Weighted Gene Co-Expression Network Analysis Uncovers Critical Genes and Pathways Involved in Soybean Response to Soybean Mosaic Virus
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Methods
2.2.1. Plant Cultivation and Sample Collection
2.2.2. Metabolomics Assay
2.2.3. DEGs and Bioinformatics Analysis
2.2.4. Weighted Gene Co-Expression Network Analysis (WGCNA) and Visualization
2.2.5. RT-qPCR Assay
3. Results
3.1. Transcriptome Sequencing Statistics and Biological Repeat Correlation Analysis
3.2. Gene Ontology (GO) Enrichment Analysis of Differentially Expressed Genes (DEGs) in Soybean Leaves Responding to Soybean Mosaic Virus (SMV) Infection
3.3. KEGG Enrichment Analysis of DEGs in Soybean Leaves Responding to SMV Infection
3.4. Analysis of the Differentially Expressed Metabolites (DEMs) in Soybean Leaves Responding to SMV Infection
3.5. KEGG Pathway Enrichment Analysis of the 894 DEGs from WGCNA
3.6. The Cytoscape Network Analysis of the DEGs
3.7. RT-qPCR Validation of the Key DGEs
4. Discussion
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Dangl, J.L.; Horvath, D.M.; Staskawicz, B.J. Pivoting the plant immune system from dissection to deployment. Science 2013, 341, 746–751. [Google Scholar] [CrossRef] [PubMed]
- Dodds, P.N.; Rathjen, J.P. Plant immunity: Towards an integrated view of plant-pathogen interactions. Nat. Rev. Genet. 2010, 11, 539–548. [Google Scholar] [CrossRef] [PubMed]
- Ambrós, S.; Gómez-Muñoz, N.; Giménez-Santamarina, S.; Sánchez-Vicente, J.; Navarro-López, J.; Martínez, F.; Daròs, J.A.; Rodrigo, G. Molecular signatures of silencing suppression degeneracy from a complex RNA virus. PLoS Comput. Biol. 2021, 17, e1009166. [Google Scholar] [CrossRef] [PubMed]
- Whitham, S.A.; Qi, M.; Innes, R.W.; Ma, W.; Lopes-Caitar, V.; Hewezi, T. Molecular Soybean-pathogen interactions. Annu. Rev. Phytopathol. 2016, 54, 443–468. [Google Scholar] [CrossRef]
- Liao, L.; Chen, P.; Buss, G.R.; Yang, Q.; Tolin, S.A. Inheritance and allelism of resistance to soybean mosaic virus in Zao18 soybean from China. J. Hered. 2002, 93, 447–452. [Google Scholar] [CrossRef]
- Quenouille, J.; Montarry, J.; Palloix, A.; Moury, B. Farther, slower, stronger: How the plant genetic background protects a major resistance gene from breakdown. Mol. Plant Pathol. 2013, 14, 109–118. [Google Scholar] [CrossRef]
- Wang, J.; Wu, D.; Wang, Y.; Xie, D. Jasmonate action in plant defense against insects. J. Exp. Bot. 2019, 70, 3391–3400. [Google Scholar] [CrossRef]
- Katsir, L.; Chung, H.S.; Koo, A.J.; Howe, G.A. Jasmonate signaling: A conserved mechanism of hormone sensing. Curr. Opin. Plant Biol. 2008, 11, 428–435. [Google Scholar] [CrossRef]
- Wasternack, C.; Hause, B. Jasmonates: Biosynthesis, perception, signal transduction and action in plant stress response, growth and development. Ann. Bot. 2013, 111, 1021–1058. [Google Scholar] [CrossRef]
- Carvalhais, L.C.; Schenk, P.M.; Dennis, P.G. Jasmonic acid signalling and the plant holobiont. Curr. Opin. Microbiol. 2017, 37, 42–47. [Google Scholar] [CrossRef]
- Wasternack, C.; Song, S. Jasmonates: Biosynthesis, metabolism, and signaling by proteins activating and repressing transcription. J. Exp. Bot. 2017, 68, 1303–1321. [Google Scholar] [CrossRef] [PubMed]
- Acosta, I.F.; Przybyl, M. Jasmonate signaling during arabidopsis stamen maturation. Plant Cell Physiol. 2019, 60, 2648–2659. [Google Scholar] [CrossRef]
- Ruan, J.; Zhou, Y.; Zhou, M.; Yan, J.; Khurshid, M.; Weng, W.; Cheng, J.; Zhang, K. Jasmonic Acid Signaling Pathway in Plants. Int. J. Mol. Sci. 2019, 20, 2479. [Google Scholar] [CrossRef] [PubMed]
- Glauser, G.; Grata, E.; Dubugnon, L.; Rudaz, S.; Farmer, E.E.; Wolfender, J.-L. Spatial and temporal dynamics of jasmonate synthesis and accumulation in Arabidopsis in response to wounding. J. Biol. Chem. 2008, 283, 16400–16407. [Google Scholar] [CrossRef] [PubMed]
- Koo, A.J.; Gao, X.; Jones, A.D.; Howe, G.A. A rapid wound signal activates the systemic synthesis of bioactive jasmonates in Arabidopsis. Plant J. 2009, 59, 974–986. [Google Scholar] [CrossRef]
- Chauvin, A.; Caldelari, D.; Wolfender, J.; Farmer, E.E. Four 13-lipoxygenases contribute to rapid jasmonate synthesis in wounded Arabidopsis thaliana leaves: A role for lipoxygenase 6 in responses to long-distance wound signals. New Phytol. 2013, 197, 566–575. [Google Scholar] [CrossRef]
- Wasternack, C.; Strnad, M. Jasmonates: News on occurrence, biosynthesis, metabolism and action of an ancient group of signaling compounds. Int. J. Mol. Sci. 2018, 19, 2539. [Google Scholar] [CrossRef]
- Ali, M.S.; Baek, K.H. Jasmonic acid signaling pathway in response to abiotic stresses in plants. Int. J. Mol. Sci. 2020, 21, 621. [Google Scholar] [CrossRef]
- Staswick, P.E.; Su, W.; Howell, S.H. Methyl jasmonate inhibition of root growth and induction of a leaf protein are decreased in an Arabidopsis thaliana mutant. Proc. Natl. Acad. Sci. USA 1992, 89, 6837–6840. [Google Scholar] [CrossRef]
- Yang, J.; Duan, G.; Li, C.; Liu, L.; Han, G.; Zhang, Y.; Wang, C. The crosstalks between jasmonic acid and other plant hormone signaling highlight the involvement of jasmonic acid as a core component in plant response to biotic and abiotic stresses. Front. Plant Sci. 2019, 10, 1349. [Google Scholar] [CrossRef]
- Jiang, H.; Zhou, C.; Ma, J.; Qu, S.; Liu, F.; Sun, H.; Zhao, X.; Han, Y. Weighted gene co-expression network analysis identifies genes related to HG Type 0 resistance and verification of hub gene GmHg1. Front. Plant Sci. 2023, 13, 1118503. [Google Scholar] [CrossRef] [PubMed]
- Alkharouf, N.W.; Klink, V.P.; Chouikha, I.B.; Beard, H.S.; MacDonald, M.H.; Meyer, S.; Knap, H.T.; Khan, R.; Matthews, B.F. Timecourse microarray analyses reveal global changes in gene expression of susceptible Glycine max (soybean) roots during infection by Heterodera glycines (soybean cyst nematode). Planta 2006, 224, 838–852. [Google Scholar] [CrossRef] [PubMed]
- Niu, J.; Zhao, J.; Guo, Q.; Zhang, H.; Yue, A.; Zhao, J.; Yin, C.; Wang, M.; Du, W. WGCNA reveals Hub genes and key gene regulatory pathways of the response of soybean to infection by Soybean mosaic virus. Genes 2024, 15, 566. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Shang, J.; Wang, W.; Du, J.; Li, K.; Wu, X.; Yu, L.; Liu, C.; Khaskheli, M.I.; Yang, W. Comparison of transcriptome differences in soybean response to soybean mosaic virus under normal light and in the shade. Viruses 2019, 11, 793. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Q.; Li, H.; Sun, H.; Li, A.; Liu, S.; Yu, R.; Cui, X.; Zhang, D.; Wuriyanghan, H. Salicylic acid and broad spectrum of NBS-LRR family genes are involved in SMV-soybean interactions. Plant Physiol. Biochem. 2017, 123, 132–140. [Google Scholar] [CrossRef]
- Qi, Z.; Zhang, Z.; Wang, Z.; Yu, J.; Qin, H.; Mao, X.; Jiang, H.; Xin, D.; Yin, Z.; Zhu, R.; et al. Meta-analysis and transcriptome profiling reveal hub genes for soybean seed storage composition during seed development. Plant Cell Environ. 2018, 41, 2109–2127. [Google Scholar]
- Aleem, M.; Raza, M.M.; Haider, M.S.; Atif, R.M.; Ali, Z.; Bhat, J.A.; Zhao, T. Comprehensive RNA-seq analysis revealed molecular pathways and genes associated with drought tolerance in wild soybean (Glycine soja Sieb. and Zucc.). Physiol. Plant. 2021, 172, 707–732. [Google Scholar] [CrossRef]
- da Silva, H.A.P.; Caetano, V.S.; Pessôa, D.D.V.; Pacheco, R.S.; Meneses, C.H.S.; Simões-Araújo, J.L. Unraveling the drought-responsive transcriptomes in nodules of two common bean genotypes during biological nitrogen fixation. Front. Plant Sci. 2024, 15, 1345379. [Google Scholar] [CrossRef]
- Zhao, X.; Jing, Y.; Luo, Z.; Gao, S.; Teng, W.; Zhan, Y.; Qiu, L.; Zheng, H.; Li, W.; Han, Y. GmST1, which encodes a sulfotransferase, confers resistance to soybean mosaic virus strains G2 and G3. Plant Cell Environ. 2021, 44, 2777–2792. [Google Scholar] [CrossRef]
- Han, Y.; Zhao, X. Mapping of resistance genes in N1 strains of soybean mosaic virus disease. Soybean Sci. 2016, 35, 407–410. [Google Scholar]
- Wang, X.; Song, S.; Wang, X.; Liu, J.; Dong, S. Transcriptomic and metabolomic analysis of seedling-stage soybean responses to PEG-simulated drought stress. Int. J. Mol. Sci. 2022, 23, 6869. [Google Scholar] [CrossRef] [PubMed]
- Langfelder, P.; Horvath, S. WGCNA: An r package for weighted correlation network analysis. BMC Bioinform. 2008, 9, 559. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Horvath, S. A general framework for weighted gene coexpression network analysis. Stat. Appl. Genet. Mol. Biol. 2005, 4, 17–60. [Google Scholar] [CrossRef]
- Fonseca, J.E.; Brandi, M.L. Mechanism of action of strontium ranelate: What are the facts? Clinical cases in mineral and bone metabolism: The official journal of the Italian Society of Osteoporosis. Clin. Cases Miner. Bone Metab. 2010, 7, 17–18. [Google Scholar] [PubMed]
- Zhang, X.; Liu, C.J. Multifaceted regulations of gateway enzyme phenylalanine ammonia-lyase in the biosynthesis of phenylpropanoids. Mol. Plant. 2015, 8, 17–27. [Google Scholar] [CrossRef]
- Li, Y.; Kim, J.I.; Pysh, L.; Chapple, C. Four Isoforms of Arabidopsis 4-Coumarate:CoA ligase have overlapping yet distinct roles in phenylpropanoid metabolism. Plant Physiol. 2015, 169, 2409–2421. [Google Scholar]
- Ncube, E.; Mohale, K.; Nogemane, N. Metabolomics as a prospective tool for soybean (Glycine max) crop improvement. Curr. Issues Mol. Biol. 2022, 44, 4181–4196. [Google Scholar] [CrossRef]
- Pyo, Y.; Moon, H.; Nugroho, A.B.D.; Yang, S.W.; Jung, I.L.; Kim, D.-H. Transcriptome analysis revealed that jasmonic acid biosynthesis/signaling is involved in plant response to Strontium stress. Ecotoxicol. Environ. Saf. 2022, 237, 113552. [Google Scholar] [CrossRef]
- Du, J.; Wang, S.; He, C.; Zhou, B.; Ruan, Y.L.; Shou, H. Identification of regulatory networks and hub genes controlling soybean seed set and size using RNA sequencing analysis. J. Exp. Bot. 2017, 68, 1955–1972. [Google Scholar] [CrossRef]
- Luo, Y.; Pang, D.; Jin, M.; Chen, J.; Kong, X.; Li, W.; Chang, Y.; Wang, Z. Identification of plant hormones and candidate hub genes regulating flag leaf senescence in wheat response to water deficit stress at the grain-filling stage. Plant Direct. 2019, 3, e00152. [Google Scholar] [CrossRef]
- Kuroda, H.; Oshima, T.; Kaneda, H.; Takashio, M. Identification and functional analyses of two cDNAs that encode fatty acid 9-/13-hydroperoxide lyase (CYP74C) in rice. Biosci. Biotechnol. Biochem. 2005, 69, 1545–1554. [Google Scholar] [CrossRef] [PubMed]
- Stintzi, A.; Browse, J. The Arabidopsis male-sterile mutant, opr3, lacks the 12-oxophytodienoic acid reductase required for jasmonate synthesis. Proc. Natl. Acad. Sci. USA 2000, 97, 10625. [Google Scholar] [CrossRef] [PubMed]
- Kienow, L.; Schneider, K.; Bartsch, M.; Stuible, H.P.; Weng, H.; Miersch, O.; Wasternack, C.; Kombrink, E. Jasmonates meet fatty acids: Functional analysis of a new acyl-coenzyme A synthetase family from Arabidopsis thaliana. J. Exp. Bot. 2008, 59, 403. [Google Scholar] [CrossRef] [PubMed]
Gene ID | Upstream Primer | Downstream Primer |
---|---|---|
Glyma.16G010000 | GTGTTTGATGCCTTTTCGCC | CAACCCCTTGGTTTCCTGC |
Glyma.11G017900 | GGAAGGTTACTTACGGGTGGT | TGGTGTAGTTGCTAGGGCGT |
Glyma.01G235600 | TCACACTCAACGCCCAGAAA | CAGCGGTGCCAAAACAACT |
Glyma.02G232600 | GGGTTTCAATCGGATTATGG | TTGTAGGGCAGTTGGGGTAT |
Glyma.08G320500 | CGAGGAAGACAAGAAGCCAAC | CGTCCATCAAACAGAAAAGCA |
Glyma.12G073000 | ATACCGAGACGAACGAGCTG | GCAAGGGTGGAGGAATAACA |
Sample | Raw Total Reads | Clean Total Reads | Clean Total Bases | Clean_Q20_Rate (%) | Clean_Q30_Rate (%) | Clean GC Content (%) |
---|---|---|---|---|---|---|
C-1 | 50,064,710 | 49,195,396 | 7,222,615,372 | 98.29 | 94.17 | 44.88 |
C-2 | 55,168,036 | 54,221,094 | 7,988,468,883 | 98.29 | 94.16 | 45.18 |
C-3 | 43,620,848 | 42,822,426 | 6,302,742,270 | 98.26 | 94.09 | 45.37 |
T-1 | 47,875,056 | 47,036,828 | 6,900,332,803 | 98.37 | 94.38 | 44.26 |
T-2 | 54,746,326 | 53,759,410 | 7,847,745,711 | 98.38 | 94.43 | 44.82 |
T-3 | 44,181,626 | 43,291,440 | 6,363,593,234 | 98.37 | 94.39 | 44.86 |
Number | Number | Metabolite Pathway |
---|---|---|
C06366 | Homospermidine |
Biosynthesis of plant secondary metabolites Biosynthesis of alkaloids derived from ornithine, lysine, and nicotinic acid |
C07667 | Gossypol |
Sesquiterpenoid and triterpenoid biosynthesis Biosynthesis of terpenoids and steroids Beta-Alanine metabolism |
C16519 | SEpHCHC |
Biosynthesis of cofactors GlyceropHospHolipid metabolism Arachidonic acid metabolism |
C00157 | PHospHatidylcholine |
Linoleic acid metabolism Alpha-Linolenic acid metabolism |
C00082 | L-tyrosine |
Monobactam biosynthesis Tyrosine metabolism Phenylalanine metabolism Phenylalanine, tyrosine, and tryptopHan biosynthesis Novobiocin biosynthesis Cyanoamino acid metabolism Thiamine metabolism Phenylpropanoid biosynthesis Isoquinoline alkaloid biosynthesis Betalain biosynthesis Glucosinolate biosynthesis Aminoacyl-tRNA biosynthesis Biosynthesis of various antibiotics Biosynthesis of vancomycin group antibiotics Biosynthesis of enediyne antibiotics Biosynthesis of alkaloids derived from shikimate pathway 2-Oxocarboxylic acid metabolism Biosynthesis of amino acids Biosynthesis of cofactors |
C08491 | Jasmonic acid |
Alpha-Linolenic acid metabolism Biosynthesis of plant secondary metabolites Biosynthesis of plant hormones Metabolic pathways Biosynthesis of secondary metabolites Plant hormone signal transduction |
Gene ID | Gene Annotation | T/C |
---|---|---|
Jasmonic acid (JA) biosynthesis | ||
Glyma.13G030300 Glyma.19G263300 Glyma.12G054700 Glyma.20G054400 Glyma.11G130200 Glyma.07G039900 | 13-Lipoxygenase (LOX) | up |
Glyma.17G246500 Glyma.14G078600 Glyma.11G122700 | Allene oxidase synthase (AOS) | up |
Glyma.13G047300 Glyma.19G044900 | Allene oxide cyclase (AOC) | up |
Glyma.03G285800 Glyma.18G139000 | OPDA Reductase (JASSY) | up |
Glyma.17G050000 Glyma.17G049900 Glyma.13G109800 Glyma.13G109700 Glyma.01G235600 | OPCL:Acyl-CoA oxidase (OPR3) | up |
Glyma.01G207500 Glyma.11G035200 Glyma.17G144000 Glyma.05G062200 | Acyl Thioesterase (ACX1) | up |
Phenylpropanoid biosynthesis | ||
Glyma.03G152000 Glyma.18G196200 Glyma.19G154500 Glyma.01G111200 Glyma.03G076800 Glyma.04G237200 Glyma.06G263000 Glyma.08G209500 Glyma.06G127000 | Phenylalaninamnia lyase (PAL) | up |
Glyma.02G221100 Glyma.06G148800 Glyma.04G217100 Glyma.14G221700 | 4-coumarate: CoA ligase (4CL) | up |
Plant hormone signal transduction | ||
Glyma.16G010000 | JAZ | up |
Glyma.08G271900 | Transcription factor MYC2 | up |
alpha-Linolenic acid metabolism | ||
Glyma.11G017900 Glyma.20G143900 | ACSL | up |
Glyma.14G223200 | OPCL1 | up |
Glyma.07G246300 | MFP2 | up |
Glyma.10G124700 | ACAA1 | up |
Plant-pathogen interaction | ||
Glyma.02G232600 Glyma.14G200200 Glyma.18G238200 | Transcription factor WRKY | up |
Hub genes | ||
Glyma.06G157100 | Small nucleolar ribonucleoprotein (SNRP) | up |
Glyma.12G073000 | Mitogen-activated protein kinase (MAPK) | up |
Glyma.15G091400 | Ubiquitin-like protein (UBL) | up |
Glyma.19G205100 | Ribosomal small subunit protein (RP) | up |
Glyma.14G152100 | Aldehyde dehydrogenase (ALDH) | up |
Glyma.10G138800 | Photolyase-interacting factor (PIF) | up |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, H.; Li, R.; Fang, Y.; Zhao, X.; Teng, W.; Li, H.; Han, Y. Weighted Gene Co-Expression Network Analysis Uncovers Critical Genes and Pathways Involved in Soybean Response to Soybean Mosaic Virus. Agronomy 2024, 14, 2455. https://doi.org/10.3390/agronomy14112455
Zhu H, Li R, Fang Y, Zhao X, Teng W, Li H, Han Y. Weighted Gene Co-Expression Network Analysis Uncovers Critical Genes and Pathways Involved in Soybean Response to Soybean Mosaic Virus. Agronomy. 2024; 14(11):2455. https://doi.org/10.3390/agronomy14112455
Chicago/Turabian StyleZhu, Hanhan, Ruiqiong Li, Yaoyao Fang, Xue Zhao, Weili Teng, Haiyan Li, and Yingpeng Han. 2024. "Weighted Gene Co-Expression Network Analysis Uncovers Critical Genes and Pathways Involved in Soybean Response to Soybean Mosaic Virus" Agronomy 14, no. 11: 2455. https://doi.org/10.3390/agronomy14112455
APA StyleZhu, H., Li, R., Fang, Y., Zhao, X., Teng, W., Li, H., & Han, Y. (2024). Weighted Gene Co-Expression Network Analysis Uncovers Critical Genes and Pathways Involved in Soybean Response to Soybean Mosaic Virus. Agronomy, 14(11), 2455. https://doi.org/10.3390/agronomy14112455