Frameshifting in the P6 cDNA Phage Display System
Abstract
:1. Introduction
2. Results and Discussion
2.1. Fusion of an E-tag to the ApoE cDNA Sequence
2.2. Detection of Protein Display on the Surface of the Phage
2.3. Detection of E-tag Expression
2.4. Specific Enrichment of Frameshifted Phage Clone UH-FS
3. Experimental
3.1. Serological Antigen Selection of a Multiple Sclerosis cDNA Phage Display Library on Patient Plasma
3.2. Generation of E-tag Constructs
3.3. Detection of ApoE and E-tag Expression by ELISA
3.4. Measuring ApoE-antibody reactivity in plasma of MS patients
4. Conclusions
Acknowledgements
References
- Smith, G.P. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science 1985, 228, 1315–1317. [Google Scholar]
- Parmley, S.F.; Smith, G.P. Antibody-selectable filamentous fd phage vectors: affinity purification of target genes. Gene 1988, 73, 305–318. [Google Scholar] [CrossRef]
- Smith, G.P.; Petrenko, V.A. Phage Display. Chem. Rev. 1997, 97, 391–410. [Google Scholar]
- Jacobsson, K.; Rosander, A.; Bjerketorp, J.; Frykberg, L. Shotgun phage display - selection for bacterial receptins or other exported proteins. Biol. Proced. Online 2003, 5, 123–135. [Google Scholar] [CrossRef] [Green Version]
- Jespers, L.S.; Messens, J.H.; De Keyser, A.; Eeckhout, D.; Van, d.B., I; Gansemans, Y.G.; Lauwereys, M.J.; Vlasuk, G.P.; Stanssens, P.E. Surface expression and ligand-based selection of cDNAs fused to filamentous phage gene VI. Biotechnology (NY) 1995, 13, 378–382. [Google Scholar] [CrossRef]
- Hufton, S.E.; Moerkerk, P.T.; Meulemans, E.V.; de Bruine, A.; Arends, J.W.; Hoogenboom, H.R. Phage display of cDNA repertoires: the pVI display system and its applications for the selection of immunogenic ligands. J. Immunol. Methods 1999, 231, 39–51. [Google Scholar] [CrossRef]
- Somers, V.; Govarts, C.; Hellings, N.; Hupperts, R.; Stinissen, P. Profiling the autoantibody repertoire by serological antigen selection. J. Autoimmun. 2005, 25, 223–228. [Google Scholar] [CrossRef]
- Somers, V.; Govarts, C.; Somers, K.; Hupperts, R.; Medaer, R.; Stinissen, P. Autoantibody profiling in multiple sclerosis reveals novel antigenic candidates. J. Immunol. 2008, 180, 3957–3963. [Google Scholar]
- Somers, V.A.; Brandwijk, R.J.; Joosten, B.; Moerkerk, P.T.; Arends, J.W.; Menheere, P.; Pieterse, W.O.; Claessen, A.; Scheper, R.J.; Hoogenboom, H.R.; Hufton, S.E. A panel of candidate tumor antigens in colorectal cancer revealed by the serological selection of a phage displayed cDNA expression library. J. Immunol. 2002, 169, 2772–2780. [Google Scholar]
- Govarts, C.; Somers, K.; Hupperts, R.; Stinissen, P.; Somers, V. Exploring cDNA phage display for autoantibody profiling in the serum of multiple sclerosis patients: optimization of the selection procedure. Ann. NY Acad. Sci. 2007, 1109, 372–384. [Google Scholar] [CrossRef]
- Somers, K.; Stinissen, P.; Somers, V. Optimization of high-throughput autoantibody profiling for the discovery of novel antigenic targets in rheumatoid arthritis. Ann. NY Acad. Sci. 2009, 1173, 92–102. [Google Scholar] [CrossRef]
- Jacobsson, K.; Frykberg, L. Cloning of ligand-binding domains of bacterial receptors by phage display. Biotechniques 1995, 18, 878–885. [Google Scholar]
- Jacobsson, K.; Frykberg, L. Phage display shot-gun cloning of ligand-binding domains of prokaryotic receptors approaches 100% correct clones. Biotechniques 1996, 20, 1070–1071. [Google Scholar]
- Carcamo, J.; Ravera, M.W.; Brissette, R.; Dedova, O.; Beasley, J.R.; Alam-Moghe, A.; Wan, C.; Blume, A.; Mandecki, W. Unexpected frameshifts from gene to expressed protein in a phage-displayed peptide library. Proc. Natl. Acad. Sci. USA 1998, 95, 11146–11151. [Google Scholar]
- Goldman, E.; Korus, M.; Mandecki, W. Efficiencies of translation in three reading frames of unusual non-ORF sequences isolated from phage display. FASEB J. 2000, 14, 603–611. [Google Scholar]
- Suzuki, Y.; Ito, S.; Otsuka, K.; Iwasawa, E.; Nakajima, M.; Yamaguchi, I. Preparation of functional single-chain antibodies against bioactive gibberellins by utilizing randomly mutagenized phage-display libraries. Biosci. Biotechnol. Biochem. 2005, 69, 610–619. [Google Scholar] [CrossRef]
- Marks, J.D.; Hoogenboom, H.R.; Bonnert, T.P.; McCafferty, J.; Griffiths, A.D.; Winter, G. By-passing immunization. Human antibodies from V-gene libraries displayed on phage. J. Mol. Biol. 1991, 222, 581–597. [Google Scholar] [CrossRef]
Appendix
Name | Sequence |
ApoE forward primer | GGATCCGGTGGAGGCTCAGGCGGAGGGCCAAGTCGGCCAGATCTTCTAGAGAATTC |
E-tag reverse primer | GCGGCCGCACGCGGTTCCAGCGGATCCGGATACGGCACCGGCGCACCGCACACGTCCTCCAT |
NC reverse primer | GCGGCCGCACGCGGTTCCAGCGGATCCGGATACGGCACCGGCGCACCCCTCGTGCCGAATT |
PC reverse primer | GCGGCCGCACGCGGTTCCAGCGGATCCGGATACGGCACCGGCGCACCACCTCGTGCCGAATT |
M13 forward primer | CAGGAAACAGCTATGAC |
M13 reverse primer | GTAAAACGACGGCCAG |
gVI forward primer | TTACCCTCTGACTTTGTTCAGG |
© 2010 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Govarts, C.; Somers, K.; Stinissen, P.; Somers, V. Frameshifting in the P6 cDNA Phage Display System. Molecules 2010, 15, 9380-9390. https://doi.org/10.3390/molecules15129380
Govarts C, Somers K, Stinissen P, Somers V. Frameshifting in the P6 cDNA Phage Display System. Molecules. 2010; 15(12):9380-9390. https://doi.org/10.3390/molecules15129380
Chicago/Turabian StyleGovarts, Cindy, Klaartje Somers, Piet Stinissen, and Veerle Somers. 2010. "Frameshifting in the P6 cDNA Phage Display System" Molecules 15, no. 12: 9380-9390. https://doi.org/10.3390/molecules15129380
APA StyleGovarts, C., Somers, K., Stinissen, P., & Somers, V. (2010). Frameshifting in the P6 cDNA Phage Display System. Molecules, 15(12), 9380-9390. https://doi.org/10.3390/molecules15129380