Search Results (41)

Endometriosis is a disorder characterized by the presence of endometrial tissue outside the uterus, leading to dyspareunia, chronic pelvic pain, dysuria, and infertility. The latter has been related to implantation failure associated with alterations in decidualization, a process regulated by sex hormones such as progesterone. Membrane progesterone receptor β (mPRβ) exhibits a lower expression in endometriotic tissues than in normal endometrial ones. However, the role of mPRβ in decidualization is unknown. This work aimed to investigate whether mPRβ plays a role in the decidualization of endometrial stromal cells (ESCs) derived from women with and without endometriosis. The mPR agonist OrgOD-2 induced the gene expression of key decidualization markers (insulin-like growth factor binding protein 1, prolactin, transcription factor heart and neural crest derivatives-expressed transcript 2, and fork-head transcription factor) in healthy ESCs, eutopic (uterine cavity), and ectopic (outside of the uterine cavity) ESCs from women with endometriosis. Notably, the expression of the decidualization markers was lower in endometriotic cells than in healthy endometrial ones. An siRNA mediated knockdown of mPRβ reduced the expression of decidualization-associated genes in ESCs treated with a decidualization stimuli, regardless of whether cells were derived from healthy women or those with endometriosis. Our data suggest that progesterone, through mPRβ activation, regulates the decidualization process in endometrial stromal cells from women with and without endometriosis. Full article

Background: The principal function of mammary glands is to produce milk to nourish the newborn. Optimal lactation is controlled by various hormones, growth factors, and cytokines. Objectives: Using 3D cultures of primary mouse mammary epithelial cells, we explored the effects of T helper (Th)1 cytokines, interferon (IFN)-γ, and tumor necrosis factor (TNF)-α on the structure and function of mammary cells as well as the underlying mechanism. Methods: Three-dimensional cultures of mammary cells were treated with IFN-γ/TNF-α, and milk protein expression and acinar structures were analyzed by immunoblotting and immunofluorescence microscopy. Results: Our results revealed that combined treatment with IFN-γ and TNF-α inhibits prolactin-induced STAT5 tyrosine phosphorylation and β-casein expression. These cytokines also disrupted the structure of mammary acini, resulting in smaller or no lumens, disordered cell arrangements, and multilayered cells in certain regions. Additionally, some cells became elongated rather than maintaining their usual cube-like shape. Since cell proliferation and death can modulate the structural organization of acini, we examined the influences of IFN-γ and TNF-α on these events. Combined cytokine treatment moderately increased cell proliferation and cell death. Notably, stimulation with IFN-γ and TNF-α induced the expression of inducible nitric oxide synthase (iNOS), and the inhibition of iNOS partially restored acinar morphology and β-casein expression, revealing a novel mechanism for cytokine-induced acinar disruption. Conclusions: When a Th1 cytokine milieu is dominant, such as during inflammation and infection, IFN-γ and TNF-α might cause mammary gland ductal occlusion and lactation insufficiency. Full article

Breast cancer (BC) is the most common cancer in women, and a higher level of prolactin-induced protein (PIP) is associated with better responses to adjuvant chemotherapy. The signal transducer and activator of transcription 5 (STAT5) is a potential regulator of the PIP gene. Prolactin (PRL) and its receptor (PRLR) activate JAK2/STAT5 signaling in BC, which is modulated by inhibitors like suppressors of cytokine signaling (SOCS) proteins and protein inhibitors of activated STAT (PIAS). Using real-time PCR and immunohistochemistry, we studied the relationship between PIP and STAT5 inhibitors in BC. Our findings indicated that PIP and STAT5 levels decrease with a higher tumor grade, size, and tumor/nodes/metastasis (TNM) clinical stage, while nuclear PIAS3 levels increase with tumor progression. Both STAT inhibitors are linked to estrogen and progesterone receptor status. Notably, STAT5 correlates positively with PIP, SOCS3, and PIAS3, suggesting that it may be a favorable prognostic factor. Among the STAT inhibitors, only nuclear PIAS3 expression correlates with PIP. In vitro studies indicated that silencing PIAS3 in T47D cells does not affect PIP expression or sensitivity to doxorubicin (DOX), but T47D control cells with a higher PIP expression are more sensitive to DOX, highlighting the need for further investigation into these mechanisms. Full article

High concentrations of prolactin (PRL)-induced ovine ovarian granulosa cell (GCs) apoptosis and MAPK12 could aggravate the induced effect. However, the molecular mechanisms that MAPK12-induced GC apoptosis and repressed steroid hormone secretion remain unclear. In this study, GCs in the P group (GCs with high PRL concentration: 500 ng/mL PRL) and P-10 group (GCs with 500 ng/mL PRL infected by lentiviruses carrying overexpressed sequences of MAPK12) were collected for whole-transcriptome analysis. Then, we applied the miRNA mimics combined with a dual-luciferase reporter gene assay to explore the molecular mechanisms through which MAPK12 affected GC apoptosis and steroid hormones secretion. The whole-transcriptome analysis indicated that MAPK12 regulated high PRL concentration GC apoptosis and steroid hormone secretion mainly through novel 58. The expression of pro-apoptotic proteins Caspase 3 and Bax was increased, while the expression of anti-apoptotic protein BCL-2 declined by novel 58-5p in high PRL concentration GCs (p < 0.05); The secretion of steroid hormones and genes associated with steroid secretion (CYP11A1, 3β-HSD and CYP19A1) decreased (p < 0.05), while the protein expression of the target gene, SREBF1 of novel 58, was repressed by novel 58-5p in high PRL concentration GCs (p < 0.05). Dual-luciferase reporter gene analysis showed that SREBF1 was confirmed as a target gene of novel 58-5p and the negative feedback interaction was established between novel 58-5p and SREBF1. The ggccggctgggggattgccg sequence may be the target site of SREBF1, targeted by novel 58-5p. In addition, steroid hormone secretion was reduced and GC apoptosis was suppressed after the interference of SREBF1 in ovine ovarian GCs with high PRL concentration. In conclusion, novel 58-5p regulated ovine ovarian GC apoptosis and steroid hormone secretion by targeting SREBF1. Full article

Background: Untreated hyperprolactinemia and autoimmune thyroiditis (Hashimoto’s disease) seem to increase cardiometabolic risk. The cardiometabolic effects of cabergoline were less significant in young women with concurrent euthyroid Hashimoto’s illness. This study sought to investigate if the detrimental effects of this condition on cabergoline efficacy are also evident in postmenopausal women. Methods: The study comprised 50 postmenopausal women exhibiting increased prolactin levels, with half qualifying for euthyroid Hashimoto’s illness. The subjects with thyroid autoimmunity were matched with those without thyroid disease according to age, body mass index, and prolactin levels. In addition to prolactin, we assessed thyroid-stimulating hormone (TSH), thyroid antibodies, and glucose homeostasis markers: fasting glucose, the homeostatic model assessment 1 of insulin resistance ratio (HOMA1-IR), and glycated hemoglobin (HbA1c). Furthermore, we assessed plasma lipids, plasma uric acid levels, high-sensitivity C-reactive protein (hsCRP), fibrinogen, homocysteine, and the urine albumin-to-creatinine ratio (UACR). The decadal cardiovascular risk was assessed with the Framingham Risk Score (FRS). Results: Before therapy, disparities existed among groups in HOMA1-IR, HDL cholesterol, antibody titers, uric acid, hsCRP, fibrinogen, homocysteine, UACR, and FRS. After six months of treatment, cabergoline successfully corrected prolactin levels (both total and monomeric) in women without thyroid disorders. This normalization correlated with decreases in HOMA1-IR, triglycerides, uric acid, hsCRP, fibrinogen, homocysteine, UACR, and FRS, as well as an elevation in HDL cholesterol. In women diagnosed with Hashimoto’s disease, cabergoline’s effects were limited to a reduction in prolactin levels, HOMA1-IR, and UACR, as well as an elevation in HDL cholesterol, with these alterations being less pronounced compared to women without thyroid illness. Conclusions: The cardiometabolic benefits of cabergoline were associated with the degree of prolactin concentration reduction. In women diagnosed with Hashimoto’s disease, connections were noted between baseline levels and treatment-induced alterations in hsCRP. These data indicate that concurrent euthyroid autoimmune thyroiditis mitigates the cardiometabolic consequences of cabergoline. Full article

Prolactin induced-protein (PIP) has been found to be rich in immunomodulatory epitopes, including N-acetyllactosamine (LacNAc) and N,N-diacetyllactosamine (LacdiNAc) residues, which may constitute ligands for galecin-3 (Gal-3). In the current study, we aimed to investigate the reactivity of galactose- and N-acetylgalactosamine-specific lectins with human seminal plasma PIP. Subsequently, we examined the direct interaction between seminal plasma PIP and galectin-3, and next analyzed whether there are any differences in the interaction associated with impaired semen parameters. The reactivity of terminal galactose-presenting glycans in seminal plasma PIP with Ricinus communis agglutinin I in the asthenozoospermic group was significantly higher compared to the normozoospermic fertile subjects. Investigating the reactivity of Wisteria floribunda lectin with PIP glycans, we found likewise significantly higher relative reactivity in the normozoospermic infertile as well as the oligoasthenozoopermic group compared to the control group. These results are related to the expression of LacdiNAc epitopes in the oligosaccharide chain of PIP. Finally, we observed that PIP reactivity with Wisteria floribunda lectin correlates positively with the interaction between galectin-3 and PIP in the seminal plasma. This can suggest that LacdiNAc residues are engaged in the interaction between PIP and galectin-3. Full article

Low prolactin levels in men predispose them to mood disturbances, sexual dysfunction, and diabetes. The purpose of the current study was to assess cardiometabolic risk in males with hypoprolactinemia. This prospective study included three age-matched groups of young and middle-aged men: individuals with cabergoline-induced hypoprolactinemia (n = 15), cabergoline-treated subjects with prolactin levels within the reference range (n = 20), and untreated men with normal prolactin levels (n = 31). In men with hypoprolactinemia, the cabergoline dose was reduced in order to normalize prolactin concentration. Anthropometric parameters, blood pressure, QRISK3 score; plasma concentrations of prolactin, glucose, insulin, lipids, uric acid, high-sensitivity C-reactive protein (hsCRP), fibrinogen, homocysteine, and testosterone; whole-blood levels of glycated hemoglobin (HbA_1C); urinary albumin-to-creatinine ratio (UACR); and carotid intima–media thickness were assessed at baseline and six months later. Men with hypoprolactinemia were characterized by higher body mass index, fat content, waist circumference, systolic blood pressure, fasting and 2 h post-load glucose, HbA_1C, HOMA1-IR, uric acid, hsCRP, fibrinogen, homocysteine, and UACR; by lower HDL cholesterol and testosterone; by greater intima–media thickness; and by a higher QRISK3 score than their peers with normal prolactin levels. There were no statistically significant differences in the measured parameters between both groups of men with normal prolactin levels. Normalization of prolactin concentration was accompanied by normalization of biochemical variables, systolic blood pressure, and QRISK3 score. Although cabergoline dose reduction did not cause statistically significant changes in the remaining anthropometric parameters and intima–media thickness, six months later, they did not differ from those observed in the remaining study groups. Our findings suggest that iatrogenic hypoprolactinemia is associated with increased cardiometabolic risk, which is reversible and resolves after the normalization of prolactin levels. Full article

Metformin inhibits the secretory function of overactive anterior pituitary cells, including lactotropes. In women of childbearing age, this effect was absent if they had coexisting autoimmune (Hashimoto) thyroiditis. The current study was aimed at investigating whether autoimmune thyroiditis modulates the impact of metformin on the plasma prolactin concentration in men. This prospective cohort study included two groups of middle-aged or elderly men with drug-induced hyperprolactinemia, namely subjects with concomitant Hashimoto thyroiditis (group A) and subjects with normal thyroid function (group B), who were matched for baseline prolactin concentration and insulin sensitivity. Titers of thyroid peroxidase and thyroglobulin antibodies, levels of C-reactive protein, markers of glucose homeostasis, concentrations of pituitary hormones (prolactin, thyrotropin, gonadotropins, and adrenocorticotropic hormone), free thyroxine, free triiodothyronine, testosterone, and insulin growth factor-1 were measured before and six months after treatment with metformin. Both study groups differed in titers of both antibodies and concentrations of C-reactive protein. The drug reduced the total and monomeric prolactin concentration only in group B, and the impact on prolactin correlated with the improvement in insulin sensitivity and systemic inflammation. There were no differences between the follow-up and baseline levels of the remaining hormones. The results allow us to conclude that autoimmune thyroiditis mitigates the impact of metformin on prolactin secretion in men. Full article

Male infertility may be caused by an impaired sperm functionality, with insufficient vitamin D levels affecting the quantity and development of motile sperm. Given the influence of vitamin D on vital aspects of male infertility, this study aimed to investigate the correlation between vitamin D levels and male infertility, along with exploring the possible mechanism of action. A total of 306 male participants were included. Semen samples were collected and analyzed for semen parameters with demographic features. Patients were classified into two groups based on vitamin D levels of <20 ng/mL (low) and ≥20 ng/mL (high). The Super-PRED, Swiss TargetPrediction, GeneCards, and DisGeNET databases were utilized to retrieve potential molecular targets associated with both vitamin D and male infertility, while the STRING database was employed for constructing protein–protein interaction (PPI) networks and conducting a functional enrichment analysis. A total of 146 patients (47.71%) showed low vitamin D levels and 160 patients (52.29%) had high vitamin D levels. Vitamin D was not strongly influenced by demographic parameters. Vitamin D demonstrated significant positive correlations with type A and B sperm motility. Conversely, it exhibited significant negative correlations with type C and D sperm motility. Hormones (thyroid-stimulating hormone, follicle-stimulating hormone, prolactin, luteinizing hormone, estradiol) were not significantly associated with vitamin D; however, testosterone was significantly positive correlated with vitamin D. Notably, no significant correlation was found between vitamin D levels and iron, ferritin, hemoglobin, hematocrit, calcium, magnesium, and phosphorus levels. The functional annotations of potential vitamin D targets associated with male infertility primarily indicated involvement in regulating infection, the immune response, forkhead box O (FOXO) and hypoxia-inducible factor 1 (HIF1) signals in male infertility. Adequate vitamin D levels are associated with an improved reproductive health, evidenced by positive correlations with hormone levels and sperm motility. Specifically, the FOXO and HIF-1 signaling pathways may be effective in the potential molecular mechanisms underlying the impact of vitamin D on male infertility and/or in the significant correlations identified. Full article

Infertility is a well-recognized multifactorial problem affecting the majority of people who struggle with infertility issues. In recent times, among infertility cases, the male factor has acquired importance, and now it contributes to approximately half of the infertility cases because of different abnormalities. In the current study, we used natural phytochemicals as potential drug-lead compounds to target different receptor proteins that are involved in the onset of male infertility. A set of 210 plant phytochemicals were docked counter to active site residues of sex hormone-binding globulin, a disintegrin and metalloproteinase 17, and DNase I as receptor proteins. On the basis of binding scores and molecular dynamics simulation, the phytochemicals tricin, quercetin, malvidin, rhamnetin, isorhamnetin, gallic acid, kaempferol, esculin, robinetin, and okanin were found to be the potential drug candidates to treat male infertility. Molecular dynamics simulation showed tricin as a strong inhibitor of all selected receptor proteins because the ligand–protein complexes remained stabilized during the entire simulation time of 100 ns. Further, an in vivo study was designed to evaluate the effect of tricin in male rats with nicotine-induced infertility. It was explored that a high dose of tricin significantly reduced the levels of alanine transaminase, aspartate transaminase, urea, creatinine, cholesterol, triglyceride, and low-density lipoprotein and raised the level of high-density lipoprotein in intoxicated male rats. A high dose of tricin also increased the reproductive hormones (i.e., testosterone, luteinizing hormone, follicle-stimulating hormone, and prolactin) and reduced the level of DHEA-SO4. The phytochemical (tricin, 10 mg/kg body weight) also showed significant improvement in the histo-architecture after nicotine intoxication in rats. From the current study, it is concluded that the phytochemical tricin could serve as a potential drug candidate to cure male infertility. Full article

Brucellosis is a notorious zoonotic disease caused by Brucella, which can lead to reproductive diseases in humans and animals, such as infertility and abortion. Lipopolysaccharides (LPS) are the main virulence factor of Brucella. LPS derived from Brucella are different and non-classical and are less toxic and less active than LPS isolated from E. coli. However, the effects and possible mechanisms of Brucella LPS-caused pregnancy loss remain to be revealed. In the present study, we investigated the effects of Brucella suis S2 LPS on early pregnancy loss in mice. The results indicated that embryo implantation failure was induced by Brucella LPS treatment in a dose-dependent manner. The injection of Brucella LPS mainly resulted in fibrinolysis in the decidual area of the uterus on the 6th day post coition (dpc), infiltration of large granular cells among the decidual cells near the embryo on the 8th dpc, a large number of gaps in the decidual area, and cell necrosis around the embryo. In addition, the expression of Cyclin D3 mRNA in the uterus on the 7th and 8th dpc and IGFBP-1 mRNA and the progesterone receptor in the uterus on the 6th and 7th dpc were also inhibited. Moreover, the expression of decidualization marker Cyclin D3 and decidualization prolactin-associated protein (dPRP) in endometrial stromal cells were also inhibited by Brucella LPS treatment in vitro. In summary, Brucella LPS affect the process of endometrial decidualization in mice by affecting the structure of the decidua and the expression of decidual marker factors in endometrial stromal cells. Full article

Breast cancer remains the most frequently diagnosed cancer in women worldwide. Tumors that express hormone receptors account for 75% of all cases. Understanding alternative signaling cascades is important for finding new therapeutic targets for hormone receptor-positive breast cancer patients. JAK-STAT signaling is commonly activated in hormone receptor-positive breast tumors, inducing inflammation, proliferation, migration, and treatment resistance in cancer cells. In hormone receptor-positive breast cancer, the JAK-STAT cascade is stimulated by hormones and cytokines, such as prolactin and IL-6. In normal cells, JAK-STAT is inhibited by the action of the adaptor protein, LNK. However, the role of LNK in breast tumors is not fully understood. This review compiles published reports on the expression and activation of the JAK-STAT pathway by IL-6 and prolactin and potential inhibition of the cascade by LNK in hormone receptor-positive breast cancer. Additionally, it includes analyses of available datasets to determine the level of expression of LNK and various members of the JAK-STAT family for the purpose of establishing associations between expression and clinical outcomes. Together, experimental evidence and in silico studies provide a better understanding of the potential implications of the JAK-STAT-LNK loop in hormone receptor-positive breast cancer progression. Full article

Prolactin-inducible protein (PIP), also referred to as gross cystic disease fluid protein 15 (GCDFP-15), has been a trending topic in recent years due to its potential role as a specific marker in breast cancer. PIP binds to aquaporin-5 (AQP5), CD4, actin, fibrinogen, β-tubulin, serum albumin, hydroxyapatite, zinc α2-glycoprotein, and the Fc fragment of IgGs, and the expression of PIP has been demonstrated to be modulated by various cytokines, including IL4/13, IL1, and IL6. PIP gene expression has been extensively studied due to its captivating nature. It is influenced by various factors, with androgens, progesterone, glucocorticosteroids, prolactin, and growth hormone enhancing its expression while estrogens suppress it. The regulatory mechanisms involve important proteins such as STAT5A, STAT5B, Runx2, and androgen receptor, which collaborate to enhance PIP gene transcription and protein production. The expression level of PIP in breast cancer is dependent on the tumor stage and subtype. Higher expression is observed in early-stage tumors of the luminal A subtype, while lower expression is associated with luminal B, basal-like, and triple-negative subtypes, which have a poorer prognosis. PIP expression is also correlated with apocrine differentiation, hormone receptor positivity, and longer metastasis-free survival. PIP plays a role in supporting the immune system’s antitumor response during the early stages of breast cancer development. However, as cancer progresses, the protective role of PIP may become less effective or diminished. In this work, we summarized the clinical significance of the PIP molecule in breast cancer and its potential role as a new candidate for cell-based therapies. Full article

Pigeon is an important economic poultry species in many countries. As an altricial bird, its growth and development are largely reliant on pigeon milk produced by the crop tissue in the first week. During the breeding cycle, pigeons undergo a series of behavioral changes. Pigeon milk is generally characterized by having high concentrations of proteins and lipids, and a complicated regulatory network is involved in the milk formation. Hormones, especially prolactin, could promote the proliferation of crop epidermal cells and nutrient accumulation. The expression of target genes associated with these important biological processes in the crop epidermis is affected by non-coding RNAs. Meanwhile, signaling pathways, such as target of rapamycin (TOR), Janus kinase/signal transducer and activator of transcription proteins (JAK/STAT), protein kinase B (Akt), etc., influence the production of crop milk by either enhancing protein synthesis in crop cells or inducing apoptosis of crop epidermal cells. In order to adapt to the different breeding periods, pigeons are physiologically changed in their intestinal morphology and function and liver metabolism. This paper reviews the behaviors and physiological adaptations of pigeon during the breeding cycle, the composition of pigeon crop milk, and the mechanism of its formation, which is important for a better understanding of the physiology of altricial birds and the development of artificial crop milk. Full article

Progestin-only long-acting reversible-contraceptive (pLARC)-exposed endometria displays decidualized human endometrial stromal cells (HESCs) and hyperdilated thin-walled fragile microvessels. The combination of fragile microvessels and enhanced tissue factor levels in decidualized HESCs generates excess thrombin, which contributes to abnormal uterine bleeding (AUB) by inducing inflammation, aberrant angiogenesis, and proteolysis. The- zinc finger and BTB domain containing 16 (ZBTB16) has been reported as an essential regulator of decidualization. Microarray studies have demonstrated that ZBTB16 levels are induced by medroxyprogesterone acetate (MPA) and etonogestrel (ETO) in cultured HESCs. We hypothesized that pLARC-induced ZBTB16 expression contributes to HESC decidualization, whereas prolonged enhancement of ZBTB16 levels triggers an inflammatory milieu by inducing pro-inflammatory gene expression and tissue-factor-mediated thrombin generation in decidualized HESCs. Thus, ZBTB16 immunostaining was performed in paired endometria from pre- and post-depo-MPA (DMPA)-administrated women and oophorectomized guinea pigs exposed to the vehicle, estradiol (E₂), MPA, or E₂ + MPA. The effect of progestins including MPA, ETO, and levonorgestrel (LNG) and estradiol + MPA + cyclic-AMP (E₂ + MPA + cAMP) on ZBTB16 levels were measured in HESC cultures by qPCR and immunoblotting. The regulation of ZBTB16 levels by MPA was evaluated in glucocorticoid-receptor-silenced HESC cultures. ZBTB16 was overexpressed in cultured HESCs for 72 h followed by a ± 1 IU/mL thrombin treatment for 6 h. DMPA administration in women and MPA treatment in guinea pigs enhanced ZBTB16 immunostaining in endometrial stromal and glandular epithelial cells. The in vitro findings indicated that: (1) ZBTB16 levels were significantly elevated by all progestin treatments; (2) MPA exerted the greatest effect on ZBTB16 levels; (3) MPA-induced ZBTB16 expression was inhibited in glucocorticoid-receptor-silenced HESCs. Moreover, ZBTB16 overexpression in HESCs significantly enhanced prolactin (PRL), insulin-like growth factor binding protein 1 (IGFBP1), and tissue factor (F3) levels. Thrombin-induced interleukin 8 (IL-8) and prostaglandin-endoperoxide synthase 2 (PTGS2) mRNA levels in control-vector-transfected HESCs were further increased by ZBTB16 overexpression. In conclusion, these results supported that ZBTB16 is enhanced during decidualization, and long-term induction of ZBTB16 expression by pLARCs contributes to thrombin generation through enhancing tissue factor expression and inflammation by enhancing IL-8 and PTGS2 levels in decidualized HESCs. Full article