Construction and Immunogenicity Evaluation of Recombinant Adenovirus-Expressing Capsid Protein of Foot-and-Mouth Disease Virus Types O and A
Abstract
1. Introduction
2. Materials and Methods
2.1. Plasmids, Cells, and Animals
2.2. Main Reagents and Consumables
2.3. Construction and Screening of Recombinant Adenoviruses
2.4. Principles of Recombinant Adenovirus Construction
2.5. Recombinant Adenovirus Packaging
2.6. Recombinant Adenovirus Identification
2.6.1. PCR Qualification
2.6.2. Western Blot Analysis
2.6.3. Porcine Source Cell (PK Cell) Infection Test
2.6.4. VP1 Protein Expression Identification—Indirect Immunofluorescence Test (IFA)
2.7. Recombinant Adenovirus Purification
2.8. Recombinant Adenovirus Titer Assay
2.9. Transmission Electron Microscopy
2.10. Immunity of Guinea Pigs
2.11. Guinea Pig Serum FMDV-Specific IgG Antibodies Were Detected
2.12. Cytokines IL-4 and γ-IFN in Guinea Pig Serum
2.13. Statistical Analysis
3. Results
3.1. Identification of the Recombinant Shuttle Vector Digestion
3.2. Construction of Recombinant Adenovirus
3.3. Verification of the Stability of the Recombinant Adenovirus Strains
3.4. Identification of Recombinant Adenovirus Protein Expression
3.5. FMDV Recombinant Adenovirus PK Cell Infection Assay and Indirect Immunofluorescence Identification
3.6. Recombinant Adenovirus Particle Detection with Transmission Electron Microscopy
3.7. Level of Serum Antibodies in Guinea Pigs after Immunization
3.8. Post-Guinea Pig Immune Cytokine IFN-γ and IL-4 Levels
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Grubman, M.J.; Baxt, B. Foot-and-Mouth Disease. Clin. Microbiol. Rev. 2004, 17, 465–493. [Google Scholar] [CrossRef] [PubMed]
- Carrillo, C.; Tulman, E.R.; Delhon, G.; Lu, Z.; Carreno, A.; Vagnozzi, A.; Kutish, G.F.; Rock, D.L. Comparative Genomics of Foot-and-Mouth Disease Virus. J. Virol. 2005, 79, 6487–6504. [Google Scholar] [CrossRef]
- Gao, Y.; Sun, S.Q.; Guo, H.C. Biological function of Foot-and-mouth disease virus non-structural proteins and non-coding elements. Virol. J. 2016, 13, 107. [Google Scholar] [CrossRef] [PubMed]
- Rueckert, R.R.; Wimmer, E. Systematic nomenclature of picornavirus proteins. J. Virol. 1984, 50, 957–959. [Google Scholar] [CrossRef]
- Knowles, N.J.; Samuel, A.R. Molecular epidemiology of foot-and-mouth disease virus. Virus Res. 2003, 91, 65–80. [Google Scholar] [CrossRef] [PubMed]
- Mohapatra, J.K.; Subramaniam, S.; Pandey, L.K.; Pawar, S.S.; De, A.; Das, B.; Sanyal, A.; Pattnaik, B. Phylogenetic structure of serotype a foot-and-mouth disease virus: Global diversity and the Indian perspective. J. Gen. Virol. 2011, 92 Pt 4, 873–879. [Google Scholar] [CrossRef]
- Jamal, S.M.; Belsham, G.J. Foot-and-mouth disease: Past, present and future. Vet. Res. 2013, 44, 116. [Google Scholar] [CrossRef]
- Senthilkumaran, C.; Yang, M.; Bittner, H.; Ambagala, A.; Lung, O.; Zimmerman, J.; Giménez-Lirola, L.G.; Nfon, C. Detection of genome, antigen, and antibodies in oral fluids from pigs infected with foot-and-mouth disease virus. Can. J. Vet. Res. 2017, 81, 82–90. [Google Scholar]
- Mignaqui, A.C.; Ferella, A.; Cass, B.; Mukankurayija, L.; L’Abbé, D.; Bisson, L.; Sánchez, C.; Scian, R.; Cardillo, S.B.; Durocher, Y.; et al. Foot-and-Mouth Disease: Optimization, Reproducibility, and Scalability of High-Yield Production of Virus-Like Particles for a Next-Generation Vaccine. Front. Vet. Sci. 2020, 7, 601. [Google Scholar] [CrossRef]
- Diab, E.; Bazid, A.-H.I.; Fawzy, M.; El-Ashmawy, W.R.; Fayed, A.A.; El-Sayed, M.M. Foot-and-mouth disease outbreaks in Egypt during 2013–2014: Molecular characterization of serotypes A, O, and SAT2. Vet. World. 2019, 12, 190–197. [Google Scholar] [CrossRef]
- Brito, B.P.; Rodriguez, L.L.; Hammond, J.M.; Pinto, J.; Perez, A.M. Review of the global distribution of foot-and-mouth disease virus from 2007 to 2014. Transbound. Emerg. Dis. 2017, 64, 149–161. [Google Scholar] [CrossRef]
- World Organisation for Animal Health (OIE). Foot and Mouth Disease; Chapter 8.8; World Organisation for Animal Health: Paris, France, 2017; Available online: http://www.oie.int/fileadmin/Home/eng/Health (accessed on 1 April 2023).
- Muleme, M.; Barigye, R.; Khaitsa, M.L.; Berry, E.; Wamono, A.W.; Ayebazibwe, C. Effectiveness of vaccines and vaccination programs for the control of foot-and-mouth disease in Uganda, 2001–2010. Trop. Anim. Health Prod. 2013, 45, 35–43. [Google Scholar] [CrossRef] [PubMed]
- Dubey, P. Gene therapy using adenovirus vector. J. Mol. Biomark. Diagn. 2021, 12, 480. [Google Scholar]
- Tatsis, N.; Ertl, H.C. Adenoviruses as vaccine vectors. Mol. Ther. 2004, 10, 616–629. [Google Scholar] [CrossRef] [PubMed]
- Lasaro, M.O.; Ertl, H.C. New Insights on Adenovirus as Vaccine Vectors. Mol. Ther. 2009, 17, 1333–1339. [Google Scholar] [CrossRef]
- Mayr, G.A.; Chinsangaram, J.; Grubman, M.J. Development of replication-defective adenovirus serotype 5 containing the capsid and 3C protease coding regions of foot-and-mouth disease virus as a vaccine candidate. Virology. 1999, 263, 496–506. [Google Scholar] [CrossRef]
- Barrera, J.; Brake, D.A.; Schutta, C.; Ettyreddy, D.; Kamicker, B.J.; Rasmussen, M.V.; de Rueda, C.B.; Zurita, M.; Pisano, M.; Hurtle, W.; et al. Versatility of the adenovirus-vectored foot-and-mouth disease vaccine platform across multiple foot-and-mouth disease virus serotypes and topotypes using a vaccine dose representative of the AdtA24 conditionally licensed vaccine. Vaccine. 2018, 36, 7345–7352. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Liu, M.; Jiao, Y.; Yan, W.; Wei, X.; Chen, J.; Fei, L.; Liu, Y.; Zuo, X.; Yang, F.; et al. Adenovirus-mediated RNA interference against foot-and-mouth disease virus infection both in vitro and in vivo. J. Virol. 2006, 80, 3559–3566. [Google Scholar] [CrossRef] [PubMed]
- Fernandez-Sainz, I.; Medina, G.N.; Ramirez-Medina, E.; Koster, M.J.; Grubman, M.J.; de Los Santos, T. Adenovirus-vectored foot-and-mouth disease vaccine confers early and full protection against FMDV O1 Manisa in swine. Virology. 2017, 502, 123–132. [Google Scholar] [CrossRef] [PubMed]
- Zhu, F.C.; Li, Y.H.; Guan, X.H.; Hou, L.H.; Wang, W.J.; Li, J.X.; Wu, S.P.; Wang, B.S.; Wang, Z.; Wang, L.; et al. Safety, tolerability, and immunogenicity of a recombinant adenovirus type-5 vectored COVID-19 vaccine: A dose-escalation, open-label, non-randomised, first-in-human trial. Lancet 2020, 395, 1845–1854. [Google Scholar] [CrossRef]
- Park, J.H.; Lee, K.N.; Ko, Y.J.; Kim, S.M.; Lee, H.S.; Shin, Y.K.; Sohn, H.J.; Park, J.Y.; Yeh, J.Y.; Lee, Y.H.; et al. Control of Foot-and-Mouth Disease during 2010–2011 Epidemic, South Korea. Emerg. Infect. Dis. 2013, 19, 655–659. [Google Scholar] [CrossRef] [PubMed]
- Valdazo-González, B.; Timina, A.; Scherbakov, A.; Abdul-Hamid, N.F.; Knowles, N.J.; King, D.P. Multiple introductions of serotype O foot-and-mouth disease viruses into East Asia in 2010–2011. Vet. Res. 2013, 44, 76. [Google Scholar] [CrossRef]
- Caridi, F.; Vázquez-Calvo, Á.; Borrego, B.; McCullough, K.; Summerfield, A.; Sobrino, F.; Martin-Acebes, M.A. Preserved immunogenicity of an inactivated vaccine based on foot-and-mouth disease virus particles with improved stability. Vet. Microbiol. 2017, 203, 275–279. [Google Scholar] [CrossRef] [PubMed]
- Kumar, R.; Ba Sagoudanavar, S.H.; Sreenivasa, B.P. Detection of replication competent adenovirus upon serial passaging of recombinant adenovirus expressing FMDV capsid proteins. Biologicals 2015, 43, 209–212. [Google Scholar] [CrossRef] [PubMed]
- Xie, Y.; Gao, P.; Li, Z. A Recombinant Adenovirus Expressing P12A and 3C Protein of the Type O Foot-and-Mouth Disease Virus Stimulates Systemic and Mucosal Immune Responses in Mice. BioMed Res. Int. 2016, 2016, 7849203. [Google Scholar] [CrossRef]
- Luo, Z.; Fu, X.; Wang, Y. Effect of Attenuated Highly Pathogenic Pig Reproductive and Respiratory Syndrome (HP-PRRS) TJM-F92 Strain Vaccine on Immune Antibody Levels against lassical Swine Fever (CSF) and Foot-and-Mouth Disease (FMD). Anim. Husb. Feed. Sci. 2016, 8, 162–164. [Google Scholar]
- Zhou, G.; Wang, H.; Wang, F.; Yu, L. Recombinant adenovirus expressing type Asia1 foot-and-mouth disease virus capsid proteins induces protective immunity against homologous virus challenge in mice. Res. Vet. Sci. 2013, 94, 796–802. [Google Scholar] [CrossRef] [PubMed]
- Pan, J.; Shi, H.; Luo, X.; Ma, D.; Liang, W.; Zhang, J.; Zhu, J.; Li, J. Construction of replication-deficient recombinant adenovirus vector with hTFPI-2 gene by AdMax system and expression in U937 monocytes in vitro. J. Biomed. Eng. 2011, 28, 326–331. [Google Scholar]
- Xie, Y.; Chang, H.; Li, Z.; Zhang, Y. Adenovirus-Vectored Capsid Proteins of the Serotype A Foot-and-Mouth Disease Virus Protect Guinea Pigs Against Challenge. Front. Microbiol. 2020, 11, 1449. [Google Scholar] [CrossRef]
- Guo, C.; Zhang, C.; Zheng, H.; Huang, Y. Recombinant adenovirus expression of FMDV P1-2A and 3C protein and its immune response in mice. Res. Vet. Sci. 2013, 95, 736–741. [Google Scholar] [CrossRef]
- Li, H.; Li, Z.; Xie, Y.; Qin, X.; Qi, X.; Sun, P.; Bai, X.; Ma, Y.; Zhang, Z. Novel chimeric foot-and-mouth disease virus-like particles harboring serotype O VP1 protect guinea pigs against challenge. Vet. Microbiol. 2016, 183, 92–96. [Google Scholar] [CrossRef] [PubMed]
- Pena, L.; Moraes, M.P.; Koster, M.; Burrage, T.; Pacheco, J.M.; Diaz-San Segundo, F.; Grubman, M.J. Delivery of a foot-and mouth disease virus empty capsid subunit antigen with nonstructural protein 2B improves protection of swine. Vaccine. 2008, 26, 5689–5699. [Google Scholar] [CrossRef]
- Yi, J.Z.; Liu, M.Q.; Zhu, C.Z.; Zhang, Q.; Sheng, Z.T.; Du, Q.Y.; Yan, W.Y.; Zheng, Z.X. Recombinant Bivalent Vaccine against Foot-and-Mouth Disease Virus Serotype O/A Infection in Guinea Pig. Acta Biochim. Biophys. Sin. 2004, 36, 589–596. [Google Scholar] [CrossRef] [PubMed]
- Lei, Y.; Shao, J.; Zhao, F.; Li, Y.; Lei, C.; Ma, F.; Chang, H.; Zhang, Y. Artificially designed hepatitis B virus core particles composed of multiple epitopes of type A and O foot-and-mouth disease virus as a bivalent vaccine candidate. J. Med. Virol. 2019, 91, 2142–2152. [Google Scholar] [CrossRef]
- Chinsangaram, J.; Moraes, M.P.; Koster, M.; Grubman, M.J. Novel viral disease control strategy: Adenovirus expressing alpha interferon rapidly protects swine from foot-and-mouth disease. J. Virol. 2003, 77, 1621–1625. [Google Scholar] [CrossRef]
- Wu, Q.; Brum, M.C.S.; Caron, L.; Koster, M.; Grubman, M.J. Adenovirus-mediated type I interferon expression delays and reduces disease signs in cattle challenged with foot-and-mouth disease virus. J. Interf. Cytokine Res. 2003, 23, 359–368. [Google Scholar] [CrossRef] [PubMed]









| Primer Name | Sequence (5′–3′) | Size (bp) |
|---|---|---|
| P12A-F | ATGCGGCCGCGCCGCCACCATGGGCGCCGGGCAATCCAGCCCGACC | 46 |
| P12A-R | AGTGGCCCAGCGTACCCAGGGTTGGACTCAAC | 32 |
| 3BC-F | TGAGTCCAACCCTGGGTACGCTGGGCCACT | 30 |
| 3BC-R | AAGCTTAAGTCACTCGTGGTGTGGTTCGGGGTCG | 34 |
| Groups a | Designation | Dose b | First Vaccination Days | Second Vaccination Days | Third Vaccination Days |
|---|---|---|---|---|---|
| G1 | PBS | 500 μL | 0 | 14 | 28 |
| G2 | WtAdv | 1 × 107.8 TCID50 | 0 | 14 | 28 |
| G3 | rAdv-P12A3B3C-OZK93 | 1 × 107.8 TCID50 | 0 | 14 | 28 |
| G4 | rAdv-P12A3B3C-AF72 | 1 × 107.8 TCID50 | 0 | 14 | 28 |
| G5 | rAdv-P12A3B3C-OA58 | 1 × 107.8 TCID50 | 0 | 14 | 28 |
| G6 | rAdv-P12A3B3C-O: A 5:5 | 1 × 107.8 TCID50 | 0 | 14 | 28 |
| G7 | rAdv-P12A3B3C-O: A 6:4 | 1 × 107.8 TCID50 | 0 | 14 | 28 |
| G8 | rAdv-P12A3B3C-O: A 7:3 | 1 × 107.8 TCID50 | 0 | 14 | 28 |
| G9 | Inactivated vaccine c | 500 μL | 0 | 14 | 28 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, C.; Zhang, L.; Yu, R.; Zhou, P.; Zhang, Z.; Miao, X.; Li, M.; Lv, J.; Pan, L.; Wang, Y.; et al. Construction and Immunogenicity Evaluation of Recombinant Adenovirus-Expressing Capsid Protein of Foot-and-Mouth Disease Virus Types O and A. Zoonotic Dis. 2023, 3, 104-119. https://doi.org/10.3390/zoonoticdis3020010
Wang C, Zhang L, Yu R, Zhou P, Zhang Z, Miao X, Li M, Lv J, Pan L, Wang Y, et al. Construction and Immunogenicity Evaluation of Recombinant Adenovirus-Expressing Capsid Protein of Foot-and-Mouth Disease Virus Types O and A. Zoonotic Diseases. 2023; 3(2):104-119. https://doi.org/10.3390/zoonoticdis3020010
Chicago/Turabian StyleWang, Cancan, Liping Zhang, Ruiming Yu, Peng Zhou, Zhongwang Zhang, Xin Miao, Mingxia Li, Jianliang Lv, Li Pan, Yonglu Wang, and et al. 2023. "Construction and Immunogenicity Evaluation of Recombinant Adenovirus-Expressing Capsid Protein of Foot-and-Mouth Disease Virus Types O and A" Zoonotic Diseases 3, no. 2: 104-119. https://doi.org/10.3390/zoonoticdis3020010
APA StyleWang, C., Zhang, L., Yu, R., Zhou, P., Zhang, Z., Miao, X., Li, M., Lv, J., Pan, L., Wang, Y., & Liu, X. (2023). Construction and Immunogenicity Evaluation of Recombinant Adenovirus-Expressing Capsid Protein of Foot-and-Mouth Disease Virus Types O and A. Zoonotic Diseases, 3(2), 104-119. https://doi.org/10.3390/zoonoticdis3020010

