G.; Moghaddam, A. Combining advantages: Direct correlation of 2D-micro-computed tomography datasets onto histomorphometric slides to quantify 3D bone volume in scaffolds. J. Biomed. Mater. Res. A 2018. [Google Scholar] [CrossRef]
- Westhauser, F.; Weis, C.; Hoellig, M.; Swing, T.; Schmidmaier, G.; Weber, M.A.; Stiller, W.; Kauczor, H.U.; Moghaddam, A. Heidelberg-mCT-Analyzer: A novel method for standardized microcomputed-tomography-guided evaluation of scaffold properties in bone and tissue research. R. Soc. Open Sci. 2015, 2, 150496. [Google Scholar] [CrossRef]
- Westhauser, F.; Senger, A.S.; Obert, D.; Ciraldo, F.E.; Schuhladen, K.; Schmidmaier, G.; Moghaddam, A.; Boccaccini, A.R. Gelatin coating increases in vivo bone formation capacity of three-dimensional 45S5 bioactive glass-based crystalline scaffolds. J. Tissue Eng. Regen. Med. 2018. [Google Scholar] [CrossRef] [PubMed]
- Gough, J.E.; Jones, J.R.; Hench, L.L. Nodule formation and mineralisation of human primary osteoblasts cultured on a porous bioactive glass scaffold. Biomaterials 2004, 25, 2039–2046. [Google Scholar] [CrossRef] [PubMed]
- Steck, E.; Burkhardt, M.; Ehrlich, H.; Richter, W. Discrimination between cells of murine and human origin in xenotransplants by species specific genomic in situ hybridization. Xenotransplantation 2010, 17, 153–159. [Google Scholar] [CrossRef] [PubMed]
- Polak-Jonkisz, D.; Zwolinska, D. Osteocalcin as a biochemical marker of bone turnover. Nephrology 1998, 4, 339–346. [Google Scholar] [CrossRef]
- Birmingham, E.; Niebur, G.L.; McHugh, P.E.; Shaw, G.; Barry, F.P.; McNamara, L.M. Osteogenic differentiation of mesenchymal stem cells is regulated by osteocyte and osteoblast cells in a simplified bone niche. Eur. Cell Mater. 2012, 23, 13–27. [Google Scholar] [CrossRef]
- Wang, D.; Stockard, C.R.; Harkins, L.; Lott, P.; Salih, C.; Yuan, K.; Buchsbaum, D.; Hashim, A.; Zayzafoon, M.; Hardy, R.W.; et al. Immunohistochemistry in the evaluation of neovascularization in tumor xenografts. Biotech. Histochem. 2008, 83, 179–189. [Google Scholar] [CrossRef] [PubMed]
Spec. | Gene | Forward (5′→3′) | Reverse (5′→3′) |
---|---|---|---|
Human (h) | hYWHAZ | TGCTTGCATCCCACAGACTA | AGGCAGACAATGACAGACCA |
hOCN | ACCGAGACACCATGAGAGCC | GCTTGGACACAAAGGCTGCAC | |
Murine (m) | mβ-Actin | AGATCAAGATCATTGCTCCTCCT | ACGCAGCTCAGTAACACTCC |
mOCN | GAACAGACAAGTCCCACACAGC | TCAGCAGAGTGAGCAGAAAGAT | |
mTRAP | AGAGAGAAAGTCAAGGGAGTGG | ACTTGAAGGCTCTTCCTTCTTCC | |
mRANK | CACTGGAACTCAGACTGCGA | TCCTTGTTGAGAGGGATGCTG | |
mVEGFA | CGAGACGCAGCGACAAGG | ATCAAATCCCAGAGCACAGACT |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Westhauser, F.; Essers, C.; Karadjian, M.; Reible, B.; Schmidmaier, G.; Hagmann, S.; Moghaddam, A. Supplementation with 45S5 Bioactive Glass Reduces In Vivo Resorption of the β-Tricalcium-Phosphate-Based Bone Substitute Material Vitoss. Int. J. Mol. Sci. 2019, 20, 4253. https://doi.org/10.3390/ijms20174253
Westhauser F, Essers C, Karadjian M, Reible B, Schmidmaier G, Hagmann S, Moghaddam A. Supplementation with 45S5 Bioactive Glass Reduces In Vivo Resorption of the β-Tricalcium-Phosphate-Based Bone Substitute Material Vitoss. International Journal of Molecular Sciences. 2019; 20(17):4253. https://doi.org/10.3390/ijms20174253
Chicago/Turabian StyleWesthauser, Fabian, Christopher Essers, Maria Karadjian, Bruno Reible, Gerhard Schmidmaier, Sébastien Hagmann, and Arash Moghaddam. 2019. "Supplementation with 45S5 Bioactive Glass Reduces In Vivo Resorption of the β-Tricalcium-Phosphate-Based Bone Substitute Material Vitoss" International Journal of Molecular Sciences 20, no. 17: 4253. https://doi.org/10.3390/ijms20174253
APA StyleWesthauser, F., Essers, C., Karadjian, M., Reible, B., Schmidmaier, G., Hagmann, S., & Moghaddam, A. (2019). Supplementation with 45S5 Bioactive Glass Reduces In Vivo Resorption of the β-Tricalcium-Phosphate-Based Bone Substitute Material Vitoss. International Journal of Molecular Sciences, 20(17), 4253. https://doi.org/10.3390/ijms20174253