Next Article in Journal
Occurrence of Gnomoniopsis smithogilvyi in Chestnut Under Different Management Systems in Northeastern Portugal
Previous Article in Journal
MuCTAB: An Optimized Protocol for High-Molecular-Weight DNA Extraction from Mucilage-Rich Selenicereus Tissues for Long-Read Sequencing
Previous Article in Special Issue
Beyond Folding: The Dual Life of Hsp60 in Tissue Homeostasis and Pathophysiology
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Applied Biosciences
Volume 5
Issue 3
10.3390/applbiosci5030055
applbiosci-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Dietary β-Glucan Supplementation Enhances Somatotropic Axis Activity, Growth Performance, and Breast Muscle Meat Quality in Ross 308 Broiler Chickens

by
Luckas Obanda Malachy
1,*,
Betty Schwartz
2,
Natalie Avital-Cohen
1,
Ofer Gover
2,
Hadar Bar-Dagan
2,
Shelly Druyan
3,
Joanna Bartman
1,
Asaf Marco
1,
Dekel Tsalik
1 and
Israel Rozenboim
1,*
1
Department of Animal Science, Robert H. Smith Faculty of Agriculture, Food and Environment, Hebrew University of Jerusalem, Rehovot 76100, Israel
2
Institute of Biochemistry, Food Science and Nutrition, Robert H. Smith Faculty of Agriculture, Food and Environment, Hebrew University of Jerusalem, Rehovot 76100, Israel
3
Institute of Animal Science, Agricultural Research Organization (ARO), The Volcani Center, Bet Dagan 50250, Israel
*
Authors to whom correspondence should be addressed.
Appl. Biosci. 2026, 5(3), 55; https://doi.org/10.3390/applbiosci5030055
Submission received: 26 December 2025 / Revised: 22 June 2026 / Accepted: 23 June 2026 / Published: 1 July 2026
(This article belongs to the Special Issue Experimental Biology: From Methods to Applications—Under the Auspices of the Italian Society of Experimental Biology, SIBS-1925)
Versions Notes

Abstract

The global push to eliminate antibiotic growth promoters in poultry has accelerated the demand for effective natural alternatives. β-Glucans—branched polysaccharides derived from Saccharomyces cerevisiae cell walls—enhance immunity and gut health; however, their mechanistic effect on the somatotropic axis and meat quality in broilers remains unresolved. Herein, the hypothesis that dietary β-glucan modulates somatotropic signaling to improve growth performance and breast muscle quality was tested with 240 one-day-old Ross 308 chicks allocated to three groups—untreated control, 250 mg β-glucan/kg feed, and 1 g β-glucan/kg feed—and reared for 35 d. Growth performance, plasma growth hormone (GH) and prolactin (PRL), somatotropic axis gene expression in liver and breast muscle, and postmortem meat quality were assessed. β-Glucan supplementation significantly elevated final body weight, breast muscle weight, and plasma GH and PRL, and upregulated hepatic IGF-1 and muscle GH receptor mRNA at 35 d, and hepatic GH receptor mRNA at 17 d. Muscle pH was higher and relative drip loss lower in supplemented birds 72 h postmortem. These results support the hypothesis and identify 1 g β-glucan/kg feed as an effective dose for improving growth and meat quality through somatotropic axis modulation—a novel mechanistic demonstration in broiler chickens.

1. Introduction

The widespread use of antimicrobial growth promoters (AGPs) in intensive poultry production has long been justified by their capacity to suppress subclinical enteric infections that affect poultry health [1,2]. However, mounting evidence linking AGP use to the selection and dissemination of antibiotic-resistant bacteria in both animals and humans has made their continued application a pressing public health concern [3,4,5,6]. Regulatory restrictions on AGPs across major poultry-producing regions have consequently exposed commercial broiler flocks to the full metabolic cost of subclinical enteric challenge, creating an urgent need for safe, effective alternatives that can sustain productivity without compromising food-chain biosecurity [1,2,3].
Among the most extensively studied candidates, β-glucans—non-digestible polysaccharides naturally occurring in the cell walls of yeast, fungi, algae, and cereal grains—have attracted considerable attention as both immunostimulants and growth-promoting feed additives [7,8,9]. Their immunological efficacy is principally mediated through high-affinity binding to pattern-recognition receptors on myeloid cells—notably dectin-1, complement receptor 3, and toll-like receptor 2/6. Receptor engagement sequentially activates Syk kinase, CARD9, and NF-κB signaling. This cascade culminates in proinflammatory cytokine release and the epigenetic reprogramming of hematopoietic progenitors [10,11,12,13].
Among available forms, β-1,3/1,6-glucans derived from yeast and fungi are considered the most biologically potent, owing to their highly branched carbohydrate architecture [14,15]. Beyond immunostimulation, dietary β-1,3/1,6-glucan promotes intestinal villus development, upregulates tight-junction proteins, reshapes the cecal microbiome, and reduces Clostridium perfringens carriage, collectively reducing pathogen burden and enteric inflammation [16,17]. Several β-glucans have been shown to effectively promote the growth of broiler birds and improve their meat quality following their inclusion at dosages that are acceptable to consumers [16,18,19,20,21,22].
The mechanisms through which nutritional interventions translate into somatic growth gains in broilers are fundamentally governed by the somatotropic axis. Hypothalamic growth hormone-releasing hormone (GHRH) drives pulsatile pituitary growth hormone (GH) secretion, which acts via hepatic and skeletal-muscle GH receptors (GHRs) to stimulate insulin-like growth factor-1 (IGF-1) synthesis, myoblast proliferation, and muscle protein accretion [23,24,25]. Together, GH and IGF-1 enhance amino acid uptake, stimulate lipolysis and DNA synthesis, promote protein turnover, and inhibit proteolysis [24]. Prolactin (PRL), a structurally related anterior pituitary hormone, contributes an additional modulatory role in growth regulation in gallinaceous species [26,27].
The functional importance of this axis is well established. Hypophysectomy consistently impairs growth and development in meat-type birds, confirming that intact pituitary signaling is essential for normal somatic growth [25]. Exogenous GH administration in young broilers has, however, yielded ineffective outcomes, suggesting that axis sensitivity—rather than circulating GH concentration alone—governs the growth response [28]. Furthermore, nutritional status modulates somatotropic axis activity by shifting hypothalamic GH-axis expression and hepatic GHR levels across broiler and layer lines [29].
Concurrently, intensive genetic selection for rapid muscle growth has given rise to a spectrum of breast myopathies, most notably woody breast, white striping, and spaghetti meat [30,31]. These conditions originate from hypoxia-induced oxidative stress and immunocyte infiltration within hypertrophied muscle fibers [32], which manifest at the meat-quality level as paler meat color, low water retention, and high shear-force values [33]. Previous studies have shown that β-glucans stimulate the release of anti-inflammatory cytokines, thus curtailing the biosynthesis of proinflammatory cytokines and the binding to their specific receptors [34]. This suggests a key role for β-glucans in alleviating growth-related meat myopathies in broilers.
Taken together, despite the wealth of evidence for β-glucan’s immunostimulatory properties, its mechanistic role in engaging the somatotropic axis to modulate growth performance and meat quality in broilers remains unknown. The present study was therefore designed to test the hypothesis that dietary β-1,3/1,6-glucan supplementation modulates somatotropic axis activity to concurrently improve growth performance and meat quality in broilers at market age. Indeed, dietary β-glucan inclusion did improve growth performance and meat quality in these broilers, effects attributable to somatotropic axis stimulation.

2. Materials and Methods

All animal experiments were conducted in accordance with the ethical guidelines and approval of the Ethics Committee of the Hebrew University of Jerusalem (AG-20-16348-4) and the NIH standards for animal care (OPRR-A01-5011; approved on 28 October 2020).

2.1. Experimental Design and Animal Management

2.1.1. Animals

One-day-old straight-run (mixed-sex) Ross 308 broiler chicks (n = 240; approximately equal proportions of males and females as supplied by the commercial hatchery) were obtained from Nordia Hatchery, Israel, and transported to the controlled-environment poultry facility at the Robert H. Smith Faculty of Agriculture, Food and Environment, Hebrew University of Jerusalem. On arrival, all birds were individually weighed, wing-tagged, and randomly distributed across 12 floor pens (4 pens per treatment; 20 birds per pen), ensuring that each pen contained a representative mix of both sexes. Pens (1.5 × 2.0 m; 3.0 m2 floor area; 0.15 m2/bird) were constructed from plastic partitions mounted on a concrete floor covered with freshly prepared wood-shaving litter. Birds were housed in two environmentally controlled rooms (six pens per room) under standard Ross 308 management conditions, as per the Ross 308 manual guide.

2.1.2. β-Glucan Source and Dosage

High-purity (89%) baker’s yeast (Saccharomyces cerevisiae) Glucan #300 was obtained from Transfer Point (Columbia, SC, USA). β-1,3/1,6-Glucan was isolated according to the alkaline extraction procedure described previously [15]. Two supplementation levels were selected—250 mg/kg and 1 g/kg feed—based on the effective dose ranges consistently reported across published broiler supplementation trials. The lower dose (250 mg/kg) corresponds to the minimum immunostimulatory threshold identified in broiler challenge models, whereas the 1 g/kg dose represents the upper boundary of commercially recommended inclusion levels for yeast-derived β-1,3/1,6-glucan. Three feeding treatments were thus applied (Table 1). All birds received a standard commercial broiler diet (starter, grower, and finisher phases) with β-glucan supplemented at the respective doses by top-dressing and thorough mixing. The nutrient composition of the basal diet, as recommended for Ross 308 birds, is presented in Table 2.

2.1.3. Growth Performance Measurements

Body weight (BW) and feed intake (FI) of all birds were recorded weekly, and the feed conversion ratio (FCR) was calculated. Weekly measurements provided a longitudinal growth profile across the full 35 d rearing period.

2.1.4. Blood Sampling and Plasma Hormone Analyses

For plasma hormone analyses, heparinized blood samples were collected weekly from 20 birds in each treatment group by venipuncture of the wing vein. Plasma was separated by centrifugation (3000× g for 15 min at 4 °C) and stored at −20 °C until analysis. Plasma GH and PRL concentrations were determined by competitive ELISA using the corresponding biotinylated GH tracer [35] and PRL tracer [36], respectively. Inter- and intra-assay coefficients of variation were below 10% for both assays.

2.1.5. Autopsies—Tissue Sampling and Measurements

At 17 and 35 d of age, 20 birds were randomly selected from each treatment (maintaining a proportional representation of both sexes per sample) and euthanized by carbon dioxide (CO2) gas exposure, then exsanguinated by severing the jugular vein and artery in the neck. Immediately thereafter, the hypothalamic region, pituitary gland, breast muscle, and liver were sampled, snap-frozen in liquid nitrogen, and subsequently stored at −80 °C for somatotropic axis mRNA-expression analysis. In addition, the left breast muscle was extracted and weighed for muscle growth evaluation. The recorded breast muscle weight was further evaluated as a percentage of live BW (giving the relative breast muscle weight).

2.1.6. RNA Extraction and Real-Time PCR (RT-PCR)

RNA extraction and RT-PCR were performed according to Dishon et al. [35]. Briefly, total RNA was extracted from frozen tissue samples using RNAzol RT reagent (GeneCopoeia, Rockville, MD, USA) according to the manufacturer’s protocol. Tissue samples were homogenized in an HG-300 homogenizer on ice. RNA integrity and concentration were assessed by spectrophotometry (A260/A280 ratio ≥ 1.8). Complementary DNA (cDNA) was synthesized from 1 μg total RNA using the SuperScript III reverse transcription kit (Thermo Fisher Scientific, Waltham, MA, USA). Each real-time PCR (18 μL total volume) contained 10 μL Platinum SYBR Green qPCR SuperMix-UDG, 5 μL DEPC-treated water, 1 μL prepared cDNA, and 1 μL each of forward and reverse primer (4 μmol). Reactions were performed on a LightCycler 96 real-time PCR system (Roche Diagnostics, Mannheim, Germany) with the following cycling conditions: initial denaturation at 95 °C for 2 min; 40 cycles of 95 °C for 15 s (denaturation), and 60 °C for 60 s (annealing/extension); followed by a melting curve analysis from 60 °C to 95 °C in 0.3 °C increments to confirm amplicon specificity. Melting curve analysis confirmed a single peak for all amplicons, with no evidence of primer-dimer formation or non-specific amplification. Amplicon sizes are reported in Table 3. Raw quantification cycle (Cq) values were normalized against the geometric mean of two housekeeping genes—β-actin and GAPDH. Relative gene expression was calculated according to the following equation [37]:
Relative expression = 2−[Ctgene × −Ctgeometric mean of (β-actin, GAPDH)] × 1000

2.1.7. Meat-Quality Parameters

At 35 d of age, 24 randomly selected broiler birds from each treatment were subjected to 12 h of pre-slaughter feed withdrawal. The birds were euthanized by CO2 gas exposure, slaughtered, and both breast muscles were collected, weighed (W1), and sampled for evaluation of meat-quality parameters. Initial pH measurements were taken 15 min postmortem from the left breast muscle using a portable pH meter with a spear-tipped glass electrode. The probe was cleaned and calibrated in standard acidic (pH 4) and neutral (pH 7) buffer solutions between each measurement. Both breast muscles were packaged in a plastic bag, sealed, and stored in a cold room at 4 °C. At 72 h postmortem, breast muscle pH was re-recorded, and the samples were blotted dry with a clean dry paper towel and re-weighed (W2). Drip loss (DL) was computed as the difference between the breast weights recorded 15 min post and after 72 h of storage, and values were expressed as a percentage of the initial breast muscle weight (relative drip loss; RDL according to the following equation [38].
RDL = {(W1 − W2)/W1} × 100

2.2. Statistical Analysis

The experiment was carried out in four replicates for each dietary β-glucan treatment level. The replicates were tested for significant differences, but none were found. All results are presented as means ± SEM. All analyses were one-way ANOVA with JMP software Ver.19 (SAS Institute Inc., Cary, NC, USA). Student’s t-tests were performed to test the significance between β-glucan treatment levels. Differences were considered statistically significant at p ≤ 0.05.

3. Results

3.1. Growth Performance

The effects of dietary β-glucan on BW, FI, and FCR are presented in Table 4. Supplementation of β-glucan significantly increased broiler birds’ BW compared to the control group. Birds receiving 1 g β-glucan/kg feed attained the highest final BW, which was significantly greater than both the control and 250 mg/kg groups (≈2228.2 g), corresponding to an approximate 7.4% increase relative to their mean BW. No statistically significant difference in BW was observed between the control and 250 mg β-glucan groups. FI and FCR were not significantly influenced by dietary β-glucan supplementation, although the 1 g/kg group showed a numerical increase in FI (+8.6% compared to control; +4.9% compared to 250 mg) and a reduction in FCR of approximately 6.25% compared to both the control and 250 mg/kg groups (Table 4).

3.2. Autopsy Results

Dietary β-glucan supplementation significantly increased both absolute and relative breast muscle weights of broiler birds at 17 and 35 d of age (Table 5). At 17 d, birds supplemented with β-glucan had higher breast muscle weight and relative breast muscle weight in both supplementation groups (250 mg/kg and 1 g/kg), with no significant difference between the two β-glucan doses compared to the control, indicating consistent enhancement of early muscle accretion. The 1 g/kg group consistently exhibited the highest BW, whereas the 250 mg/kg group showed an intermediate response that was not statistically different from either the control or the 1 g/kg group. At 35 d, β-glucan continued to promote muscle development, resulting in higher body and breast muscle weights than the control group. Birds receiving 1 g β-glucan/kg feed achieved significantly greater BW, breast muscle weight, and relative breast muscle weight than the control group, while the 250 mg/kg group consistently showed intermediate responses that did not differ significantly from either the control or the 1 g/kg treatment, confirming β-glucan’s enhancement of muscle-accretion efficiency and overall carcass yield in broiler birds.

3.3. Plasma GH and PRL Levels

β-glucan supplementation significantly elevated mean plasma GH levels in broiler birds compared to the control diet (Table 6). Birds receiving 250 mg β-glucan/kg feed exhibited significantly higher GH levels than the control group, whereas birds fed 1 g β-glucan/kg feed showed intermediate mean values that were not significantly different from either the control or the 250 mg treatment (reflecting a non-monotonic dose pattern). Plasma PRL concentrations were significantly elevated in broilers supplemented with 250 mg and 1 g β-glucan/kg feed compared to the control, with no significant difference between the two β-glucan doses (Table 6). The mean difference between supplemented and control birds was 1.2 ng/mL, corresponding to a PRL increase of approximately 20–21%.

3.4. Gene Expression of Growth-Related Markers

At 35 d, broilers exhibited a classical dose-dependent response to β-glucan supplementation, characterized by significant upregulation of GHR mRNA expression in the breast muscle (Table 7). Birds receiving 250 mg and 1 g β-glucan/kg feed showed markedly higher GHR transcript levels than the control group, indicating enhanced somatotropic signaling within the muscle tissue. However, no significant effect on GHR mRNA expression was found at 17 d across groups (Table 7).
In the liver, the 1 g/kg dose significantly downregulated GHR mRNA at 17 d, suggesting a paradoxical suppressive effect of the higher dose on hepatic GHR signaling. Although no significant differences were observed at 35 d, a numerical increase in hepatic GHR expression persisted with higher β-glucan doses, suggesting a sustained stimulatory effect. Furthermore, β-glucan supplementation significantly elevated IGF-1 mRNA expression in the liver at 35 d (Table 7), with the highest levels observed in the 1 g β-glucan/kg feed group. This upregulation in liver IGF-1 expression supports the observed improvements in muscle accretion observed at that age.
Conversely, β-glucan supplementation did not significantly influence GHRH or GH mRNA expression at either 17 d or 35 d (Table 7). However, a non-significant increasing tendency was observed for both genes with increasing β-glucan levels, indicating potential activation of upstream components of the somatotropic axis. Gene-expression data in Table 7 are reported as arbitrary units derived from the 2−ΔCq formula (see Section 2.1.6). These values represent relative expression normalized to housekeeping genes and are directly comparable across treatment groups within each tissue and time point; they do not represent fold changes relative to the control per se, but rather absolute relative expression indices from which treatment contrasts can be computed. The control group values serve as the interpretive baseline.

3.5. Meat-Quality Parameters

Dietary β-glucan supplementation significantly improved selected breast muscle meat quality at 35 d (Table 8). Birds fed 1 g β-glucan/kg feed exhibited a higher ultimate breast muscle pH (72 h postmortem) than the control group, corresponding to an increase of approximately 1.7% and indicating a retardation of postmortem acidification. The 250 mg/kg group showed an intermediate value that did not differ significantly from either the control or the 1 g/kg group. However, as expected, initial breast muscle pH at 15 min postmortem did not differ significantly across treatment groups, confirming that β-glucan influenced the trajectory of postmortem acidification rather than its starting point. Correspondingly, 1 g/kg β-glucan supplementation significantly reduced RDL compared to the control group, while the 250 mg/kg group showed intermediate values that did not differ significantly from either the control or the 1 g/kg group. These findings indicate that supplementation with 1 g β-glucan/kg feed enhanced the water-holding capacity of the breast muscle and improved meat quality.

4. Discussion

In the present study, dietary β-1,3/1,6-glucan supplementation significantly elevated BW and muscle growth in broiler birds. In addition, it accelerated somatotropic axis activity and improved meat quality. To the best of our knowledge, this is the first study to identify the somatotropic axis as the primary endocrine mechanism through which β-glucan drives growth promotion, moving beyond the well-documented but mechanistically unexplained effects reported in prior trials.

4.1. Growth Performance

Dietary supplementation with 1 g β-glucan/kg feed significantly enhanced final BW compared to both the control and 250 mg/kg groups (which did not differ significantly from each other), indicating a clear growth-promoting effect. These findings align with previous studies reporting that β-glucan promotes growth performance through improved nutrient absorption, immune modulation, and gut health [11,16,18,19,20,21,22]. The improvement in BW observed with 1 g β-glucan/kg feed suggests that the response was primarily driven by the higher inclusion level, consistent with the growth-promoting potential of yeast-derived β-1,3/1,6-glucan reported in broiler nutrition studies. The enhanced BW observed in β-glucan-supplemented birds in the present study is consistent with the concurrent improvements in breast muscle mass (Section 4.2) and somatotropic axis activity (Section 4.3 and Section 4.4), supporting β-glucan’s role as an effective growth promoter in broiler nutrition.
FI and FCR were not significantly altered by dietary β-glucan supplementation; however, the 1 g/kg group exhibited numerical improvements in both FI and FCR compared to the control and 250 mg/kg groups. Though these differences should be interpreted cautiously, the non-significant but numerically higher FI among β-glucan-supplemented birds may reflect enhanced palatability and/or improved digestive efficiency. Similar non-significant shifts in FI and FCR have been reported in broiler studies using yeast-derived β-1,3/1,6-glucans, where metabolic modulation rather than intake stimulation appeared to drive performance outcomes [39]. Amer et al. [13] also found no adverse effects on FCR at doses of up to 150 mg β-glucan/kg feed, but reported a significant increase in serum GH concentration, which is fully consistent with the present findings and further supports the endocrine basis of β-glucan’s growth-promoting action. This is expected for yeast-derived β-1,3/1,6-glucan, as its branched structure limits the increase in intestinal digesta viscosity [40,41]. Collectively, these findings reinforce the positive role of β-glucan as a functional feed additive in broiler production. Its inclusion in diets may enhance growth performance by improving nutrient utilization and metabolic efficiency, thereby supporting its potential as a natural growth promoter in poultry-feeding strategies.

4.2. Muscle Growth

β-glucan enhanced breast muscle and relative breast muscle weights in broiler birds at both 17 and 35 d, indicating a positive influence on muscle development and carcass yield, although the response varied with supplementation level and growth stage. The absence of statistically significant differences between the 250 mg/kg and 1 g/kg groups at 17 d suggests that even moderate β-glucan inclusion was sufficient to stimulate early muscle deposition during the rapid post-hatch growth phase. In contrast, the more pronounced response observed at 35 d in birds receiving 1 g β-glucan/kg feed indicates that higher supplementation levels may be required to sustain muscle growth during later developmental stages. These findings align with previous reports demonstrating similar improvements in muscle mass in broilers [39] and Peking ducks [42] following dietary β-glucan inclusion. The higher relative breast muscle weight observed in β-glucan-treated broilers suggests enhancement of direct muscle accretion, potentially mediated through several physiological mechanisms: (i) β-glucan enhancement of FI and nutrient-utilization efficiency, potentially resulting in greater substrate availability for muscle protein synthesis [40,43]; (ii) improvement of gut health in broilers [10,16,44]; (iii) elevation in somatotropic axis hormones (Section 4.3). Although FI and FCR were not significantly affected, the numerical improvement in growth performance observed in the 1 g/kg group may have contributed to the enhanced muscle yield.
Notably, relative breast muscle weight was already significantly elevated on d 17, preceding peak somatotropic activity, which in broilers coincides with maximum GH pulse amplitude and maximal relative BW gain [6,24]. This suggests that β-glucan promotes early anabolic muscle deposition through improved nutrient utilization, intestinal health, and growth-regulatory pathway activation, independent of peak somatotropic stimulus. Consistent with the work of Vaccaro et al. [45], who demonstrated that hepatic IGF-1 rises rapidly posthatch and that paracrine IGF signaling contributes substantially to early breast muscle accretion in broilers, the hepatic GHR upregulation observed here at 17 d in the 250 mg β-glucan/kg feed group supports the view that β-glucan accelerates somatotropic axis sensitization during the early growth phase, when local IGF signaling, rather than peak circulating GH, is the dominant driver of muscle deposition. Furthermore, the present data show that β-glucan engages both phases of the somatotropic growth program sequentially: hepatic GHR–IGF-1 signaling at 17 d and muscle GHR expression at 35 d, a pattern consistent with the developmental trajectory of the axis reported by Vaccaro et al. [45] and the broader somatotropic ontogeny literature [29,46]. Together, these findings support the concept that β-glucan modulates growth-regulatory pathways involved in sequential phases of muscle accretion in broiler birds. Further studies elucidating the molecular basis of these mechanisms under different production conditions are warranted.

4.3. Plasma GH and PRL Levels

Dietary supplementation with β-glucan significantly elevated plasma GH and PRL levels compared to the control diet, indicating a stimulatory effect on the endocrine system of broiler birds. Birds supplemented with 250 mg β-glucan/kg feed exhibited approximately 43% higher plasma GH than the control group, whereas the 1 g/kg dose produced a more moderate, approximately 28% increase over the control and did not differ statistically from either the control or the 250 mg/kg treatment. These findings suggest that the lower supplementation level elicited the strongest endocrine stimulation, and increasing the dose did not proportionally enhance circulating GH concentrations. All observed GH and PRL values were within the physiological reference ranges reported for broilers of comparable age and commercial live weight—approximately 2–12 ng/mL for GH and 3–10 ng/mL for PRL [23,26]—confirming that the hormonal responses represent physiologically meaningful enhancement rather than supraphysiological stimulation. This pattern could be explained within the GH–IGF-1 long-loop feedback system: the greater IGF-1 expression observed in the 1 g/kg group (Section 4.4) likely exerts stronger negative feedback on pituitary GH secretion, moderating circulating GH to below the 250 mg/kg level despite producing superior downstream anabolic output. This is independently corroborated by Amer et al. [13], who reported that 1,3-β-glucan supplementation significantly elevated serum GH concentration in broilers, coupled with improvements in intestinal morphology, strengthening the endocrine mechanism proposed here. The observed elevation in circulating GH above control levels at 250 mg/kg is physiologically relevant, falling within the range of GH increments associated with measurable growth-rate differences in broiler lines [47].
GH is a prerequisite for normal growth and development in broilers [48,49]. It stimulates somatic growth either directly by regulating the metabolic activity of the somatic cells, or indirectly through the hepatic IGF-1 axis [23,24], followed by acceleration of somatic cell growth and proliferation. The observed increase in plasma GH level in β-glucan-fed broilers suggests an influence of β-glucan on the synthesis and secretion of GH. According to Decuypere and Buyse [24], plasma GH concentration and pulsatile amplitude are established biological indicators of growth rate in broilers, with maximum pulse amplitude occurring at the point of peak relative BW gain.
β-glucan supplementation significantly increased plasma PRL levels compared to the control group. Both β-glucan supplementation levels—250 mg and 1 g/kg feed—produced a comparable improvement of approximately 21% above control values, with no significant difference between the two β-glucan doses. This plateau-type response indicates that PRL secretion may reach maximal physiological stimulation at relatively low β-glucan-inclusion levels, beyond which additional supplementation does not further enhance circulating concentrations. Other studies have shown that PRL regulates growth in broiler birds [26,50]. Enhanced PRL levels in β-glucan-fed birds could also explain their higher BW and breast muscle weight. Supporting this, a comparable study on Japanese quails revealed an association between enhanced PRL level and higher BW [27]. Taken together, the increase in circulating GH and PRL concentrations indicates that dietary β-glucan exerts a positive regulatory effect on hormonal pathways governing growth and metabolism in broilers, thereby contributing to improved performance and muscle accretion.

4.4. Gene Expression of Growth-Related Markers in the Somatotropic Axis

The tissue- and age-specific patterns of somatotropic gene expression are among the most informative findings of this study. At 17 d, β-glucan stimulated the liver preferentially, upregulating hepatic GHR at 250 mg/kg; by 35 d, the transcriptional signal had shifted to breast muscle GHR and hepatic IGF-1 at the higher dose. This hepatic-to-peripheral progression mirrors the known developmental ontogeny of the broiler somatotropic axis, in which hepatic IGF-1 dominates early somatic growth and muscle GHR expression expands toward market weight [46], confirming that β-glucan engages the axis in a dose- and age-dependent manner.
According to Decuypere and Buyse [24], higher levels of circulating GH repress the expression of liver GHR. Interestingly, an increase in liver and muscle GHR mRNA expression was detected in β-glucan-fed broilers at 17 d and 35 d, respectively. These data suggest that β-glucan-induced GH secretion remained within a permissive range for receptor upregulation rather than triggering suppression. Elevated expression of GHR mRNA may well mediate the binding of GH, which eventually stimulates IGF-1 release from the liver and muscle [35,45,46]. The upregulation effect of β-glucan on IGF-1 at 35 d in the present study could also be associated with the enhanced growth performance and muscle development observed in β-glucan-fed broiler birds [45,46]. Hepatic IGF-1 mRNA abundance is a well-validated molecular predictor of BW and growth rate in broilers [47], and activation of the GHR–IGF-1–IGF-1 receptor-signaling pathway is the primary driver of myoblast proliferation, protein anabolism, and growth in fast-growing birds [50,51]. The activation of this pathway at the hepatic IGF-1 node by β-glucan supplementation strengthens the mechanistic case for its application as a somatotropic-active alternative to antibiotic growth promoters.
The non-significant but upward trend observed in GHRH and GH mRNA expression with increasing β-glucan doses suggests transcriptional activation of the hypothalamo-pituitary axis, as previously described [48,49,50], indicating that the hormonal effects observed in the plasma may be partly driven by enhanced hypothalamic drive rather than solely by pituitary responsiveness. Consistent with earlier observations [29], GHR mRNA expression in breast muscle was lower on d 17, likely reflecting a physiological restraint that limits muscle growth until the somatotropic axis reaches full functional maturity. These findings suggest a possible mechanism for balancing muscle growth in broilers by downregulating GHR.
Taken together, the observed increases in liver and muscle GHR and IGF-1 expression indicate that dietary β-glucan supplementation enhances somatotropic signaling, contributing to improved growth performance and muscle development in broilers through modulation of growth-related gene expression.

4.5. Meat-Quality Parameters

β-glucan supplementation elevated broiler breast muscle pH 72 h postmortem. Birds supplemented with 1 g β-glucan/kg feed exhibited an approximately 1.7% higher ultimate breast muscle pH than the control group, whereas the 250 mg/kg group showed intermediate values that did not differ significantly from either treatment. This finding aligns with recent reports in which 1 g of dietary β-glucan increased breast muscle pH in broilers [20,22,39] and muscle pH in pigs [52]. Similarly, Zhang et al. [22] reported comparable improvements in ultimate pH and water-holding capacity in β-glucan-supplemented broilers under heat stress. The observed increase in ultimate pH in the present study indicates improved postmortem muscle metabolism and reduced acidification [53]. In addition, a significant decrease in RDL (≈28%) was detected in broilers exposed to 1 g β-glucan/kg feed compared to the control—consistent with Cho et al. [20], who showed reduced DL in broilers fed β-glucan, while the 250 mg/kg group showed intermediate, non-significant responses between the control and the 1 g/kg groups. These results suggest that β-glucan improves meat quality in broilers by increasing muscle pH and water-holding capacity, likely by altering postmortem biochemical changes in the muscle and retarding pH decline [54]. The improvements in ultimate breast muscle pH and RDL in the 1 g dietary β-glucan-supplemented birds reflect a significant effect on postmortem muscle biochemistry.
Following exsanguination, anaerobic glycolysis converts stored muscle glycogen to lactic acid, progressively acidifying the breast muscle. Both the rate and extent of this pH decline govern water-holding capacity: rapid or excessive acidification denatures myofibrillar proteins, particularly myosin, reducing their water-holding capacity and leading to drip formation(DL) [55,56]. Therefore, it is likely that β-glucan, particularly at 1 g/kg feed, improves meat quality in broilers by altering postmortem biochemical changes, possibly through reduced glycogen breakdown or altered glycolytic enzyme activity [57], thereby impeding pH decline and minimizing water loss. Direct measurement of muscle glycogen and glycolytic enzyme activity at slaughter would be required to confirm this pathway.
Notably, β-glucan’s anti-inflammatory properties [34] may reduce oxidative muscle damage and inflammatory infiltration, both of which accelerate postmortem protein denaturation and DL in growth-related breast myopathies [31,58]. The anti-inflammatory properties of β-glucan have been independently associated with improvements in ultimate muscle pH and water-holding capacity [20,22,52]. The significant reductions in RDL and elevations in ultimate pH observed here extend that evidence directly, suggesting that β-glucan supplementation attenuates myopathic tissue deterioration in broiler muscle.
Combined, the internal consistency across growth performance, hormones, gene expression, and meat quality supports both the reproducibility of the endocrine response and the mechanistic inference drawn from these data. In the early rearing phase, β-glucan improves gut-barrier integrity and stabilizes the microbiome, reducing immune costs and channeling metabolites toward anabolic tissue deposition [14,17]; this is consistent with the significantly greater breast muscle weight already evident at 17 d, prior to peak somatotropic activity. As the rearing period advances, pituitary GH and PRL secretions increase, hepatic GHR and IGF-1 mRNAs are upregulated, and breast muscle GHR expression is enhanced toward market age, collectively driving muscle protein accretion, improved carcass yield, and superior postmortem muscle quality. β-Glucan engages pattern-recognition receptors across multiple cell types, triggering cascades that extend beyond innate immunity into the neuroendocrine axis. This multitarget profile, operating simultaneously at the gut, endocrine, and muscle levels, is mechanistically distinct from conventional single-pathway growth promoters. Collectively, these properties position β-glucan as an alternative to AGP in commercial broiler production.

5. Conclusions

Dietary supplementation of broilers with yeast-derived β-1,3/1,6-glucan significantly enhanced BW, breast muscle weight, upregulation of somatotropic gene expression, and postmortem meat quality over a 35 d production cycle. These improvements were mechanistically mediated by metabolic modulation of the somatotropic axis: circulating GH and PRL levels were elevated throughout the trial, hepatic GHR mRNA was upregulated at 17 d, and both hepatic IGF-1 and breast muscle GHR mRNA expression were significantly stimulated at 35 d of age. To the best of our knowledge, this is the first study to link dietary β-glucan supplementation to somatotropic axis modulation in broilers at both hormonal and transcriptional levels, but further clarification is needed. β-glucan also demonstrated improved meat quality in broilers by elevating muscle pH, suggesting that it influences postmortem biochemical changes in the muscle. An investigation of the effect of β-glucan on muscle glycogen concentration in relation to postmortem biochemical changes is warranted. Based on these findings, 1 g β-glucan/kg feed is recommended for commercial broiler production, as it consistently produced the greatest improvements. Nevertheless, a limitation of this study should be noted: only two doses were evaluated, and there is a need for sex-disaggregated data to confirm that the recommended dose performs equally in male and female birds.

Author Contributions

Conceptualization, B.S. and I.R.; formal analysis, L.O.M., B.S., S.D., J.B., D.T., and I.R.; investigation, L.O.M., N.A.-C., O.G., H.B.-D., J.B., A.M., and D.T.; methodology, B.S., A.M., and I.R.; supervision, B.S. and I.R.; writing—original draft, L.O.M., B.S., J.B., D.T., and I.R.; writing—review and editing, A.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the US–Israel Binational Agricultural Research and Development Fund (BARD), No. IS-5241-20. We gratefully acknowledge their support, which made this study possible. All funding sources have been properly acknowledged, and there are no additional sources of funding to declare.

Institutional Review Board Statement

The animal study was conducted in accordance with the Declaration of Helsinki and was reviewed and approved by the Ethics Committee of the Hebrew University of Jerusalem. The experiment was conducted at the poultry unit and research laboratories at the Faculty of Agriculture, Food and Environmental Sciences, Israel. All animal experiments were performed under the care and super-vision of Prof. Israel Rozenboim. Protocol code AG-20-16348-4, NIH approval number OPRR-A01-5011, date of approval, 28 October 2020.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interests.

References

  1. Landers, T.F.; Cohen, B.; Wittum, T.E.; Larson, E.L. A review of antibiotic use in food animals: Perspective, policy, and potential. Public Health Rep. 2012, 127, 4–22. [Google Scholar] [CrossRef] [PubMed]
  2. Mehdi, Y.; Létourneau-Montminy, M.P.; Gaucher, M.L.; Chorfi, Y.; Suresh, G.; Rouissi, T.; Brar, S.K.; Côté, C.; Ramirez, A.A.; Godbout, S. Use of antibiotics in broiler production: Global impacts and alternatives. Anim. Nutr. 2018, 4, 170–178. [Google Scholar] [CrossRef] [PubMed]
  3. Donoghue, D.J. Antibiotic residues in poultry tissues and eggs: Human health concerns? Poult. Sci. 2003, 82, 618–621. [Google Scholar] [CrossRef] [PubMed]
  4. Aarestrup, F.M.; Wegener, H.C.; Collignon, P. Resistance in bacteria of the food chain: Epidemiology and control strategies. Expert Rev. Anti. Infect. Ther. 2008, 6, 733–750. [Google Scholar] [CrossRef] [PubMed]
  5. Manyi-Loh, C.; Mamphweli, S.; Meyer, E.; Okoh, A. Antibiotic use in agriculture and its consequential resistance in environmental sources: Potential public health implications. Molecules 2018, 23, 795. [Google Scholar] [CrossRef] [PubMed]
  6. Jie, Y.; Wen, C.; Huang, Q.; Gu, S.; Sun, C. Distinct patterns of feed intake and their association with growth performance in broilers. Poult. Sci. 2023, 103, 103974. [Google Scholar]
  7. Anwar, M.I.; Muhammad, F.; Awais, M.M.; Akhtar, M. β-Glucans as a growth promoter and antibiotic alternative against enteric pathogens in poultry. Worlds Poult. Sci. J. 2017, 73, 651–661. [Google Scholar] [CrossRef]
  8. Schwartz, B.; Vetvicka, V. β-Glucans as effective antibiotic alternatives in poultry. Molecules 2021, 26, 3560. [Google Scholar] [CrossRef] [PubMed]
  9. El-sawy, A.E.F.; El-maddawy, Z.K.; Ibrahiem, H.S.; BoGhazel, E. The growth promoting effect of beta-glucan in comparison with sodium butyrate on broiler chicks. Alex. J. Vet. Sci. 2015, 44, 23–37. [Google Scholar] [CrossRef]
  10. Shao, Y.; Guo, Y.; Wang, Z. β-1,3/1,6-Glucan alleviated intestinal mucosal barrier impairment of broiler chickens challenged with Salmonella enterica serovar Typhimurium. Poult. Sci. 2013, 92, 1764–1773. [Google Scholar] [CrossRef] [PubMed]
  11. Guo, Y.; Ali, R.A.; Qureshi, M.A. Influence of β-glucan on immune responses in broiler chicks. Immunopharmacol. Immunotoxicol. 2003, 25, 461–472. [Google Scholar] [CrossRef] [PubMed]
  12. Mata-Mart, P.; Bergo, M. Dectin-1 signaling update: New perspectives for trained immunity. Front. Immunol. 2022, 13, 812148. [Google Scholar] [CrossRef]
  13. Amer, S.A.; Alagawany, M.; Farag, M.R.; Dhama, K.; Tiwari, R.; Noreldin, A.E.; Abdel-Latif, H.M.R.; Abdo, M.A.; Alotaibi, S.S.; Elbestawy, A.R. Effect of 1,3-β-glucans dietary addition on growth, intestinal histology, biochemical parameters and immune expression in broiler chickens. Anim. Biosci. 2022, 35, 1234–1248. [Google Scholar]
  14. Wang, J.; Zhao, Z.; Liu, X.; Zhang, D.; Li, H.; Li, P.; Huang, X.; Chen, Y. Effect of β-1,3/1,6-glucan on gut microbiota of yellow-feathered broilers. AMB Express 2022, 12, 145. [Google Scholar] [CrossRef]
  15. Vetvicka, V.; Sima, P.; Richter, J.; Vetvickova, J.; Vannucci, L. Spatial distribution of glucan type and content in Pleurotus eryngii. Int. J. Mol. Sci. 2018, 19, 3371. [Google Scholar] [CrossRef] [PubMed]
  16. Ding, B.; Lu, L.; Lu, X.; Yan, X.; Wu, D.; Suo, S.; Liu, C.; Li, Z. Effects of dietary yeast β-1,3-1,6-glucan on growth performance and immunity in chicks. Asian-Australas. J. Anim. Sci. 2019, 32, 1558–1564. [Google Scholar] [PubMed]
  17. Guo, W.; Han, D.; Zhang, F.; Zhan, Q.; Liu, Y.; Peng, Q.; Huang, S.; Xue, Z.; Yang, X. Effect of dietary β-1,3-glucan addition on the growth performance, mRNA expression in jejunal barrier, and cecal microflora of broilers challenged with Clostridium perfringens. Poult. Sci. 2023, 102, 102349. [Google Scholar] [PubMed]
  18. Chae, B.J.; Lee, S.I.; Ryu, K.S.; Kim, D.K.; Kim, I.H. Effect of supplementation of beta-glucan on the growth performance and immunity in broilers. Res. Vet. Sci. 2006, 80, 291–298. [Google Scholar] [PubMed]
  19. Moon, S.H.; Kang, C.W.; Kang, B.K.; Kim, D.K.; Kim, I.H. Effect of Dietary Beta-Glucan on the Performance of Broilers and the Quality of Broiler Breast Meat. Asian-Australas. J. Anim. Sci. 2016, 29, 384–389. [Google Scholar] [CrossRef] [PubMed]
  20. Cho, J.H.; Zhang, Z.F.; Kim, I.H. Effect of single or combined dietary supplementation of β-glucan and kefir on growth performance, blood characteristics and meat quality in broilers. Br. Poult. Sci. 2013, 54, 216–221. [Google Scholar] [CrossRef] [PubMed]
  21. Rajapakse, J.R.P.V.; Kim, H.J.; Kang, C.W.; Kim, D.K.; Lee, H.J. Effect of Sophy β-glucan on immunity and growth performance in broiler chicken. J. Vet. Med. Sci. 2010, 72, 1629–1632. [Google Scholar] [PubMed][Green Version]
  22. Zhang, S.; Ou, J.; Luo, Z.; Kim, I.H. Dietary β-1,3-glucan supplementation and heat stress in broilers. Poult. Sci. 2020, 99, 4969–4977. [Google Scholar] [CrossRef] [PubMed]
  23. Scanes, C.G.; Lauterio, T.J. Growth hormone: Its physiology and control. J. Exp. Zool. 1984, 232, 443–452. [Google Scholar] [CrossRef] [PubMed]
  24. Decuypere, E.; Buyse, J. Endocrine control of postnatal growth in poultry. J. Poult. Sci. 2005, 42, 1–13. [Google Scholar] [CrossRef]
  25. Harvey, S. Growth hormone and growth. Gen. Comp. Endocrinol. 2013, 190, 3–9. [Google Scholar] [CrossRef] [PubMed]
  26. Harvey, S.; Davison, T.F.; Chadwick, A. Ontogeny of growth hormone and prolactin secretion in domestic fowl. Gen. Comp. Endocrinol. 1979, 39, 270–273. [Google Scholar] [CrossRef] [PubMed]
  27. Camper, P.M.; Burke, W.H. Effect of prolactin on reproductive function in Japanese quail. Poult. Sci. 1977, 56, 1130–1134. [Google Scholar] [CrossRef] [PubMed]
  28. Moellers, R.F.; Cogburn, L.A. Chronic intravenous infusion of chicken growth hormone increases body fat content of young broiler chickens. Comp. Biochem. Physiol. A 1995, 110, 47–56. [Google Scholar] [CrossRef]
  29. Zhao, R.; Muehlbauer, E.; Decuypere, E.; Grossmann, R. Effect of genotype-nutrition interaction on growth and somatotropic gene expression in the chicken. Domest. Anim. Endocrinol. 2004, 136, 2–11. [Google Scholar] [CrossRef]
  30. Petracci, M.; Mudalal, S.; Soglia, F.; Cavani, C. Meat quality in fast-growing broiler chickens. Worlds Poult. Sci. J. 2019, 71, 9339. [Google Scholar]
  31. Wang, C.; Che, S.; Susta, L.; Barbut, S. Textural and physical properties of breast fillets with myopathies. Poult. Sci. 2023, 102, 102309. [Google Scholar] [CrossRef] [PubMed]
  32. Mutryn, M.F.; Brannick, E.M.; Fu, W.; Lee, W.R.; Abasht, B. Characterization of a novel chicken muscle disorder. BMC Genom. 2015, 16, 399. [Google Scholar] [CrossRef]
  33. Soglia, F.; Laghi, L.; Mudalal, S.; Zappaterra, M.; Cavani, C.; Petracci, M. Histology, composition, and quality traits of chicken Pectoralis major muscle affected by wooden breast abnormality. Poult. Sci. 2017, 96, 3465–3472. [Google Scholar] [CrossRef] [PubMed]
  34. Bedirli, A.; Kaynar, H.; Atli, Y.; Cander, B.; Sarisoy, H.; Goktas, S. Beta-glucan attenuates inflammatory cytokine release. Shock 2007, 27, 397–401. [Google Scholar] [CrossRef] [PubMed]
  35. Dishon, L.; Rozenboim, I.; Rosenstrauch, A.; Proudman, J.A.; Halevy, O. In-ovo green light photostimulation enhances somatotropic axis activity. Poult. Sci. 2017, 96, 1884–1890. [Google Scholar] [CrossRef] [PubMed]
  36. Rochester, J.R.; Heiblum, R.; Rozenboim, I.; Millam, J.R. Post-hatch estrogen exposure effects. Physiol. Behav. 2008, 95, 370–380. [Google Scholar] [PubMed]
  37. Dishon, L.; Rozenboim, I.; Halevy, O.; Proudman, J.A. In-ovo green light photostimulation at embryonic stages. Poult. Sci. 2018, 97, 1998–2004. [Google Scholar] [CrossRef] [PubMed]
  38. Sabaw, A.B.; Muhammed, T.S. Meat quality in broiler chickens under feed withdrawal. IOP Conf. Ser. Earth Environ. Sci. 2021, 761, 012112. [Google Scholar]
  39. Ahammad, G.S.; Kim, I.H. Dietary β-1,3-glucan supplementation in broilers with dextran sulfate sodium (DSS)-induced colitis: Impact on growth performance, organ weight, meat quality, and intestinal health. Can. J. Anim. Sci. 2025, 105, 1–8. [Google Scholar] [CrossRef]
  40. Jacob, J.P.; Pescatore, A.J. Barley β-glucan in poultry diets. Ann. Transl. Med. 2014, 2, 20. [Google Scholar] [CrossRef] [PubMed]
  41. Laroche, C.; Michaud, P. New developments and prospective applications for beta-(1,3) glucans. Recent Pat. Biotechnol. 2007, 1, 59–73. [Google Scholar] [PubMed]
  42. Tang, X.Y.; Yang, J.; Zhang, H.Y.; Zhang, X.; Liu, G. Effects of Sophy β-glucan on growth performance, carcass traits, meat composition, and immunological responses of Peking ducks. Poult. Sci. 2011, 90, 737–745. [Google Scholar] [CrossRef] [PubMed]
  43. Luo, J.; Cheng, L.; Du, Y.; Mao, X. The anti-inflammatory effects of low-and high-molecular-weight beta-glucans from Agrobacterium sp. ZXO9 in LPS-induced weaned piglets. Food Funct. 2020, 11, 585–595. [Google Scholar] [PubMed]
  44. Kovitvadhi, A.; Wongtangtintharn, S.; Boontiam, W.; Phaephan, S.; Suriyaphol, P. Effects of dietary supplementation with different levels and molecular weights of fungal β-glucan on performances, health and meat quality in broilers. Asian-Australas. J. Anim. Sci. 2019, 32, 1548–1557. [Google Scholar] [CrossRef] [PubMed]
  45. Vaccaro, L.A.; Porter, T.E.; Ellestad, L.E. The effect of commercial Genetic selection on somatotropic gene expression in broilers: A potential role for insulin-like growth factor binding proteins in regulating broiler growth and body composition. Front. Physiol. 2022, 13, 935311. [Google Scholar] [CrossRef] [PubMed]
  46. Kanacki, Z.; Stojanovic, S.; Uscebrka, G.; Zikic, D. The development pattern of IGF-1 (insulin-like growth factor-1) protein expression in breast muscle of broiler chickens. Biotechnol. Anim. Husb. 2012, 28, 797–805. [Google Scholar]
  47. Jia, J.; Guo, Y.; Li, X.; Chen, H.; Zhang, D.; Zhao, G. Selection for growth rate and body size have altered the expression profiles of somatotropic axis genes in chickens. PLoS ONE 2018, 13, e0195378. [Google Scholar] [CrossRef] [PubMed]
  48. Buyse, J.; Decuypere, E. The role of the somatotrophic axis in the metabolism of the chicken. Domest. Anim. Endocrinol. Domest. Anim. Endocrinol. 1999, 17, 245–255. [Google Scholar] [CrossRef] [PubMed]
  49. Scanes, C.G.; Harvey, S.; Marsh, J.A.; King, D.B. Hormones and growth in poultry. Poult. Sci. 1983, 63, 2062–2074. [Google Scholar]
  50. Bhattacharya, T.K.; Chatterjee, R.N.; Sharma, R.P.; Niranjan, M.; Rajkumar, U.; Reddy, B.L.N. Polymorphism in the prolactin promoter and its association with growth traits in chickens. Biochem. Genet. 2011, 49, 385–394. [Google Scholar] [CrossRef] [PubMed]
  51. Barclay, R.D.; Burd, N.A.; Tyler, C.; Tillin, N.A.; Mackenzie, R.W. The Role of the IGF-1 Signaling Cascade in Muscle Protein Synthesis and Anabolic Resistance in Aging Skeletal Muscle. Front. Nutr. 2019, 6, 146. [Google Scholar] [CrossRef] [PubMed]
  52. Luo, J.; Luo, Q.; Wu, J.; Cheng, L.; Mao, X.; Du, Y. Dietary β-glucan improves finishing pig performance. Anim. Nutr. 2019, 5, 380–385. [Google Scholar] [PubMed]
  53. Mir, N.A.; Rafiq, A.; Kumar, F.; Singh, V.; Shukla, V. Determinants of broiler meat quality. J. Food Sci. Technol. 2017, 54, 2997–3009. [Google Scholar] [CrossRef] [PubMed]
  54. Schreurs, F.J.G. Post-mortem changes in chicken muscle. Worlds Poult. Sci. J. 2000, 56, 319–346. [Google Scholar] [CrossRef]
  55. Lee, H.L.; Santé-Lhoutellier, V.; Vigouroux, S.; Briand, Y.; Briand, M. Role of calpains in postmortem proteolysis. Poult. Sci. 2008, 87, 2126–2132. [Google Scholar] [CrossRef] [PubMed]
  56. Huff-Lonergan, E.; Lonergan, S.M. Mechanisms of water-holding capacity of meat. Meat Sci. 2005, 71, 194–204. [Google Scholar] [CrossRef] [PubMed]
  57. Przybylski, W.; Jaworska, D. Metabolomic analysis of drip loss in chicken meat. Poult. Sci. 2022, 101, 101608. [Google Scholar] [CrossRef] [PubMed]
  58. Kong, B.; Li, S.; Zhu, X.; Zhang, L.; Xu, J.; Wu, X.; Zhao, R.; He, J. Proteomic analysis of chicken breast with white striping myopathy. Poult. Sci. 2024, 103, 103682. [Google Scholar] [PubMed]
Table 1. Nutritional treatment groups.
Table 1. Nutritional treatment groups.
TreatmentPensBirds/pen
Untreated control420
250 mg β-glucan/kg feed420
1 g β-glucan/kg feed420
n = 80 birds per treatment; four replicate pens of 20 birds per pen.
Table 2. Nutrient composition of basal diet.
Table 2. Nutrient composition of basal diet.
ConstituentsStarter (Days 0–10)Grower (Days 11–24)Finisher (Days 25–35)
Ingredient composition (%, as-fed basis)
Corn gluten meal 60% CP3.705.505.89
Corn 7.5% CP56.0059.0062.20
Soybean meal 48% CP33.5628.1823.80
Soy oil2.203.004.00
Sodium bicarbonate0.250.250.25
Di-calcium phosphate 18%1.501.401.30
Calcium carbonate1.201.201.10
Broiler premix *0.300.300.30
Salt0.150.150.15
L-Lysine HCl 78%0.470.450.40
DL-Methionine 98%0.400.300.33
L-Threonine 98.5%0.100.100.10
Choline 60 veg0.070.070.07
Phytase0.0050.0050.005
Antimycotoxin0.100.100.10
β-Glucan (treatment-dep.) †0/0.025/0.10/0.025/0.10/0.025/0.1
Total100.00100.00100.00
Chemical analysis (calculated, as-fed basis)
Moisture (%)12.0012.1011.60
ME poultry (kcal/kg) 297530503100
ME poultry (MJ/kg)12.4512.7612.97
CP (%)23.021.519.5
Methionine, total (%)0.560.510.48
Lysine, total (%)1.441.291.16
Calcium (%)0.950.750.65
Av phosphorus (%)0.500.420.36
CP, crude protein; ME, metabolizable energy. * Premix provided per kg diet (all phases or starter/grower/finisher): vitamin A 13,000 IU; vitamin D3 5000/4500/4000 IU; vitamin E 80/65/55 IU; vitamin K3 4.0/3.6/3.2 mg; thiamin (B1) 5/4/3 mg; riboflavin (B2) 9/8/7 mg; niacin 70/65/50 mg; pantothenic acid 25/20/15 mg; pyridoxine (B6) 5/4/3 mg; biotin 0.35/0.28/0.22 mg; folic acid 2.5/2.0/1.8 mg; vitamin B12 0.020/0.018/0.016 mg; choline 1700/1600/1500 mg; copper 16 mg; iodine 1.25 mg; iron 20 mg; manganese 120 mg; selenium 0.30 mg; zinc 120 mg. † β-Glucan (Glucan #300, 89% purity; Transfer Point) was top-dressed at 0 (control), 250 mg/kg (0.025%), or 1 g/kg (0.1%) feed per treatment without adjusting the basal nutrient matrix.
Table 3. Primers used in real-time PCR.
Table 3. Primers used in real-time PCR.
GenePrimer Sequence (5′→3′)Tm (°C)Amplicon (bp)
GHRHF: GGCAAACGGCTCAGAAACAG60140
R: AGCATCGCTCCCAAGAAGTC
GHRF: GCGTGTTCAGGAGCAAAGCT60121
R: TGGGACAGGCATTTCCATACTT
IGF-1F: GCTTTTGTGATTTCTTGAAGGTGAA61195
R: CATACCCTGTAGGCTTACTGAAGTA64
β-actinF: CCGCAAATGCTTCTAAACCG58101
R: AAAGCCATGCCAATCTCGTC
GAPDHF: GGCACGCCATCACTATC5561
R: CCTGCATCTGCCCATTT52
GHF: AACGCACCTATATTCCGGAGG61158
R: AAGCAGCTCCATGTCTGACTTCT63
GHRH, growth hormone-releasing hormone; GHR, growth hormone receptor; IGF-1, insulin-like growth factor 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GH, growth hormone; Tm, melting temperature; bp, base pairs; F, forward primer; R, reverse primer.
Table 4. Effect of β-glucan supplementation on body weight (BW), feed intake (FI), and feed conversion ratio (FCR) of broiler birds over 35 d of age.
Table 4. Effect of β-glucan supplementation on body weight (BW), feed intake (FI), and feed conversion ratio (FCR) of broiler birds over 35 d of age.
ParametersControl250 mg1 gp-Value
Initial BW (g)47.3 ± 0.347.4 ± 0.348 ± 0.30.3015
BW (g)2217.1 ± 44.7 b2239.2 ± 50.3 b2393.4 ± 32.8 a0.0175
FI/bird (g)3411.1 ± 108.53530.4 ± 94.13704.0 ± 45.90.0743
FCR1.6 ± 0.031.6 ± 0.011.5 ± 0.030.1558
Data are presented as means ± SEM. Different superscript letters denote significant differences among treatments (p < 0.05; Student’s t-test).
Table 5. Effect of β-glucan supplementation on BW and breast muscle development at 17 and 35 d of age.
Table 5. Effect of β-glucan supplementation on BW and breast muscle development at 17 and 35 d of age.
ParametersControl250 mg1 gp-Value
BW 17 d (g)623.5 ± 19.4 b672.0 ± 14.9 ab683.5 ± 18.3 a0.0463
Breast muscle weight 17 d (g)48.1 ± 2.3 b54.5 ± 1.6 a55.7 ± 1.6 a0.012
Relative breast muscle weight (%)7.6 ± 0.2 b8.1 ± 0.1 a8.2 ± 0.1 a0.0266
BW 35 d (g)2238.1 ± 70.3 b2278.2 ± 68.6 ab2445.6 ± 52.6 a0.0336
Breast muscle weight 35 d (g)256.1 ± 9.6 b269.1 ± 10.4 ab294.9 ± 7.3 a0.0218
Relative breast muscle weight (%)11.4 ± 0.2 b11.8 ± 0.2 ab12.1 ± 0.2 a0.0203
Data are presented as means ± SEM. Different superscript letters denote significant differences among treatments (p < 0.05; Student’s t-test). Relative weights are expressed as a percentage of live body weight.
Table 6. Effect of β-glucan supplementation on plasma GH and prolactin (PRL) levels (values averaged across the experimental period).
Table 6. Effect of β-glucan supplementation on plasma GH and prolactin (PRL) levels (values averaged across the experimental period).
ParametersControl250 mg1 gp-Value
Plasma GH (ng/mL)6.0 ± 0.6 b8.6 ± 0.6 a7.7 ± 0.6 ab0.0157
Plasma PRL (ng/mL)5.9 ± 0.3 b7.1 ± 0.4 a7.1 ± 0.4 a0.0165
Values are means ± SEM. Different superscript letters indicate significant differences among treatments (p < 0.05; Student’s t-test).
Table 7. Effect of β-glucan supplementation on the expression of growth-related genes (GHRH, GH, GHR, IGF-1) in liver and breast muscle of broiler birds.
Table 7. Effect of β-glucan supplementation on the expression of growth-related genes (GHRH, GH, GHR, IGF-1) in liver and breast muscle of broiler birds.
ParametersControl250 mg1 gp-Value
GHRH, hypothalamus 17 d10.7 ± 1.112.2 ± 0.812.1 ± 0.80.506
GHRH, hypothalamus 35 d5.8 ± 1.37.5 ± 0.99.4 ± 1.20.123
GH, pituitary 17 d7189.3 ± 462.37594.8 ± 1054.27722.3 ± 484.30.8665
GH, pituitary 35 d3002.7 ± 373.13184.6 ± 404.04075.9 ± 578.80.2634
GHR, breast muscle 17 d131.7 ± 15.7155.6 ± 11.2129.7 ± 10.70.7629
GHR, breast muscle 35 d32.3 ± 4.8 b56.6 ± 6.1 a62.6 ± 7.6 a0.0035
GHR, liver 17 d259.7 ± 50.1 ab300.9 ± 22.3 a198.8 ± 16.3 b0.0127
GHR, liver 35 d584.7 ± 66.7636.4 ± 68.5763.9 ± 68.20.1859
IGF-1, liver 35 d35.6 ± 2.6 b49.5 ± 3.8 ab58.9 ± 6.5 a0.0071
Data presented as means ± SEM (arbitrary units from 2−ΔCq × 1000; see Section 2.1.6). Different superscript letters denote significant differences among treatments (p < 0.05; Student’s t-test).
Table 8. Effect of β-glucan supplementation on meat quality parameters of broiler breast muscle.
Table 8. Effect of β-glucan supplementation on meat quality parameters of broiler breast muscle.
ParametersControl250 mg1 gp-Value
Breast muscle pH (15 min postmortem)6.54 ± 0.056.50 ± 0.056.54 ± 0.040.7674
Breast muscle pH (72 h postmortem)5.85 ± 0.02 b5.88 ± 0.02 ab5.95 ± 0.02 a0.045
RDL (%)2.5 ± 0.1 a2.17 ± 0.1 ab1.8 ± 0.1 b0.0072
RDL, relative drip loss, expressed as percentage of initial breast muscle weight: [(W1 − W2)/W1] × 100. Data are means ± SEM. Different superscripts indicate significant differences among treatments (p < 0.05; Student’s t-test).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Malachy, L.O.; Schwartz, B.; Avital-Cohen, N.; Gover, O.; Bar-Dagan, H.; Druyan, S.; Bartman, J.; Marco, A.; Tsalik, D.; Rozenboim, I. Dietary β-Glucan Supplementation Enhances Somatotropic Axis Activity, Growth Performance, and Breast Muscle Meat Quality in Ross 308 Broiler Chickens. Appl. Biosci. 2026, 5, 55. https://doi.org/10.3390/applbiosci5030055

AMA Style

Malachy LO, Schwartz B, Avital-Cohen N, Gover O, Bar-Dagan H, Druyan S, Bartman J, Marco A, Tsalik D, Rozenboim I. Dietary β-Glucan Supplementation Enhances Somatotropic Axis Activity, Growth Performance, and Breast Muscle Meat Quality in Ross 308 Broiler Chickens. Applied Biosciences. 2026; 5(3):55. https://doi.org/10.3390/applbiosci5030055

Chicago/Turabian Style

Malachy, Luckas Obanda, Betty Schwartz, Natalie Avital-Cohen, Ofer Gover, Hadar Bar-Dagan, Shelly Druyan, Joanna Bartman, Asaf Marco, Dekel Tsalik, and Israel Rozenboim. 2026. "Dietary β-Glucan Supplementation Enhances Somatotropic Axis Activity, Growth Performance, and Breast Muscle Meat Quality in Ross 308 Broiler Chickens" Applied Biosciences 5, no. 3: 55. https://doi.org/10.3390/applbiosci5030055

APA Style

Malachy, L. O., Schwartz, B., Avital-Cohen, N., Gover, O., Bar-Dagan, H., Druyan, S., Bartman, J., Marco, A., Tsalik, D., & Rozenboim, I. (2026). Dietary β-Glucan Supplementation Enhances Somatotropic Axis Activity, Growth Performance, and Breast Muscle Meat Quality in Ross 308 Broiler Chickens. Applied Biosciences, 5(3), 55. https://doi.org/10.3390/applbiosci5030055

Article Metrics

Back to TopTop