Relationship between Arachidonate 5-Lipoxygenase-Activating Protein Gene and Peripheral Arterial Disease in Elderly Patients Undergoing General Surgery: A Retrospective Observational Study
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Population and Data Collection
2.2. Ankle-Brachial Index (ABI)
2.3. DNA Isolation and Genotype Analysis
2.4. Hardy–Weinberg Equilibrium
2.5. Genetic Risk Score
2.6. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kehlet, M.; Jensen, L.P.; Schroeder, T.V. Risk factors for complications after peripheral vascular surgery in 3202 patient procedures. Ann. Vasc. Surg. 2016, 36, 13–21. [Google Scholar] [CrossRef]
- Conte, S.M.; Vale, P.R. Peripheral arterial disease. Heart Lung Circ. 2018, 27, 427–432. [Google Scholar] [CrossRef]
- Song, P.; Rudan, D.; Zhu, Y.; Fowkes, F.J.I.; Rahimi, K.; Fowkes, F.G.R.; Rudan, I. Global, regional, and national prevalence and risk factors for peripheral artery disease in 2015: An updated systematic review and analysis. Lancet Glob. Health 2019, 7, e1020–e1030. [Google Scholar] [CrossRef]
- Bhatt, D.L.; Steg, P.G.; Ohman, E.M.; Hirsch, A.T.; Ikeda, Y.; Mas, J.L.; Goto, S.; Liau, C.S.; Richard, A.J.; Röther, J.; et al. International prevalence, recognition, and treatment of cardiovascular risk factors in outpatients with atherothrombosis. JAMA 2006, 295, 180–189. [Google Scholar] [CrossRef]
- Agnelli, G.; Belch, J.J.F.; Baumgartner, I.; Giovas, P.; Hoffmann, U. Morbidity and mortality associated with atherosclerotic peripheral artery disease: A systematic review. Atherosclerosis 2020, 293, 94–100. [Google Scholar] [CrossRef]
- Golomb, B.A.; Dang, T.T.; Criqui, M.H. Peripheral arterial disease: Morbidity and mortality implications. Circulation 2006, 114, 688–699. [Google Scholar] [CrossRef]
- Choi, J.B.; Park, C.H.; Jeon, H.J.; Kim, H.S. The usefulness of ankle-brachial index as a screening test on peripheral artery occlusive disease in patients with low back and leg pain. Korean J. Anesthesiol. 2013, 65, 278–279. [Google Scholar] [CrossRef]
- Aboyans, V.; Criqui, M.H.; Abraham, P.; Allison, M.A.; Creager, M.A.; Diehm, C.; Fowkes, F.G.; Hiatt, W.R.; Jönsson, B.; Lacroix, P.; et al. Measurement and interpretation of the ankle-brachial index: A scientific statement from the American Heart Association. Circulation 2012, 126, 2890–2909. [Google Scholar] [CrossRef]
- Visonà, A.; De Paoli, A.; Fedeli, U.; Tonello, D.; Zalunardo, B.; Zanatta, N.; Martini, R.; Pesavento, R.; Cuppini, S.; Prior, M.; et al. Abnormal ankle-brachial index (ABI) predicts primary and secondary cardiovascular risk and cancer mortality. Eur. J. Intern. Med. 2020, 77, 79–85. [Google Scholar] [CrossRef]
- Häfner, A.K.; Gerstmeier, J.; Hörnig, M.; George, S.; Ball, A.K.; Schröder, M.; Garscha, U.; Werz, O.; Steinhilber, D. Characterization of the interaction of human 5-lipoxygenase with its activating protein FLAP. Biochim. Biophys. Acta 2015, 1851, 1465–1472. [Google Scholar] [CrossRef]
- Mashima, R.; Okuyama, T. The role of lipoxygenases in pathophysiology; new insights and future perspectives. Redox Biol. 2015, 6, 297–310. [Google Scholar] [CrossRef]
- Peters-Golden, M.; Brock, T.G. 5-Lipoxygenase and FLAP. Prostaglandins Leukot. Essent. Fat. Acids 2003, 69, 99–109. [Google Scholar] [CrossRef]
- Bäck, M. Leukotriene signaling in atherosclerosis and ischemia. Cardiovasc. Drugs Ther. 2009, 23, 41–48. [Google Scholar] [CrossRef]
- Jin, X.; He, Y.; Zhu, M.; Lin, X.; Chen, Q.; Han, Z.; Huang, X.; Wang, F. The relationship between the polymorphism of SG13S114 A/T in ALOX5AP gene and the vulnerability of carotid atherosclerosis in Chinese Han population. Int. J. Clin. Exp. Med. 2010, 3, 28–32. [Google Scholar]
- Huang, H.; Zeng, Z.; Li, J.; Zhang, L.; Chen, Y. Variants of arachidonate 5-lipoxygenase-activating protein (ALOX5AP) gene and risk of coronary heart disease: A meta-analysis. Arch. Med. Res. 2010, 41, 634–641. [Google Scholar] [CrossRef]
- Tsai, A.K.; Li, N.; Hanson, N.Q.; Tsai, M.Y.; Tang, W. Associations of genetic polymorphisms of arachidonate 5-lipoxygenase-activating protein with risk of coronary artery disease in a European-American population. Atherosclerosis 2009, 207, 487–491. [Google Scholar] [CrossRef]
- Li, K.L.; Chen, C.Y.; Xu, M.; Zhu, X.Q.; Yang, X.J. ALOX5AP rs10507391 polymorphism and the risk of ischemic stroke in Caucasians: An update meta-analysis. Cell. Mol. Biol. 2017, 63, 137–140. [Google Scholar] [CrossRef]
- Ye, H.; Zhang, X.; Chen, Z.; Li, X.; Zhang, T.; Yang, C.; Huang, L. Association between the polymorphism (rs17222919, −1316T/G) of 5-lipoxygenase-activating protein gene (ALOX5AP) and the risk of stroke: A meta analysis. Medicine 2018, 97, e12682. [Google Scholar] [CrossRef]
- Jin, T.; Youn, J.; Kim, A.N.; Kang, M.; Kim, K.; Sung, J.; Lee, J.E. Interactions of habitual coffee consumption by genetic polymorphisms with the risk of prediabetes and Type 2 diabetes combined. Nutrients 2020, 12, 2228. [Google Scholar] [CrossRef]
- Na, R.; Labbate, C.; Yu, H.; Shi, Z.; Fantus, R.J.; Wang, C.H.; Andriole, G.L.; Isaacs, W.B.; Zheng, S.L.; Helfand, B.T.; et al. Single-nucleotide polymorphism–based genetic risk score and patient age at prostate cancer diagnosis. JAMA Netw. Open. 2019, 2, e1918145. [Google Scholar] [CrossRef]
- Criqui, M.H.; Aboyans, V. Epidemiology of peripheral artery disease. Circ. Res. 2015, 116, 1509–1526. [Google Scholar] [CrossRef] [PubMed]
- Leibson, C.L.; Ransom, J.E.; Olson, W.; Zimmerman, B.R.; O’Fallon, W.M.; Palumbo, P.J. Peripheral arterial disease, diabetes, and mortality. Diabetes Care 2004, 27, 2843–2849. [Google Scholar] [CrossRef] [PubMed]
- Yokomizo, T.; Nakamura, M.; Shimizu, T. Leukotriene receptors as potential therapeutic targets. J. Clin. Investig. 2018, 128, 2691–2701. [Google Scholar] [CrossRef]
- Yao, Q.; Zhang, C.; Zhang, X.; Yuan, R.; Li, J.; Sun, F.; Zhou, C. Synergistic effect of ALOX5AP polymorphisms and cigarette smoking on the risk of atherosclerotic cerebral infarction in a Northern Han Chinese population. J. Clin. Neurosci. 2014, 21, 975–979. [Google Scholar] [CrossRef]
- Shao, M.; Yi, X.; Chi, L.; Lin, J.; Zhou, Q.; Huang, R. Ischemic stroke risk in a southeastern Chinese population: Insights from 5-lipoxygenase activating protein and phosphodiesterase 4-D single-nucleotide polymorphisms. J. Formos. Med. Assoc. 2015, 114, 422–429. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Gammelmark, A.; Nielsen, M.S.; Lundbye-Christensen, S.; Tjønneland, A.; Schmidt, E.B.; Overvad, K. Common polymorphisms in the 5-lipoxygenase pathway and risk of incident myocardial infarction: A Danish case-cohort study. PLoS ONE 2016, 11, e0167217. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Chen, Z.; Zheng, J.; Liu, W.; Yang, K.; Li, K.; Huang, B.; Zhu, R.; Lu, X.; Li, L. The SG13S114 polymorphism of the ALOX5AP gene is associated with ischemic stroke in Europeans: A meta-analysis of 8062 subjects. Neurol. Sci. 2017, 38, 579–587. [Google Scholar] [CrossRef]
- Wang, G.; Liu, R.; Zhang, J. The arachidonate 5-lipoxygenase-activating protein (ALOX5AP) gene SG13S114 polymorphism and ischemic stroke in Chinese population: A meta-analysis. Gene 2014, 533, 461–468. [Google Scholar] [CrossRef]
- Foley, T.R.; Armstrong, E.J.; Waldo, S.W. Contemporary evaluation and management of lower extremity peripheral artery disease. Heart 2016, 102, 1436–1441. [Google Scholar] [CrossRef]
- Herraiz-Adillo, Á.; Cavero-Redondo, I.; Álvarez-Bueno, C.; Pozuelo-Carrascosa, D.P.; Solera-Martínez, M. The accuracy of toe brachial index and ankle brachial index in the diagnosis of lower limb peripheral arterial disease: A systematic review and meta-analysis. Atherosclerosis 2020, 315, 81–92. [Google Scholar] [CrossRef]
- Gerhard-Herman, M.D.; Gornik, H.L.; Barrett, C.; Barshes, N.R.; Corriere, M.A.; Drachman, D.E.; Fleisher, L.A.; Fowkes, F.G.R.; Hamburg, N.M.; Kinlay, S.; et al. 2016 AHA/ACC guideline on the management of patients with lower extremity peripheral artery disease: A report of the American College of Cardiology/American Heart Association Task Force on Clinical Practice guidelines. J. Am. Coll. Cardiol. 2017, 69, e71–e126. [Google Scholar] [CrossRef] [PubMed]
SNP | Design Strand | Context Sequence |
---|---|---|
rs17216473 | Forward | TGACCTCAGGTGATCTGCCTGCCTC[A/G] GCCTCCCACAGTTTTGTGATTATAG |
rs10507391 | Forward | AATAACTGTATCACTGGTGCGGGCT[A/G] TAGACATCAGCTGGGAATGAAGGTG |
rs4769874 | Forward | CCGTTGCGTTCTGCTCCGTCGGCCC[C/G] GAGCTGCATGGCCAACTCCCAGCAG |
rs9551963 | Forward | CTCACCCCGCCGCCGCCGCCGTCCC[C/G] GAGCTCCGCACAGTGTGCCCCAGCC |
rs17222814 | Forward | CTAGTCTCTTTCCCCAGCCACTGTT[A/G] CCCAGTGGGCTTACATATATCATGG |
rs17222842 | Forward | AGTTTTCCTGGGATGTGGTCCTTTC[A/G] GTTTTTTAAAAATTATTTTTATTGA |
Overall (n = 129) | |
---|---|
Age | 71.25 ± 7.15 |
Height (cm) | 166.03 ± 9.25 |
Body weight (kg) | 65.9 (60.2–70.7) |
Body mass index (kg/m2) | 23.94 ± 7.15 |
Comorbidities | |
Hypertension | 92 (71.32) |
Diabetes mellitus | 52 (40.31) |
Cardiovascular disease | 43 (33.33) |
Respiratory disease | 17 (13.18) |
Chronic kidney disease | 13 (10.08) |
Cerebrovascular disease | 20 (15.50) |
Others | 6 (4.65) |
Prevalence of PAD | 85 (65.89) |
SNP | Genotype | Frequency | Allele | Frequency | p-Value of Hardy–Weinberg Equilibrium |
---|---|---|---|---|---|
rs17216473 | A/A | 5 (3.9) | A | 55 (21.3) | 0.651 |
A/G | 45 (34.9) | G | 203 (78.7) | ||
G/G | 79 (61.2) | ||||
rs10507391 | A/A | 23 (17.8) | A | 111 (43.0) | 0.753 |
A/T | 65 (50.4) | T | 147 (57.0) | ||
T/T | 41 (31.8) | ||||
rs4769874 | A/G | 7 (5.4) | A | 7 (2.7) | 0.751 |
G/G | 122 (94.6) | G | 251 (97.3) | ||
rs9551963 | A/A | 71 (55.0) | A | 186 (72.1) | 0.084 |
A/C | 44 (34.1) | C | 72 (27.9) | ||
C/C | 14 (10.9) | ||||
rs17222814 | A/G | 1 (0.8) | A | 1 (0.4) | 0.965 |
G/G | 128 (99.2) | G | 257 (99.6) | ||
rs17222842 | G/G | 129 (100) | G | 258 (100.0) | - |
SNP | Genotype | Prevalence | p-Value |
---|---|---|---|
rs17216473 | A/A | 1 (20.0) | 0.111 |
A/G | 31 (68.9) | ||
G/G | 53 (67.1) | ||
rs10507391 | A/A | 13 (56.5) | 0.578 |
A/T | 44 (67.7) | ||
T/T | 28 (68.3) | ||
rs4769874 | A/G | 6 (85.7) | 0.421 |
G/G | 79 (64.8) | ||
rs9551963 | A/A | 41 (57.7) | 0.026 |
A/C | 31 (70.5) | ||
C/C | 13 (92.9) |
Genetic Risk Score | Prevalence | p-Value |
---|---|---|
0 | 1 (25.0) | 0.005 |
1 | 3 (33.3) | |
2 | 43 (65.2) | |
3 | 35 (76.1) | |
4 | 3 (75.0) |
Univariate Analysis | ||
---|---|---|
Variables | OR (95% CI) | p-Value |
Genetic risk score | 2.024 (1.234, 3.4940) | 0.007 |
Age | 1.086 (1.029, 1.151) | 0.004 |
Body mass index | 0.873 (0.762, 0.992) | 0.042 |
Hypertension | 1.258 (0.560, 2.771) | 0.571 |
Diabetes mellitus | 2.796 (1.280, 6.461) | 0.012 |
Cardiovascular disease | 0.950 (0.442, 2.080) | 0.896 |
Respiratory disease | 0.533 (0.188, 1.527) | 0.232 |
Chronic kidney disease | 1.184 (0.361, 4.589) | 0.789 |
Cerebrovascular disease | 0.578 (0.219, 1.554) | 0.267 |
Multivariate Analysis * | ||
Variables | OR (95% CI) | p-Value |
Genetic risk score | 2.153 (1.241, 3.952) | 0.009 |
Age | 1.088 (1.025, 1.160) | 0.007 |
Body mass index | 0.924 (0.797, 1.064) | 0.280 |
Diabetes mellitus | 2.170 (0.929, 5.289) | 0.079 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jin, S.; Choi, E.-J.; Choi, Y.J.; Min, W.K.; Park, J.Y.; Yoon, S.Z. Relationship between Arachidonate 5-Lipoxygenase-Activating Protein Gene and Peripheral Arterial Disease in Elderly Patients Undergoing General Surgery: A Retrospective Observational Study. Int. J. Environ. Res. Public Health 2023, 20, 1027. https://doi.org/10.3390/ijerph20021027
Jin S, Choi E-J, Choi YJ, Min WK, Park JY, Yoon SZ. Relationship between Arachidonate 5-Lipoxygenase-Activating Protein Gene and Peripheral Arterial Disease in Elderly Patients Undergoing General Surgery: A Retrospective Observational Study. International Journal of Environmental Research and Public Health. 2023; 20(2):1027. https://doi.org/10.3390/ijerph20021027
Chicago/Turabian StyleJin, Sejong, Eun-Ji Choi, Yoon Ji Choi, Won Kee Min, Ju Yeon Park, and Seung Zhoo Yoon. 2023. "Relationship between Arachidonate 5-Lipoxygenase-Activating Protein Gene and Peripheral Arterial Disease in Elderly Patients Undergoing General Surgery: A Retrospective Observational Study" International Journal of Environmental Research and Public Health 20, no. 2: 1027. https://doi.org/10.3390/ijerph20021027
APA StyleJin, S., Choi, E.-J., Choi, Y. J., Min, W. K., Park, J. Y., & Yoon, S. Z. (2023). Relationship between Arachidonate 5-Lipoxygenase-Activating Protein Gene and Peripheral Arterial Disease in Elderly Patients Undergoing General Surgery: A Retrospective Observational Study. International Journal of Environmental Research and Public Health, 20(2), 1027. https://doi.org/10.3390/ijerph20021027