The Effect of Poria cocos Polysaccharide PCP-1C on M1 Macrophage Polarization via the Notch Signaling Pathway
Abstract
1. Introduction
2. Results
2.1. The Appearance and Chemical Composition of PCP-1C
2.2. Homogeneity and Molecular Weight
2.3. The Effect of PCP-1C on the Morphology, Viability, and Phagocytosis of RAW264.7
2.4. The Effects of PCP-1C on the Cytokine Profile of Macrophages
2.5. The Effects of PCP-1C on the Macrophage Polarization Detected by Flow Cytometry
2.6. PCP-1C Affects M1 Polarization via Notch Signaling Pathway
3. Discussion
4. Materials and Methods
4.1. Materials and Reagents
4.2. Morphological Observation and Preparation of PCP-1C
4.2.1. Preparation of PCP-1C
4.2.2. Scanning Electron Microscope Observation and Chemical Composition Detection
4.2.3. Homogeneity and Molecular Weight
4.3. The Stimulation to Polarization of the Macrophages by PCP-1C
4.3.1. Cell Culture
4.3.2. Cell Viability
4.3.3. Cell Phagocytic Ability
4.3.4. ELISA
4.3.5. qRT-PCR
4.3.6. Flow Cytometry
4.3.7. Western Blot
4.3.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Li, X.; He, Y.; Zeng, P.; Liu, Y.; Zhang, M.; Hao, C.; Wang, H.; Lv, Z.; Zhang, L. Molecular basis for Poria cocos mushroom polysaccharide used as an antitumour drug in China. J. Cell. Mol. Med. 2019, 23, 4–20. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Diao, F.; Niu, Y.; Li, X.; Zhou, H.; Mei, Q.; Li, Y. Apple polysaccharide prevents from colitis-associated carcinogenesis through regulating macrophage polarization. Int. J. Biol. Macromol. 2020, 161, 704–711. [Google Scholar] [CrossRef] [PubMed]
- Wu, K.; Fan, J.; Huang, X.; Wu, X.; Guo, C. Hepatoprotective effects exerted by Poria Cocos polysaccharides against acetaminophen-induced liver injury in mice. Int. J. Biol. Macromol. 2018, 114, 137–142. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Yu, X.; Xu, X.; Zhang, X.; Zhang, X. The protective effects of Poria cocos-derived polysaccharide CMP33 against IBD in mice and its molecular mechanism. Food Funct. 2018, 9, 5936–5949. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Li, S.; Li, H.; Zhao, C.; Ma, H.; Zhao, X.; Wu, J.; Liu, K.; Shan, J.; Wang, Y. Effect of a polysaccharide from Poria cocos on humoral response in mice immunized by H1N1 influenza and HBsAg vaccines. Int. J. Biol. Macromol. 2016, 91, 248–257. [Google Scholar] [CrossRef]
- Chen, X.; Zhang, L.; Cheung, P.C.K. Immunopotentiation and anti-tumor activity of carboxymethylated-sulfated β-(1→3)-d-glucan from Poria cocos. Int. Immunopharmacol. 2010, 10, 398–405. [Google Scholar] [CrossRef]
- Cheng, Y.; Xie, Y.; Ge, J.-C.; Wang, L.; Peng, D.-Y.; Yu, N.-J.; Zhang, Y.; Jiang, Y.-H.; Luo, J.-P.; Chen, W.-D. Structural characterization and hepatoprotective activity of a galactoglucan from Poria cocos. Carbohydr. Polym. 2021, 2, 117979. [Google Scholar] [CrossRef]
- Wang, Y.; Zhang, M.; Ruan, D.; Shashkov, A.S.; Kilcoyne, M.; Savage, A.V.; Zhang, L. Chemical components and molecular mass of six polysaccharides isolated from the sclerotium of Poria cocos. Carbohydr. Res. 2004, 339, 327–334. [Google Scholar] [CrossRef]
- Ta, W.; Chawla, A.; Pollard, J. Origins and Hallmarks of Macrophages: Development, Homeostasis, and Disease. Nature 2013, 496, 445–455. [Google Scholar] [CrossRef]
- Fernández, N.; Alonso, S.; Valera, I.; Vigo, A.G.; Renedo, M.; Barbolla, L.; Crespo, M.S. Mannose-Containing Molecular Patterns Are Strong Inducers of Cyclooxygenase-2 Expression and Prostaglandin E 2 Production in Human Macrophages. J. Immunol. 2005, 174, 8154–8162. [Google Scholar] [CrossRef]
- Netea, M.G.; Gow, N.A.; Munro, C.A.; Bates, S.; Collins, C.; Ferwerda, G.; Hobson, R.P.; Bertram, G.; Hughes, H.B.; Jansen, T.; et al. Immune sensing of Candida albicans requires cooperative recognition of mannans and glucans by lectin and Toll-like receptors. J. Clin. Investig. 2006, 116, 1642–1650. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.Y.; You, H.J.; Jeong, H.G.; Kang, J.S.; Kim, H.M.; Rhee, S.D.; Jeon, Y.J. Polysaccharide isolated from Poria cocos sclerotium induces NF-κB/Rel activation and iNOS expression through the activation of p38 kinase in murine macrophages. Int. Immunopharmacol. 2004, 4, 1029–1038. [Google Scholar] [CrossRef] [PubMed]
- Pu, Y.; Liu, Z.; Tian, H.; Bao, Y. The immunomodulatory effect of Poria cocos polysaccharides is mediated by the Ca 2+/PKC/p38/NF-κB signaling pathway in macrophages. Int. Immunopharmacol. 2019, 72, 252–257. [Google Scholar] [CrossRef] [PubMed]
- Tao, S.; Chen, Q.; Lin, C.; Dong, H. Linc00514 promotes breast cancer metastasis and M2 polarization of tumor-associated macrophages via Jagged1-mediated notch signaling pathway. J. Exp. Clin. Cancer Res. 2020, 39, 191. [Google Scholar] [CrossRef] [PubMed]
- Guenter, R.; Patel, Z.; Chen, H. Notch Signaling in Thyroid Cancer. Notch Signal. Embryol. Cancer Notch Signal. Cancer 2021, 1287, 155–168. [Google Scholar] [CrossRef]
- Christopoulos, P.F.; Gjølberg, T.T.; Krüger, S.; Haraldsen, G.; Andersen, J.T.; Sundlisæter, E. Targeting the Notch Signaling Pathway in Chronic Inflammatory Diseases. Front. Immunol. 2021, 12, 668207. [Google Scholar] [CrossRef]
- Aoyama, T.; Takeshita, K.; Kikuchi, R.; Yamamoto, K.; Cheng, X.W.; Liao, J.K.; Murohara, T. Gamma-Secretase inhibitor reduces diet-induced atherosclerosis in apolipoprotein E-deficient mice. Biochem. Biophys. Res. Commun. 2009, 383, 216–221. [Google Scholar] [CrossRef]
- Jurynczyk, M.; Jurewicz, A.; Raine, C.S.; Selmaj, K. Notch3 inhibition in myelin-reactive T cells down-regulates protein kinase C theta and attenuates experimental autoimmune encephalomyelitis. J. Immunol. 2008, 180, 2634–2640. [Google Scholar] [CrossRef]
- Guruharsha, K.G.; Kankel, M.W.; Artavanis-Tsakonas, S. The Notch signalling system: Recent insights into the complexity of a conserved pathway. Nat. Rev. Genet. 2012, 13, 654–666. [Google Scholar] [CrossRef]
- Ferrandino, F.; Grazioli, P.; Bellavia, D.; Campese, A.F.; Screpanti, I.; Felli, M.P. Notch and NF-κB: Coach and players of regulatory T-Cell response in cancer. Front. Immunol. 2018, 9, 2165. [Google Scholar] [CrossRef]
- Meurette, O.; Mehlen, P. Notch Signaling in the Tumor Microenvironment. Cancer Cell 2018, 34, 536–548. [Google Scholar] [CrossRef]
- Foldi, J.; Chung, A.Y.; Xu, H.; Zhu, J.; Outtz, H.H.; Kitajewski, J.; Li, Y.; Hu, X.; Ivashkiv, L.B. Autoamplification of Notch signaling in macrophages by TLR- induced and RBP-J-dependent induction of Jagged1. J. Immunol. 2011, 185, 5023–5031. [Google Scholar] [CrossRef] [PubMed]
- Yin, Q.; Wang, W.; Cui, G.; Yan, L.; Zhang, S. Potential role of the Jagged1/Notch1 signaling pathway in the endothelial-myofibroblast transition during BLM-induced pulmonary fibrosis. J. Cell Physiol. 2018, 233, 2451–2463. [Google Scholar] [CrossRef] [PubMed]
- Camelo, S.; Raoul, W.; Lavalette, S.; Calippe, B.; Cristofaro, B.; Levy, O.; Houssier, M.; Sulpice, E.; Jonet, L.; Klein, C.; et al. Delta-like 4 inhibits choroidal neovascularization despite opposing effects on vascular endothelium and macrophages. Angiogenesis 2012, 15, 609–622. [Google Scholar] [CrossRef] [PubMed]
- Nickoloff, B.J.; Qin, J.-Z.; Chaturvedi, V.; Denning, M.F.; Bonish, B.; Miele, L. Jagged-1 mediated activation of notch signaling induces complete maturation of human keratinocytes through NF-κB and PPARγ. Cell Death Differ. 2002, 9, 842–855. [Google Scholar] [CrossRef]
- Singla, D.K.; Wang, J.; Singla, R. Primary human monocytes differentiate into M2 macrophages and involve notch-1 pathway. Can. J. Physiol. Pharmacol. 2016, 95, 288–294. [Google Scholar] [CrossRef] [PubMed]
- Lu, M.-K.; Cheng, J.-J.; Lin, C.-Y.; Chang, C.-C. Purification, structural elucidation, and anti-inflammatory effect of a water-soluble 1,6-branched 1,3-α-d-galactan from cultured mycelia of Poria cocos. Food Chem. 2010, 118, 349–356. [Google Scholar] [CrossRef]
- Shi, C.; Ma, Q.; Ren, M.; Liang, D.; Yu, Q.; Luo, J. Antitumor pharmacological mechanism of the oral liquid of Poria cocos polysaccharide. J. Ethnopharmacol. 2017, 209, 24–31. [Google Scholar] [CrossRef]
- Tang, J.; Nie, J.; Li, D.; Zhu, W.; Zhang, S.; Ma, F.; Sun, Q.; Song, J.; Zheng, Y.; Chen, P. Characterization and antioxidant activities of degraded polysaccharides from Poria cocos sclerotium. Carbohydr. Polym. 2014, 105, 121–126. [Google Scholar] [CrossRef]
- Chen, Y.; Liu, W.; Wang, Y.; Zhang, L.; Wei, J.; Zhang, X.; He, F.; Zhang, L. Casein Kinase 2 Interacting Protein-1 regulates M1 and M2 inflammatory macrophage polarization. Cell. Signal. 2017, 33, 107–121. [Google Scholar] [CrossRef]
- Arora, S.; Dev, K.; Agarwal, B.; Das, P.; Syed, M.A. Macrophages: Their role, activation and polarization in pulmonary diseases. Immunobiology 2018, 223, 383–396. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Bozec, A.; Ramming, A.; Schett, G. Anti-inflammatory and immune-regulatory cytokines in rheumatoid arthritis. Nat. Rev. Rheumatol. 2019, 15, 9–17. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Han, C.-C.; Cui, D.; Li, Y.; Ma, Y.; Wei, W. Is macrophage polarization important in rheumatoid arthritis? Int. Immunopharmacol. 2017, 50, 345–352. [Google Scholar] [CrossRef] [PubMed]
- TChanmee, T.; Ontong, P.; Konno, K.; Itano, N. Tumor-associated macrophages as major players in the tumor microenvironment. Cancers 2014, 6, 1670–1690. [Google Scholar] [CrossRef]
- Ivashkiv, L.B. Epigenetic regulation of macrophage polarization and function. Trends Immunol. 2013, 34, 216–223. [Google Scholar] [CrossRef] [PubMed]
- Mauer, J.; Denson, J.L.; Brüning, J.C. Versatile functions for IL-6 in metabolism and cancer. Trends Immunol. 2015, 36, 92–101. [Google Scholar] [CrossRef] [PubMed]
- Sang, J.; Chen, Y.; Tao, Y. Nitric oxide inhibits gastric cancer cell growth through the modulation of the Akt pathway. Mol. Med. Rep. 2011, 4, 1163–1167. [Google Scholar] [CrossRef]
- Grivennikov, S.; Karin, E.; Terzic, J.; Mucida, D.; Yu, G.-Y.; Vallabhapurapu, S.; Scheller, J.; Rose-John, S.; Cheroutre, H.; Eckmann, L.; et al. IL-6 and Stat3 Are Required for Survival of Intestinal Epithelial Cells and Development of Colitis-Associated Cancer. Cancer Cell. 2009, 15, 103–113. [Google Scholar] [CrossRef]
- Na, Y.; Stakenborg, M.; Seok, S.; Matteoli, G. Macrophages in intestinal inflammation and resolution: A potential therapeutic target in IBD. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 531–543. [Google Scholar] [CrossRef]
- Menen, R.; Hassanein, M.K.; Momiyama, M.; Suetsugu, A.; Moossa, A.R.; Bouvet, M.; Hoffman, R.M. Tumor-educated macrophages promote tumor growth and peritoneal metastasis in an orthotopic nude mouse model of human pancreatic cancer. Cancer Res. 2012, 26, 565–570. [Google Scholar] [CrossRef]
- Ren, J.; Hou, C.; Shi, C.; Lin, Z.; Liao, W.; Yuan, E. A polysaccharide isolated and purified from Platycladus orientalis (L.) Franco leaves, characterization, bioactivity and its regulation on macrophage polarization. Carbohydr. Polym. 2019, 213, 276–285. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y. Biological activities and potential health benefits of polysaccharides from Poria cocos and their derivatives. Int. J. Biol. Macromol. 2014, 68, 131–134. [Google Scholar] [CrossRef] [PubMed]
- Wu, H.; Yin, Y.; Hu, X.; Peng, C.; Liu, Y.; Li, Q.; Huang, W.; Huang, Q. Effects of Environmental pH on Macrophage Polarization and Osteoimmunomodulation. ACS Biomater. Sci. Eng. 2019, 5, 5548–5557. [Google Scholar] [CrossRef] [PubMed]
- Chen, F.; Huang, G. Preparation and immunological activity of polysaccharides and their derivatives. Int. J. Biol. Macromol. 2018, 112, 211–216. [Google Scholar] [CrossRef]
- Basso, A.M.M.; De Castro, R.J.A.; de Castro, T.B.; I Guimarães, H.; Polez, V.L.P.; Carbonero, E.R.; Pomin, V.H.; Hoffmann, C.; Grossi-De-Sa, M.F.; Tavares, A.H.; et al. Immunomodulatory activity of β-glucan-containing exopolysaccharides from Auricularia auricular in phagocytes and mice infected with Cryptococcus neoformans. Med. Mycol. 2020, 58, 227–239. [Google Scholar] [CrossRef]
- Zhang, M.; Wu, W.; Ren, Y.; Li, X.; Tang, Y.; Min, T.; Lai, F.; Wu, H. Structural Characterization of a Novel Polysaccharide from Lepidium meyenii (Maca) and Analysis of Its Regulatory Function in Macrophage Polarization in Vitro. J. Agric. Food Chem. 2017, 65, 1146–1157. [Google Scholar] [CrossRef]
- Bi, S.; Huang, W.; Chen, S.; Huang, C.; Li, C.; Guo, Z.; Yang, J.; Zhu, J.; Song, L.; Yu, R. Cordyceps militaris polysaccharide converts immunosuppressive macrophages into M1-like phenotype and activates T lymphocytes by inhibiting the PD-L1/PD-1 axis between TAMs and T lymphocytes. Int. J. Biol. Macromol. 2020, 150, 261–280. [Google Scholar] [CrossRef]
- Li, Y.; Xu, F.; Zheng, M.; Xi, X.; Cui, X.; Han, C. Maca polysaccharides: A review of compositions, isolation, therapeutics and prospects. Int. J. Biol. Macromol. 2018, 111, 894–902. [Google Scholar] [CrossRef]
- Zhang, Q.; Wang, C.; Liu, Z.; Liu, X.; Han, C.; Cao, X.; Li, N. Notch signal suppresses toll-like receptor-triggered inflammatory responses in macrophages by inhibiting extracellular signal-regulated kinase 1/2-mediated nuclear factor κB activation. J. Biol. Chem. 2012, 287, 6208–6217. [Google Scholar] [CrossRef]
- Wei, W.; Li, Z.; Bian, Z.; Han, Q. Astragalus polysaccharide RAP induces macrophage phenotype polarization to M1 via the notch signaling pathway. Molecules 2019, 24, 2016. [Google Scholar] [CrossRef]
- Zhang, W.; Xu, W.; Xiong, S. Blockade of Notch1 Signaling Alleviates Murine Lupus via Blunting Macrophage Activation and M2b Polarization. J. Immunol. 2010, 184, 6465–6478. [Google Scholar] [CrossRef] [PubMed]
- Zhou, D.; Huang, C.; Lin, Z.; Zhan, S.; Kong, L.; Fang, C.; Li, J. Macrophage polarization and function with emphasis on the evolving roles of coordinated regulation of cellular signaling pathways. Cell. Signal. 2014, 26, 192–197. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.-C.; He, F.; Feng, F.; Liu, X.-W.; Dong, G.-Y.; Qin, H.-Y.; Hu, X.-B.; Zheng, M.-H.; Liang, L.; Feng, L.; et al. Notch signaling determines the M1 versus M2 polarization of macrophages in antitumor immune responses. Cancer Res. 2010, 70, 4840–4849. [Google Scholar] [CrossRef] [PubMed]
- Palaga, T.; Buranaruk, C.; Rengpipat, S.; Fauq, A.H.; Golde, T.E.; Kaufmann, S.H.E.; Osborne, B.A. Notch signaling is activated by TLR stimulation and regulates macrophage functions. Eur. J. Immunol. 2008, 38, 174–183. [Google Scholar] [CrossRef] [PubMed]
- Porcelli, L.; Mazzotta, A.; Garofoli, M.; Di Fonte, R.; Guida, G.; Guida, M.; Tommasi, S.; Azzariti, A. Active notch protects MAPK activated melanoma cell lines from MEK inhibitor cobimetinib. Biomed. Pharmacother. 2021, 133, 111006. [Google Scholar] [CrossRef] [PubMed]
- Ahmad, J.; Baig, M.A.; Ali, A.A.; Al-Huqail, A.; Ibrahim, M.M.; Qureshi, M.I. Comparative assessment of four RNA extraction methods and modification to obtain high-quality RNA from Parthenium hysterophorus leaf. 3 Biotech. 2017, 7, 373. [Google Scholar] [CrossRef]
- Hong, L.-L.; Wang, Q.; Zhao, Y.-T.; Zhang, S.; Zhang, K.-Q.; Chen, W.-D.; Peng, C.; Liu, L.; Wang, H.-S. Evaluation of Zhenwu Decoction Effects on CYP450 Enzymes in Rats Using a Cocktail Method by UPLC-MS/MS. BioMed Res. Int. 2020, 2020, 4816209. [Google Scholar] [CrossRef]








| Name | Sugar Content (%) | Reverse Primer | Uronic Acid Content (%) |
|---|---|---|---|
| PCP-1C | 96.97 ± 1.37 | 0.70 ± 0.22 | 0.09 ± 0.02 |
| Forward Primer | Reverse Primer | |
|---|---|---|
| IL-12 | GACCTGTTTACCACTGGAACTA | GATCTGCTGATGGTTGTGATTC |
| IL-10 | TTCTTTCAAACAAAGGACCAGC | GCAACCCAAGTAACCCTTAAAG |
| IL-6 | CTCCCAACAGACCTGTCTATAC | CCATTGCACAACTCTTTTCTCA |
| TNF-α | ATGTCTCAGCCTCTTCTCATTC | GCTTGTCACTCGAATTTTGAGA |
| β-actin | GTCCCTCACCCTCCCAAAAG | GCTGCCTCAACACCTCAACCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hu, X.; Hong, B.; Shan, X.; Cheng, Y.; Peng, D.; Hu, R.; Wang, L.; Chen, W. The Effect of Poria cocos Polysaccharide PCP-1C on M1 Macrophage Polarization via the Notch Signaling Pathway. Molecules 2023, 28, 2140. https://doi.org/10.3390/molecules28052140
Hu X, Hong B, Shan X, Cheng Y, Peng D, Hu R, Wang L, Chen W. The Effect of Poria cocos Polysaccharide PCP-1C on M1 Macrophage Polarization via the Notch Signaling Pathway. Molecules. 2023; 28(5):2140. https://doi.org/10.3390/molecules28052140
Chicago/Turabian StyleHu, Xuerui, Bangzhen Hong, Xiaoxiao Shan, Yue Cheng, Daiyin Peng, Rongfeng Hu, Lei Wang, and Weidong Chen. 2023. "The Effect of Poria cocos Polysaccharide PCP-1C on M1 Macrophage Polarization via the Notch Signaling Pathway" Molecules 28, no. 5: 2140. https://doi.org/10.3390/molecules28052140
APA StyleHu, X., Hong, B., Shan, X., Cheng, Y., Peng, D., Hu, R., Wang, L., & Chen, W. (2023). The Effect of Poria cocos Polysaccharide PCP-1C on M1 Macrophage Polarization via the Notch Signaling Pathway. Molecules, 28(5), 2140. https://doi.org/10.3390/molecules28052140

