Search Results (25)

Microcystin-leucine arginine (MC-LR) is a prominent water pollutant known for its potent hepatic toxicity. However, the effects of subchronic exposure to environmentally relevant concentrations of MC-LR on the fish liver remain poorly understood. This study aimed to systematically evaluate the impact of subchronic MC-LR exposure on the liver of darkbarbel catfish (Tachysurus vachelli). A total of 270 one-year-old fish were exposed to MC-LR (0, 2, and 5 μg/L) for 28 days and sampled on days 14 (D14) and 28 (D28). Histopathological analysis revealed marked hepatic inflammation in the MC-LR treatment groups, manifested as cellular degeneration, hyperemia, and inflammation. MC-LR exposure induced oxidative stress, evidenced by elevated malondialdehyde (MDA) levels and compensatory upregulation of superoxide dismutase (SOD) activity on D28. While hepatic lipid profiles were not altered by low-dose MC-LR, significant elevation of low-density lipoprotein cholesterol (LDL-C) specifically on D28 indicated incipient lipid metabolic disorder. Metabolomic analysis demonstrated a higher sensitivity, highlighting the stress response of the liver to low-dose MC-LR exposure. The results suggest MC-LR exposure disrupted hepatic phosphatidylcholine (PC) biosynthesis and inhibited lipoprotein formation, thereby impairing lipid transport and contributing to lipid metabolic disorders. In summary, subchronic exposure to environmentally relevant concentrations of MC-LR-induced hepatic tissue inflammation, oxidative stress, and lipid metabolic disorders in darkbarbel catfish. Full article

Microcystin-leucine arginine (MC-LR) poses a serious threat to aquatic animals during cyanobacterial blooms. Recently, biochar (BC), derived from rice straw, has emerged as a potent adsorbent for eliminating hazardous contaminants from water. To assess the joint hepatotoxic effects of environmentally relevant concentrations of MC-LR and BC on fish, male adult zebrafish (Danio rerio) were sub-chronically co-exposed to varying concentrations of MC-LR (0, 1, 5, and 25 μg/L) and BC (0 and 100 μg/L) in a fully factorial experiment. After 30 days exposure, our findings suggested that the existence of BC significantly decreased MC-LR bioavailability in liver. Furthermore, histopathological analysis revealed that BC mitigated MC-LR-induced hepatic lesions, which were characterized by mild damage, such as vacuolization, pyknotic nuclei, and swollen mitochondria. Compared to the groups exposed solely to MC-LR, decreased malondialdehyde (MDA) and increased catalase (CAT) and superoxide dismutase (SOD) were noticed in the mixture groups. Concurrently, significant changes in the mRNA expression levels of Nrf2 pathway genes (cat, sod1, gstr, keap1a, nrf2a, and gclc) further proved that BC reduces the oxidative damage induced by MC-LR. These findings demonstrate that BC decreases MC-LR bioavailability in the liver, thereby alleviating MC-LR-induced hepatotoxicity through the Nrf2 signaling pathway in zebrafish. Our results also imply that BC could serve as a potentially environmentally friendly material for mitigating the detrimental effects of MC-LR on fish. Full article

Antibiotics can affect the photosynthetic system of Microcystis, potentially altering the balance of carbon and nitrogen, which may influence the synthesis of different microcystin (MC) congeners. However, the regulatory mechanisms by which antibiotics affect the synthesis of various MC congeners in Microcystis remain unknown. In this study, the effects of ciprofloxacin (CIP) on the growth, carbon and nitrogen balance, amino acid composition, mcyB gene expression, and production of different MC congeners were investigated in two toxin-producing strains of Microcystis aeruginosa. The results show that CIP exposure significantly inhibited the growth of both strains, achieving an inhibition rate of 71.75% in FACHB-315 and 41.13% in FACHB-915 at 8 μg/L CIP by the end of the cultivation. The intracellular C:N ratio in FACHB-315 increased by 51.47%, while no significant change was observed in FACHB-915. The levels of leucine, tyrosine, and arginine, as identified and quantified by UPLC-MS/MS, were significantly altered at higher CIP concentrations, leading to a reduction in leucine percentage and a notable increase in tyrosine in both strains, which contributed to a reduction in MC-LR proportion and an increase in MC-RR and MC-YR proportion. Additionally, the expression of the mcyB gene was upregulated by as much as 5.57 times, indicating that antibiotic stress could enhance MC synthesis at the genetic level, contributing to the increased toxicity of cyanobacteria. These findings emphasize the significant role of CIP in the biochemical processes of M. aeruginosa, particularly in MC synthesis and composition, providing valuable insights into the ecological risks posed by antibiotics and harmful cyanobacteria. Full article

Cyanobacteria bloom is the term used to describe an abnormal and rapid growth of cyanobacteria in aquatic ecosystems such as lakes, rivers, and oceans as a consequence of anthropic factors, ecosystem degradation, or climate change. Cyanobacteria belonging to the genera Microcystis, Anabaena, Planktothrix, and Nostoc produce and release toxins called microcystins (MCs) into the water. MCs can have severe effects on human and animal health following their ingestion and inhalation. The MC structure is composed of a constant region (composed of five amino acid residues) and a variable region (composed of two amino acid residues). When the MC variable region is composed of arginine and leucine, it is named MC-LR. The most-common methods used to detect the presence of MC-LR in water are chromatographic-based methods (HPLC, LC/MS, GC/MS) and immunological-based methods (ELISA). In this work, we developed a new competitive Förster resonance energy transfer (FRET) assay to detect the presence of traces of MC-LR in water. Monoclonal antibody anti-MC-LR and MC-LR conjugated with bovine serum albumin (BSA) were labeled with the near-infrared fluorophores CF568 and CF647, respectively. Steady-state fluorescence measurements were performed to investigate the energy transfer process between anti-MC-LR 568 and MC-LR BSA 647 upon their interaction. Since the presence of unlabeled MC-LR competes with the labeled one, a lower efficiency of FRET process can be observed in the presence of an increasing amount of unlabeled MC-LR. The limit of detection (LoD) of the FRET assay is found to be 0.245 nM (0.245 µg/L). This value is lower than the provisional limit established by the World Health Organization (WHO) for quantifying the presence of MC-LR in drinking water. Full article

Microcystin-leucine arginine (MCLR) is one of the most common and toxic microcystin variants, a class of cyanotoxins produced by cyanobacteria. A major molecular mechanism for MCLR-elicited liver toxicity involves the dysregulation of protein phosphorylation through protein phosphatase (PP) inhibition and mitogen-activated protein kinase (MAPK) modulation. In this study, specific pharmacological MAPK inhibitors were used in HepaRG cells to examine the pathways associated with MCLR cytotoxicity. SB203580 (SB), a p38 inhibitor, rescued HepaRG cell viability, whereas treatment with SP600125 (JNK inhibitor), MK2206 (AKT inhibitor), or N-acetylcysteine (reactive oxygen species scavenger) did not. Phosphoproteomic analysis revealed that phosphosites—which were altered by the addition of SB compared to MCLR treatment alone—included proteins involved in RNA processing, cytoskeletal stability, DNA damage response, protein degradation, and cell death. A closer analysis of specific proteins in some of these pathways indicated that SB reversed the MCLR-mediated phosphorylation of the necroptosis-associated proteins, the mixed lineage kinase domain-like protein (MLKL), receptor-interacting serine/threonine kinase 1 (RIP1), DNA damage response proteins, ataxia telangiectasia and Rad3-related kinase (ATR), and checkpoint kinase 1 (CHK1). Overall, these data implicate p38/MK2, DNA damage, and necroptosis in MCLR-mediated hepatotoxicity, and suggest these pathways may be targets for prevention prior to, or treatment after, MCLR toxicity. Full article

In recent years, the consumption of blue-green algae (BGA) dietary supplements is increasing because of their health benefits. However, cyanobacteria can produce cyanotoxins, which present serious health risks. In this work we propose hydrophilic interaction liquid chromatography coupled with tandem mass spectrometry (HILIC-MS/MS) to determine cyanotoxins in BGA dietary supplements. Target toxins, including microcystin-leucine-arginine (MC-LR) and microcystin-arginine-arginine (MC-RR), nodularin, anatoxin-a and three non-protein amino acids, β-N-methylamino-L-alanine (BMAA), 2,4-diaminobutyric acid (DAB) and N-(2-aminoethyl)glycine (AEG), were separated using a SeQuant ZIC-HILIC column. Cyanotoxin extraction was based on solid–liquid extraction (SLE) followed by a tandem-solid phase extraction (SPE) procedure using Strata-X and mixed-mode cation-exchange (MCX) cartridges. The method was validated for BGA dietary supplements obtaining quantification limits from 60 to 300 µg·kg⁻¹. Nine different commercial supplements were analyzed, and DAB, AEG, and MCs were found in some samples, highlighting the relevance of monitoring these substances as precaution measures for the safe consumption of these products. Full article

Sphingopyxis sp. YF1 has proven to be efficient in biodegrading microcystin (MC)-leucine (L) and arginine (R) (MC-LR); however, the optimal environmental factors to biodegrade the toxin have not been investigated. In this study, the biodegrading characteristics of strain YF1 against MC-LR were assessed under diverse environmental factors, including temperature (20, 30 or 40 °C), pH (5, 7 or 9) and MC-LR concentration (1, 3 or 5 µg/mL). Data obtained from the single-factor experiment indicated that MC-LR biodegradation by strain YF1 was temperature-, pH- and MC-LR-concentration-dependent, and the maximal biodegradation rate occurred at 5 µg/mL/h. Proposing Box-Behnken Design in response surface methodology, the influence of the three environmental factors on the biodegradation efficiency of MC-LR using strain YF1 was determined. A 17-run experiment was generated and carried out, including five replications performed at the center point. The ANOVA analysis demonstrated that the model was significant, and the model prediction of MC-LR biodegradation was also validated with the experimental data. The quadratic statistical model was established to predict the interactive effects of the environmental factors on MC-LR biodegradation efficiency and to optimize the controlling parameters. The optimal conditions for MC-LR biodegradation were observed at 30 °C, pH 7 and 3 µg/mL MC-LR, with a biodegradation efficiency of 100% after 60 min. The determination of the optimal environmental factors will help to unveil the detailed biodegradation mechanism of MC-LR by strain YF1 and to apply it into the practice of eliminating MC-LR from the environment. Full article

Microcystins are ubiquitous toxins produced by photoautotrophic cyanobacteria. Human exposures to microcystins occur through the consumption of contaminated drinking water, fish and shellfish, vegetables, and algal dietary supplements and through recreational activities. Microcystin-leucine-arginine (MCLR) is the prototypical microcystin because it is reported to be the most common and toxic variant and is the only microcystin with an established tolerable daily intake of 0.04 µg/kg. Microcystin toxicokinetics is characterized by low intestinal absorption, rapid and specific distribution to the liver, moderate metabolism to glutathione and cysteinyl conjugates, and low urinary and fecal excretion. Molecular toxicology involves covalent binding to and inhibition of protein phosphatases, oxidative stress, cell death (autophagy, apoptosis, necrosis), and cytoskeleton disruption. These molecular and cellular effects are interconnected and are commonly observed together. The main target organs for microcystin toxicity are the intestine, liver, and kidney. Preclinical data indicate microcystins may also have nervous, pulmonary, cardiac, and reproductive system toxicities. Recent evidence suggests that exposure to other hepatotoxic insults could potentiate microcystin toxicity and increase the risk for chronic diseases. This review summarizes the current knowledge for microcystin toxicokinetics, molecular toxicology, and pathophysiology in preclinical rodent models and humans. More research is needed to better understand human toxicokinetics and how multifactorial exposures contribute to disease pathogenesis and progression. Full article

Microcystins (MCs) produced in eutrophic waters may decrease crop yield, enter food chains and threaten human and animal health. The main objective of this research was to highlight the role of rhizospheric soil microbiota to protect faba bean plants from MCs toxicity after chronic exposure. Faba bean seedlings were grown in pots containing agricultural soil, during 1 month under natural environmental conditions of Marrakech city in Morocco (March–April 2018) and exposed to cyanobacterial extracts containing up to 2.5 mg·L⁻¹ of total MCs. Three independent exposure experiments were performed (a) agricultural soil was maintained intact “exposure experiment 1”; (b) agricultural soil was sterilized “exposure experiment 2”; (c) agricultural soil was sterilized and inoculated with the rhizobia strain Rhizobium leguminosarum RhOF34 “exposure experiment 3”. Overall, data showed evidence of an increased sensitivity of faba bean plants, grown in sterilized soil, to MCs in comparison to those grown in intact and inoculated soils. The study revealed the growth inhibition of plant shoots in both exposure experiments 2 and 3 when treated with 2.5 mg·L⁻¹ of MCs. The results also showed that the estimated daily intake (EDI) of MCs, in sterilized soil, exceeded 2.18 and 1.16 times the reference concentrations (0.04 and 0.45 µg of microcysin-leucine arginine (MC-LR). Kg⁻¹ DW) established for humans and cattle respectively, which raises concerns about human food chain contamination. Full article

This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH₂)₆GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag⁰) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA–PVS–Ag⁰) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA–PVS–Ag⁰ nanocomposites were polydispersed and contained embedded Ag⁰. Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01–0.1 ng L⁻¹ MC-LR and 0.003 ng L⁻¹ MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses excellent selectivity for MC-LR. Full article

The inhibition of cyanobacteria growth by allelochemicals, which controls harmful algal blooms has been examined in many studies. The objective of this work was to compare the efficiencies of different allelochemicals and determine a mixing proportion corresponding to the highest algae inhibiting activity and smallest adverse effect. The obtained results demonstrated that artemisinin, nonanoic acid, malonic acid, and ethyl acetate inhibited algal growth more efficiently than D-menthol and lactic acid. Synergies were observed in five groups of allelochemical combinations with inhibition ratios exceeding 80%, and the concentrations of extracellular microcystin-LR in the groups with high algal inhibition ratios were lower than that in the control group on the 7th day. No changes in extracellular polymeric substances compositions were detected after treatment. The permanganate indices of the treated groups were higher than that of the control group; however, this disparity gradually decreased with time. In addition, a sharp decrease in the concentration of dissolved inorganic phosphorus was observed for all treated groups. From the obtained data, the optimal proportion of mixed allelochemicals corresponding to 3.94 mg L⁻¹ of artemisinin, 6.27 mg L⁻¹ of nonanoic acid, 8.2 mg L⁻¹ of malonic acid, and 6.38 mg L⁻¹ of ethyl acetate was suggested. Full article

Inflammatory Bowel Disease (IBD) is one of the most common gastrointestinal (GI) disorders around the world, and includes diagnoses such as Crohn’s disease and ulcerative colitis. The etiology of IBD is influenced by genetic and environmental factors. One environmental perturbagen that is not well studied within the intestines is microcystin-leucine arginine (MC-LR), which is a toxin produced by cyanobacteria in freshwater environments around the world. We recently reported that MC-LR has limited effects within the intestines of healthy mice, yet interestingly has significant toxicity within the intestines of mice with pre-existing colitis induced by dextran sulfate sodium (DSS). MC-LR was found to prolong DSS-induced weight loss, prolong DSS-induced bloody stools, exacerbate DSS-induced colonic shortening, exacerbate DSS-induced colonic ulceration, and exacerbate DSS-induced inflammatory cytokine upregulation. In addition, we previously reported a significant increase in expression of the pro-inflammatory receptor CD40 in the colons of these mice, along with downstream products of CD40 activation, including plasminogen activator inhibitor-1 (PAI-1) and monocyte chemoattractant protein-1 (MCP-1). In the current study, we demonstrate that knocking out CD40 attenuates the effects of MC-LR in mice with pre-existing colitis by decreasing the severity of weight loss, allowing a full recovery in bloody stools, preventing the exacerbation of colonic shortening, preventing the exacerbation of colonic ulceration, and preventing the upregulation of the pro-inflammatory and pro-fibrotic cytokines IL-1β, MCP-1, and PAI-1. We also demonstrate the promising efficacy of a CD40 receptor blocking peptide to ameliorate the effects of MC-LR exposure in a proof-of-concept study. Our findings suggest for the first time that MC-LR acts through a CD40-dependent mechanism to exacerbate colitis. Full article

The increasing cyanobacterial blooms have recently been considered a severe environmental problem. Microcystin-leucine arginine (MC-LR) is one of the secondary products of cyanobacteria metabolism and most harmful cyanotoxins found in water bodies. Studies show MC-LR negatively affects various human organs when exposed to it. The phenotype of the jejunal chronic toxicity induced by MC-LR has not been well described. The aim of this paper was to investigate the effects of MC-LR on the jejunal microstructure and expression level of inflammatory-related factors in jejunum. Mice were treated with different doses (1, 30, 60, 90 and 120 μg/L) of MC-LR for six months. The microstructure and mRNA expression levels of inflammation-related factors in jejunum were analyzed. Results showed that the microstructure of the jejunum was destroyed and expression levels of inflammation-related factors interleukin (IL)-1β, interleukin (IL)-8, tumor necrosis factor alpha, transforming growth factor-β1 and interleukin (IL)-10 were altered at different MC-LR concentrations. To the best of our knowledge, this is the first study that mice were exposed to a high dose of MC-LR for six months. Our data demonstrated MC-LR had the potential to cause intestinal toxicity by destroying the microstructure of the jejunum and inducing an inflammatory response in mice, which provided new insight into understanding the prevention and diagnosis of the intestinal diseases caused by MC-LR. Full article

Inflammatory Bowel Disease (IBD) represents a collection of gastrointestinal disorders resulting from genetic and environmental factors. Microcystin-leucine arginine (MC-LR) is a toxin produced by cyanobacteria during algal blooms and demonstrates bioaccumulation in the intestinal tract following ingestion. Little is known about the impact of MC-LR ingestion in individuals with IBD. In this study, we sought to investigate MC-LR’s effects in a dextran sulfate sodium (DSS)-induced colitis model. Mice were separated into four groups: (a) water only (control), (b) DSS followed by water (DSS), (c) water followed by MC-LR (MC-LR), and (d) DSS followed by MC-LR (DSS + MC-LR). DSS resulted in weight loss, splenomegaly, and severe colitis marked by transmural acute inflammation, ulceration, shortened colon length, and bloody stools. DSS + MC-LR mice experienced prolonged weight loss and bloody stools, increased ulceration of colonic mucosa, and shorter colon length as compared with DSS mice. DSS + MC-LR also resulted in greater increases in pro-inflammatory transcripts within colonic tissue (TNF-α, IL-1β, CD40, MCP-1) and the pro-fibrotic marker, PAI-1, as compared to DSS-only ingestion. These findings demonstrate that MC-LR exposure not only prolongs, but also worsens the severity of pre-existing colitis, strengthening evidence of MC-LR as an under-recognized environmental toxin in vulnerable populations, such as those with IBD. Full article

Hazardous contaminants, such as nitrite and microcystin-leucine arginine (MC-LR), are released into water bodies during cyanobacterial blooms and may adversely influence the normal physiological function of hydrobiontes. The combined effects of nitrite and MC-LR on the antioxidant defense and innate immunity were evaluated through an orthogonal experimental design (nitrite: 0, 29, 290 μM; MC-LR: 0, 3, 30 nM). Remarkable increases in malondialdehyde (MDA) levels have suggested that nitrite and/or MC-LR exposures induce oxidative stress in fish spleen, which were indirectly confirmed by significant downregulations of total antioxidant capacity (T-AOC), glutathione (GSH) contents, as well as transcriptional levels of antioxidant enzyme genes cat1, sod1 and gpx1a. Simultaneously, nitrite and MC-LR significantly decreased serum complement C3 levels as well as the transcriptional levels of splenic c3b, lyz, il1β, ifnγ and tnfα, and indicated that they could jointly impact the innate immunity of fish. The severity and extent of splenic lesions were aggravated by increased concentration of nitrite or MC-LR and became more serious in combined groups. The damages of mitochondria and pseudopodia in splenic macrophages suggest that oxidative stress exerted by nitrite and MC-LR aimed at the membrane structure of immune cells and ultimately disrupted immune function. Our results clearly demonstrate that nitrite and MC-LR exert synergistic suppressive effects on fish innate immunity via interfering antioxidant responses, and their joint toxicity should not be underestimated in eutrophic lakes. Full article