Next Article in Journal
When Does a Journal Stop Being a New Journal?
Next Article in Special Issue
Perceptions, Knowledge, and Attitudes of Communal Farmers Toward Tick-Borne Diseases: Review of South African Case Studies
Previous Article in Journal
Knowledge and Awareness of Bovine Fasciolosis Among Dairy Farm Personnel in the Eastern Cape Province, South Africa
Previous Article in Special Issue
Human Impact on the Composition of Small-Intestine Helminth Infracommunities in Canine Mesocarnivores, with a Special Focus on Echinococcus multilocularis
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Intestinal Microbial Eukaryotes at the Human, Animal and Environment Interface in Rural Iraq

by
Yaseen Majid Salman Al-Adilee
1,2,
Maulood M. Shather
3,
Dalia A. Kalef
3,
Sadiya Maxamhud
1,
Eylem Akdur Öztürk
4,
Eleni Gentekaki
5,* and
Anastasios D. Tsaousis
1,*
1
Laboratory of Molecular and Evolutionary Parasitology, School of Natural Sciences, University of Kent, Canterbury CT2 7NJ, UK
2
Department of Medical Microbiology, College of Medicine, Ninevah University, Ninevah, Iraq
3
Department of Parasitology, College of Veterinary Medicine, University of Baghdad, Baghdad City, Iraq
4
Department of Parasitology, Faculty of Medicine, Cukurova University, Sarçam, Adana 01330, Turkey
5
Department of Veterinary Medicine, School of Veterinary Medicine, University of Nicosia, Nicosia 2408, Cyprus
*
Authors to whom correspondence should be addressed.
Parasitologia 2025, 5(3), 34; https://doi.org/10.3390/parasitologia5030034
Submission received: 19 May 2025 / Revised: 10 June 2025 / Accepted: 1 July 2025 / Published: 9 July 2025
(This article belongs to the Special Issue Parasites Circulation Between the Three Domains of One Health)

Abstract

Intestinal microbial eukaryotic parasites represent a significant public and veterinary health burden, especially in low- and middle-income countries, yet their transmission dynamics at the human–animal–environment interface remain poorly characterized in certain countries. This study investigated the prevalence and genetic diversity of key microbial eukaryotes, including Cryptosporidium spp., Giardia duodenalis, Blastocystis spp., Entamoeba histolytica, and Enterocytozoon bieneusi, in a rural village in Iraq. Samples collected from humans (n = 50), livestock (sheep and goats, n = 50), water (n = 20), and soil (n = 20) were analysed using microscopy and molecular methods (qPCR and nested PCR). Blastocystis spp. (78% animals, 16% humans, 45% soil, 5% water) and Cryptosporidium spp. (26% animals, 12% humans, 5% soil, 15% water) were the most frequently found microeukaryotes using either microscopy and/or molecular detection. Molecular methods identified Cryptosporidium parvum in humans and sheep, hinting at zoonotic transmission potential. Enterocytozoon bieneusi and Giardia were also found. Cryptosporidium ubiquitum and E. bieneusi genotypes BEB6 and COS-I, respectively, were detected exclusively in sheep, suggesting roles as potential reservoirs. Blastocystis ST1 was detected in humans, while ST4 and ST10 occurred in sheep. Notably, molecular detection rates of Blastocystis were much lower than those of microscopy. Entamoeba histolytica was not detected. The detection of the same organisms in humans, animals and the environment suggest zoonotic and environmental transmission pathways, which warrant further investigation using the One Health approach.

1. Introduction

Intestinal microbial eukaryotic (protozoan) parasites are globally significant pathogens, causing considerable morbidity in humans and livestock, particularly in low- and middle-income countries (LMICs) [1]. These organisms, including Cryptosporidium spp., Giardia duodenalis, Entamoeba histolytica, and Enterocytozoon bieneusi, contribute substantially to diarrheal disease, malnutrition, and economic losses in affected communities [2,3]. Beyond their clinical and veterinary impact, these parasites also pose an economic burden due to livestock losses and reduced productivity [4,5].
Cryptosporidium spp. and Giardia duodenalis are known zoonotic agents, frequently transmitted between humans and animals via the faecal–oral route, often through contaminated water or food [6]. Entamoeba histolytica is one of the few invasive amoebae and remains a major cause of dysentery worldwide [7]. Meanwhile, Blastocystis, a genetically diverse organism whose pathogenicity remains controversial, has been gained increasing attention in recent years due to its high prevalence in both healthy and symptomatic individuals, and potential associations with a healthy gut microbiome [8]. Finally, E. bieneusi is an emerging microsporidian parasite found in various hosts, including humans, and is particularly problematic in immuno-compromised individuals [9].
While these eukaryotic microbes have been studied globally, investigations in Iraq remain limited, with most relying on microscopy-based methods [10]. Studies based on molecular methods are scarce, particularly for Blastocystis and E. bieneusi. Prior reports have documented these microbial eukaryotes in humans and animals in Iraq, but knowledge on their epidemiology and diversity remains limited [11,12].
To bridge these gaps, the current study employed both microscopic and molecular diagnostic methods to investigate the occurrence, genetic diversity, environmental contamination and potential zoonotic transmission of intestinal eukaryotic parasites between humans and small ruminants in a rural village in Iraq.

2. Materials and Methods

2.1. Ethics

The ethics committee (ACUC) at the University of Baghdad approved this study on 16 March 2022 under the project “One Health Approach—Iraq” (No.D.A.672).

2.2. Study Area

The study took place at Alissma village, which is located in the northeastern part of Iraq, near the border with Iran (Figure 1). Approximately 1000 individuals reside in this village. The nearest city (Mandli) is about 30 km away. The village is in a semi-desert area with nearly no tree cover, devoid of ponds and lakes. Oil River runs through the village in the winter, but its water is unfit for drinking and is used solely for irrigation purposes. Groundwater wells and underground well water are typically used for drinking after filtration and purification. The village latrines are basic and located outside of the household.

2.3. Sample Collection

The methodology used herein is graphically summarized (Figure 2). A total of 140 samples were collected between February 2022 and July 2022, each one comprising a singular sample for each participant in the study for humans and animals. Fifty of these were stool samples collected from humans. The participants did not have diarrhoea or other gastrointestinal symptoms and were not taking antibiotics and antiparasitic treatment at the time of sampling, with the exception of four participants, who had been diagnosed by a physician as having colitis. During sample collection, questionnaires were administered, and information about age, gender, type of drinking water, antibiotics, pets, career, and chronic disease was recorded.
Moreover, 50 samples were collected from animals, namely from goats (n = 15) and sheep (n = 35). These animals grazed near the village and drank unfiltered well water. None of the animals had diarrhoea at the time, and the animal faecal samples were collected directly from the rectal ampulla.
Additionally, 20 water samples were collected from sources used by both humans and animals in 5 mL plastic tubes. These included filtered drinking water (n = 5), tap water (n = 5), well water (n = 5), and river water (n = 5). Twenty soil samples were also collected. These included home garden soil (n = 5), field soil (n = 5), animal grazing field soil (n = 5), and river edge soil (n = 5). Five grams of soil were collected in plastic tubes after scraping five centimetres of soil surface.

2.4. Microscopic Examination

All samples were examined microscopically using wet mount smears. Iodine staining was used for the human and animal faecal samples. The flotation method was also used in this study as follows: 5 g of stool was diluted in 20 mL of distilled water and filtered using clean gauze to remove the faecal debris. 5 mL of the mixture was combined with 10 mL of saturated NaCl (40 g of salt in 100 mL of water), and placed into a 15 mL centrifuge tube until a convex meniscus was obtained, in which the liquid curved upwards. The meniscus was then covered with a coverslip. After standing for 15 to 20 min to allow lighter parasitic cysts or oocysts to float, the coverslip was gently removed and examined using a microscope (Olympus Corporation, Tokyo, Japan) with the 10×, 40×, and 100× objective lenses [13].

2.5. DNA Extraction and Molecular Detection

For DNA extraction, 200 mg of each faecal and soil sample was used using the PureLink™ Microbiome Genomic DNA Purification Kit (Invitrogen, Thermo Fisher Scientific, Waltham, CA, USA) according to the manufacturer’s protocol. The extracted DNA was used for qPCR and nested PCR (Table 1).
Herein, we screened samples for Blastocystis sp., Cryptosporidium spp., Entamoeba histolytica, Giardia duodenalis and E. bieneusi. The SSU rRNA gene was used to identify Cryptosporidium spp. and gp60 was used for Cryptosporidium parvum subtyping. For Blastocystis spp., SSU rRNA was used; beta-giardin (bg) and triosephosphate isomerase (tpi) for Giardia; and internal transcribed spacer (ITS) for E. bieneusi. A positive and negative control were included in each PCR run. The reaction conditions differed according to parasite and genetic marker (Table 1). Probe-based qPCR was used to amplify a fragment of the SSU rRNA of G. duodenalis and E. histolytica. The positive PCR products were purified using a Thermo Scientific GeneJET Gel Extraction Kit (Thermo Fisher Scientific, Waltham, CA, USA) according to the manufacturer’s protocol. The methodology used in this study was undertaken according to previous investigations [14,15].
Table 1. Parasites, genes, primer sequences, amplification procedures, and the expected fragment size (bp), which were used in the study.
Table 1. Parasites, genes, primer sequences, amplification procedures, and the expected fragment size (bp), which were used in the study.
Parasite of InterestTarget GeneDetection MethodPrimer Sequences (5′-3′)Amplification ConditionAmplicon Size (bp)References
Cryptosporidium spp.SSUnPCRCRY-SSU-F1: GATTAAGCCATGCATGTCTAA95 °C: 2 min; 24 cycles:
94 °C: 50 s
53 °C: 50 s
72 °C: 1 min
72 °C: 10 min
723 bp[14,16]
CRY-SSU-R1: CTTGAATACTCCAGCATGGAA
CRY-SSU- F2: CAGTTATAGTTTACTTGATAATC94 °C: 2 min; 30 cycles: 94 °C: 50 s
56 °C: 30 s
72 °C: 1 min
72 °C: 10 min
631 bp
CRY-SSU- R2: GAAAATTAGAGTGCTTAAAGCAGG
GP60nPCRF1: AL3531: ATAGTCTCCGCTGTATTC94 °C: 3 min; 35 cycles:
94 °C: 45 s
50 °C: 45 s
72 °C: 1 min
72 °C: 7 min
1000 bp[16,17]
R1: AL3535: GCAAGGAACGATGTATCT
F2 AL3532: TCCGCTGTATTCTCAGCC94 °C: 3 min; 35 cycles:
94 °C: 45 s
50 °C: 45 s
72 °C: 1 min
72 °C: 7 min
850 bp
R2 AL3534: GCAGAGGAACCAGCATC
Giardia duodenalisSSUqPCRGIARDIA-80-F: GACGGCTCAGGACAACGGTT95 °C: 2 min; 50 cycles:
95 °C: 15 s
58 °C: 30 s
72 °C: 30 s
62 bp[14,18,19]
GIARDIA-127-R: TTGCCAGCGGTGTCCG
Probe:
FAM: CCCGCGGCGGTCCCTGCTAG
Bg beta-giardinnPCRF1(G7F): AAGCCCGACCTCACCCGCAGTGC94 °C: 5 min; 35 cycles:
94 °C: 30 s
66 °C: 30 s
72 °C: 1 min
72 °C: 7 min
753 bp[20]
F2(G376): CATAAGGACGCCATCGCGGCTCTGAGG94 °C: 3 min; 30 cycles:
94 °C: 30 s
65 °C: 15 s
72 °C: 30 s
72 °C: 7 min
292 bp
R (G759R): GAGGCCGCCCTGGATCTTCGAGACGAC
Tpi triosephosphate isomerasenPCRTpi_AL3543_F1: AAAT/IDEOXYL/ATGCCTGGTCG94 °C: 3 min; 35 cycles:
94 °C: 45 s,
50 °C: 35 s
72 °C: 30 s
72 °C: 10 min
530 bp[21]
Tpi_AL3546_R1: CAAACCTT/IDEOXYL/TCCGCAAACC
Tpi_AL3544_F2: CCCTTGATCGG/IDEXYL/GGTAACTT94 °C: 3 min; 35 cycles:
94 °C: 35 s
47 °C: 35 s
72 °C: 30 s
72 °C: 10 min
332 bp
Tpi_AL3545_R2: GTGGCCACCAC/IDEOXYL/CCCGTGCC
Blastocystis
SSU nPCRRD3—F1: GGGATCCTGA TCCTTCCGCAGGTTCACCTAC94 °C: 3 min; 35 cycles: 94 °C: 1 min
60 °C: 1 min
72 °C: 100 s
72 °C: 7 min.
600 bp[15,22]
RD5—R1: GGAAGC TTATCTGGTTGATCCTGCCAGTA
BsRD5F—F2: ATCTGGTTGATCCTGCCAGT94 °C: 3 min; 35 cycle: 94 °C: 1 min
60 °C: 1 min
72 °C: 100 s
72 °C: 10 min
650 bp
BhRDr—R2: GAGCTTTTTAACTGCAACAACG
Entamoeba histolyticaSSUqPCREnd-239F: ATTGTCGTGGCATCCTAACTCA95 °C: 2 min; 50 cycles: 95 °C: 15 s
58 °C: 30 s
72 °C: 30 s
172 bp[19]
End-88R: GCGGACGGCTCATTATAACA
Probe: VIC-TCATTGAATGAATTGGCCATTT′-NFQ
EnterocytozoonbieneusiITS nPCREBITS3: GGTCATAGGGATGAAGAG95 °C 5 min; 35 Cycles:
94 °C: 40 s
53 °C: 45 s
72 °C: 45 s
72 °C: 4 min
435 bp[23,24]
EBITS4: TTCGAGTTCTTTCGCGCTC
EBITS1: GCTCTGAATATCTATGGCT95 °C 5 min; 30 Cycles:
94 °C: 35 s
55 °C: 40 s
72 °C: 40 s
72 °C: 5 min
390 bp
EBITS2.4: ATCGCCGACGGATCCAAGTG

2.6. Sequencing Analysis

The purified positive PCR amplicons were sequenced unidirectionally at Eurofins genomics (Cologne, Germany). The obtained raw reads were trimmed manually at both ends to remove ambiguous bases using SnapGeneViewer v.6.0.2. The acquired sequences were used as queries to perform BLAST version 2.14.1 against the NCBI database. The newly generated nucleotide sequences were submitted to GenBank under accession numbers PV521084, PV521085, PV521086, PV521087, PV504621, PV504622, PV504623, and PV504624.

3. Results

3.1. Light Microscopy

The stool and environmental samples were initially examined using light microscopy. A total of 12% (6/50) of the human samples were positive for Cryptosporidium spp., 16% (8/50) for Blastocystis sp., and 10% (5/50) for G. duodenalis (Table 2, Figure 3). Moreover, 26% (13/50) of the animal samples were positive for Cryptosporidium spp., 78% (39/50) for Blastocystis sp. [4% (8/50) of the Blastocystis sp. were from goats and 70% (35/50) were from sheep] and 8% (4/50) for G. duodenalis from sheep. Regarding the soil samples, 5% (1/20) tested positive for Cryptosporidium spp., and 45% (9/20) for Blastocystis sp. Regarding the water samples, 15% (3/20) were positive for Cryptosporidium spp. and 5% (1/20) for Blastocystis sp.
Giardia duodenalis, Enterocytozoon spp., and Entamoeba histolytica were not detected by microscopy in any of the water or soil samples.

3.2. Molecular Detection

Based on qPCR analysis targeting a fragment of the SSU rRNA gene of G. duodenalis, 30% (15/50) of human samples were positive, 14% (7/50) of animals (all positives were from sheep), and 5% (1/20) of soil samples. Nested PCR of longer bg and tpi gene fragments amplified one of the qPCR positive sheep samples, which belonged to assemblage A.
Using nested PCR, one human sample was found to be positive for C. parvum (gp60 gene) and another for Blastocystis ST1. In animals, Cryptosporidium spp. was detected in 4% (2/50); one sheep sample was positive for Cryptosporidium ubiquitum (SSU rRNA gene) and another for Cryptosporidium parvum (SSU rRNA, gp60 genes). We were not able to subtype the obtained gp60 sequences due to their short length. A proportion of 8% (4/50) of animals were found to be positive for Blastocystis (SSU rRNA gene), one animal with ST4, and three animals with ST10. Finally, 8% (4/50) of animals were positive for E. bieneusi, with three belonging to E. bieneusi genotype BEB6 and one to genotype COS-I.
All samples were negative for Entamoeba histolytica.
Mixed infections were identified in 8% (4/50) of human samples, when combining microscopy and molecular detection methods (Figure 4). This included two samples that tested positive for Giardia duodenalis by molecular detection and Blastocystis sp. by microscopy. One sample was positive for both Cryptosporidium spp. and G. duodenalis by molecular detection, while another sample was positive for Cryptosporidium spp., G. duodenalis, and Blastocystis sp., all detected by molecular methods.
Regarding animal samples, 34% (17/50) had co-infections. Twelve animals were infected with Cryptosporidium spp. and Blastocystis spp. by microscopy-based detection, five with G. duodenalis and Blastocystis spp., this included three samples found positive for G. duodenalis and Blastocystis spp. microscopically, one sample which tested positive for both parasites molecularly and, lastly, one animal that tested positive for mixed infection, both microscopically and molecularly. Moreover, two animal samples tested positive for Blastocystis spp. by microscopy and E. bieneusi by PCR (Table 2).

4. Discussion

This study provides insights into the occurrence and genetic diversity of intestinal protozoan parasites in a rural village in Iraq. It highlights the environmental presence and hence zoonotic potential of Cryptosporidium spp., Giardia duodenalis, Blastocystis spp., and Enterocytozoon bieneusi. Small ruminants are economically important animals in Iraq and are reared primarily on small- and medium-scale herds. Despite this, reports on their intestinal organisms are relatively sparse [25,26]. Herein, the occurrence rate of Cryptosporidium spp. in animals is lower than in previous studies, likely due to the methodologies used or the population examined. The occurrence in sheep was much higher than in goats, matching previous findings in the country [25]. This can be attributed to the free-range nature of goats as opposed to sheep [27]. The detection of Cryptosporidium parvum in both humans and sheep suggests zoonotic transmission within this community. Meanwhile, detection of Cryptosporidium ubiquitum and E. bieneusi in sheep hints at livestock as potential reservoirs for environmental contamination and human infection.
The high prevalence of Blastocystis in both animals and humans align with previous reports [28,29]. There was a notable difference between the detection methods used, with microscopy-based detection identifying many more samples as positive. This is as opposed to molecular methods, with which it was not possible to amplify the corresponding gene fragment. The presence of co-infections, many of which were confirmed microscopically, could be a confounding factor here. While it is not possible to compare these findings to other studies in Iraq, previous molecular studies in neighbouring Iran showed variable Blastocystis occurrence rates, with one as low 5% [30,31]. As this is, to the best of our knowledge, the first molecular detection study of Blastocystis in the country, further studies are needed to shed light on the organism’s epidemiology. This is among the first reports of ST4 in sheep in this region, offering new insights into subtype distribution in the Middle East. The detection of ST4 in sheep is of interest, as this subtype is typically linked to rodents [32,33]. A significant component of wildlife, wild rodents serve as reservoirs for numerous etiological agents, including bacteria, viruses, and microbial eukaryotes like Blastocystis [33,34]. It is likely that wild rodent may spread Blastocystis to livestock, and water sources. These results are important in terms of emphasizing the need to conduct studies on different hosts, including wildlife, to gain knowledge on interspecies transmission dynamics of ST4.
Entamoeba histolytica was not detected in any sample. Nonetheless, Entamoeba spp. has been detected in both microscopic and molecular-based investigations in ruminants in the country [35,36]. This discrepancy may reflect the challenging field conditions that may compromise the detection of E. histolytica.
Given the scarcity of molecular epidemiological studies in Iraq, direct comparisons to previous work are limited. Nonetheless, our findings are in line with some earlier reports, such as the 34% Giardia detection rate by microscopy in humans observed by Al-Hasnawy and Idan [37].
While E. bieneusi infections have been reported in birds in Iraq [38], this study contributes new evidence of its presence in livestock, expanding the known host range in the region.
Several limitations should be acknowledged. One major challenge was preserving and storing samples in a remote field setting, where access to cold-chain infrastructure is limited. Inadequate preservation may have reduced the sensitivity of both microscopy and molecular assays. This could explain certain species’ absence or low detection rates in specific sample types. Additionally, although PCR-based methods were employed, only a subset of positive samples yielded high-quality sequences, limiting the depth of genetic characterization. Environmental samples, in particular, may have contained PCR inhibitors or low DNA concentrations, affecting amplification success. Our findings underline the need for standardized operating procedures for parasite sampling, preservation, and analysis in resource-limited settings. The adoption of field-friendly preservatives compatible with molecular diagnostics, along with optimized DNA extraction protocols for complex environmental matrices, would enhance data quality and comparability [39]. Another limitation of this study is its cross-sectional design, which provides only a single time point and does not capture seasonal trends or temporal changes in infection dynamics. Longitudinal studies incorporating repeated sampling from hosts and environments are needed to clarify transmission pathways, sources of reinfection, and possible seasonal patterns [40].
Despite including asymptomatic individuals and animals, future research should aim to expand the number of sampling sites, include larger sample sizes, and integrate clinical and immunological data. Such approaches would enable a more accurate assessment of the pathogenic potential and health impacts of these parasites.
Looking ahead, the high prevalence of Blastocystis, a common yet enigmatic member of the gut eukaryome, presents a valuable opportunity to study its interaction with the bacterial microbiota and host immune system. Future studies should consider using 16S rRNA sequencing or shotgun metagenomics to explore microbe–parasite interactions, particularly in communities with frequent co-infections [41]. These approaches could inform new strategies for diagnostics, surveillance, and intervention.

5. Conclusions

This study enriches the limited molecular data on intestinal protists (including parasites) in Iraq, offering a comprehensive view of their occurrence in humans, livestock, and the environment. The findings emphasize the importance of enhanced sampling protocols, environmental monitoring, and capacity building to improve parasite detection and control in rural, resource-limited settings.

Author Contributions

Conceptualization, A.D.T., M.M.S. and D.A.K.; methodology, Y.M.S.A.-A. and S.M.; software, Y.M.S.A.-A. and E.G.; validation, Y.M.S.A.-A., E.A.Ö., E.G. and A.D.T.; formal analysis, Y.M.S.A.-A., and E.G.; investigation, Y.M.S.A.-A., E.G. and A.D.T.; resources, A.D.T.; data curation, Y.M.S.A.-A.; writing—original draft preparation, Y.M.S.A.-A.; writing—review and editing, Y.M.S.A.-A., S.M., A.D.T., E.G., M.M.S. and D.A.K.; visualization, Y.M.S.A.-A.; supervision, A.D.T., E.G., M.M.S. and D.A.K. and E.A.Ö.; project administration, A.D.T.; funding acquisition, A.D.T. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki and approved by the University of Baghdad’s Ethical Committee (protocol code No. D.A. 672 and 16 March 2022.” for studies involving humans. The animal study protocol was approved by the Institutional Review Board (or ethics committee) of the University of Baghdad (protocol code No. D.A. 672 and 16 March 2022) for studies involving animals.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Acknowledgments

The authors would like to extend their deepest thanks to the residents and community of Alissma Village for their help and participation in collecting samples, which made this research successful. We also wish to acknowledge the exceptional guidance and support provided by the Parasitology Lab at the University of Baghdad.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Abdoli, A.; Olfatifar, M.; Eslahi, A.V.; Moghadamizad, Z.; Nowak, O.; Pirestani, M.; Karimipour-Saryazdi, A.; Badri, M.; Karanis, P. Prevalence of intestinal protozoan parasites among Asian schoolchildren: A systematic review and meta-analysis. Infection 2024, 52, 2097–2133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Ghebremichael, S.T.; Meng, X.; Yang, Y.; Andegiorgish, A.K.; Wu, Z.; Chen, J.; Wei, J.; Li, T.; Bao, J.; Zhou, Z.; et al. First identification and coinfection detection of Enterocytozoon bieneusi, Encephalitozoon spp., Cryptosporidium spp. and Giardia duodenalis in diarrheic pigs in Southwest China. BMC Microbiol. 2023, 23, 334. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Das, R.; Palit, P.; Haque, A.; Levine, M.M.; Kotloff, K.L.; Nasrin, D.; Hossain, M.J.; Sur, D.; Ahmed, T.; Breiman, R.F.; et al. Symptomatic and asymptomatic enteric protozoan parasitic infection and their association with subsequent growth parameters in under five children in South Asia and sub-Saharan Africa. PLoS Neglected Trop. Dis. 2023, 17, e0011687. [Google Scholar] [CrossRef] [Scilit]
  4. de Graaf, D.C.; Vanopdenbosch, E.; Ortega-Mora, L.M.; Abbassi, H.; E Peeters, J. A review of the importance of cryptosporidiosis in farm animals. Int. J. Parasitol. 1999, 29, 1269–1287. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Gao, H.; Liang, G.; Su, N.; Li, Q.; Wang, D.; Wang, J.; Zhao, L.; Kang, X.; Guo, K. Prevalence and Molecular Characterization of Cryptosporidium spp., Giardia duodenalis, and Enterocytozoon bieneusi in Diarrheic and Non-Diarrheic Calves from Ningxia, Northwestern China. Animals 2023, 13, 1983. [Google Scholar] [CrossRef] [Scilit]
  6. Hsu, C.-H.; Liang, C.; Chi, S.-C.; Lee, K.-J.; Chou, C.-H.; Lin, C.-S.; Yang, W.-Y. An Epidemiological Assessment of Cryptosporidium and Giardia spp. Infection in Pet Animals from Taiwan. Animals 2023, 13, 3373. [Google Scholar] [CrossRef] [Scilit]
  7. Haque, R.; Huston, C.D.; Hughes, M.; Houpt, E.; Petri, W.A. Amebiasis. N. Engl. J. Med. 2003, 348, 1565–1573. [Google Scholar] [CrossRef] [Scilit]
  8. Aykur, M.; Malatyalı, E.; Demirel, F.; Cömert-Koçak, B.; Gentekaki, E.; Tsaousis, A.D.; Dogruman-Al, F. Blastocystis: A Mysterious Member of the Gut Microbiome. Microorganisms 2024, 12, 461. [Google Scholar] [CrossRef] [Scilit]
  9. Mena, C.J.; Garófalo, M.P.; Perazzo, J.; Epelbaum, C.; Castro, G.; Sicilia, P.; Barnes, A.; Guasconi, L.; Burstein, V.L.; Beccacece, I.; et al. Enterocytozoon bieneusi Infection after Hematopoietic Stem Cell Transplant in Child, Argentina. Emerg. Infect. Dis. 2024, 30, 613–616. [Google Scholar] [CrossRef] [Scilit]
  10. Bedair, N.H.; Zeki, I.N. Prevalence of Some Parasitic Infections in Iraq from 2019 to 2020. Iraqi J. Sci. 2023, 64, 3281–3291. [Google Scholar] [CrossRef] [Scilit]
  11. Alberfkani, M.I. Molecular characterization of Blastocystis hominis in irritable bowel syndrome patients and nursing staff in public and private clinic in Iraq. Ann. Parasitol. 2022, 68, 715–720. [Google Scholar]
  12. Hafidh, A.-S.; Aevan, A.-M. Microsporidial infection in some domesticand laboratory animals in Iraq. Int. J. Basic Appl. Med. Sci. 2013, 3, 78–91. [Google Scholar]
  13. Fadl, S.R. Prevalence of Parasitic Infection in Sheep From different Regions in Baghdad. Iraqi J. Veter-Med. 2011, 35, 204–209. [Google Scholar] [CrossRef] [Scilit]
  14. Maxamhud, S.; Reghaissia, N.; Laatamna, A.; Samari, H.; Remdani, N.; Gentekaki, E.; Tsaousis, A.D. Molecular Identification of Cryptosporidium spp., and Giardia duodenalis in Dromedary Camels (Camelus dromedarius) from the Algerian Sahara. Parasitologia 2023, 3, 151–159. [Google Scholar] [CrossRef] [Scilit]
  15. Jinatham, V.; Maxamhud, S.; Popluechai, S.; Tsaousis, A.D.; Gentekaki, E. Blastocystis One Health Approach in a Rural Community of Northern Thailand: Prevalence, Subtypes and Novel Transmission Routes. Front. Microbiol. 2021, 12, 746340. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Lindergard, G.; Nydam, D.V.; Wade, S.E.; Schaaf, S.L.; Mohammed, H.O. The sensitivity of PCR detection of cryptosporidium oocysts in fecal samples using two DNA extraction methods. Mol. Diagn. 2003, 7, 147–153. [Google Scholar] [CrossRef] [PubMed]
  17. Pinto, P.; Ribeiro, C.A.; Hoque, S.; Hammouma, O.; Leruste, H.; Détriché, S.; Canniere, E.; Daandels, Y.; Dellevoet, M.; Roemen, J.; et al. Cross-Border Investigations on the Prevalence and Transmission Dynamics of Cryptosporidium Species in Dairy Cattle Farms in Western Mainland Europe. Microorganisms 2021, 9, 2394. [Google Scholar] [CrossRef] [Scilit]
  18. Hove, R.T.; Schuurman, T.; Kooistra, M.; Möller, L.; van Lieshout, L.; Verweij, J.J. Detection of diarrhoea-causing protozoa in general practice patients in The Netherlands by multiplex real-time PCR. Clin. Microbiol. Infect. 2007, 13, 1001–1007. [Google Scholar] [CrossRef] [Scilit]
  19. Verweij, J.J.; Blangé, R.A.; Templeton, K.; Schinkel, J.; Brienen, E.A.T.; van Rooyen, M.A.A.; van Lieshout, L.; Polderman, A.M. Simultaneous Detection of Entamoeba histolytica, Giardia lamblia, and Cryptosporidium parvum in Fecal Samples by Using Multiplex Real-Time PCR. J. Clin. Microbiol. 2004, 42, 1220–1223. [Google Scholar] [CrossRef] [Scilit]
  20. Cacciò, S.M.; De Giacomo, M.; Pozio, E. Sequence analysis of the β-giardin gene and development of a polymerase chain reaction–restriction fragment length polymorphism assay to genotype Giardia duodenalis cysts from human faecal samples. Int. J. Parasitol. 2002, 32, 1023–1030. [Google Scholar] [CrossRef] [Scilit]
  21. Sulaiman, I.M.; Fayer, R.; Bern, C.; Gilman, R.H.; Trout, J.M.; Schantz, P.M.; Das, P.; Lal, A.A.; Xiao, L. Triosephosphate Isomerase Gene Characterization and Potential Zoonotic Transmission of Giardia duodenalis. Emerg. Infect. Dis. 2003, 9, 1444–1452. [Google Scholar] [CrossRef] [Scilit]
  22. Scicluna, S.M.; Tawari, B.; Clark, C.G. DNA Barcoding of Blastocystis. Protist 2006, 157, 77–85. [Google Scholar] [CrossRef] [Scilit]
  23. Muadica, A.S.; Messa, A.E.; Dashti, A.; Balasegaram, S.; Santin, M.; Manjate, F.; Chirinda, P.; Garrine, M.; Vubil, D.; Acácio, S.; et al. First identification of genotypes of Enterocytozoon bieneusi (Microsporidia) among symptomatic and asymptomatic children in Mozambique. PLoS Neglected Trop. Dis. 2020, 14, e0008419. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Buckholt, M.A.; Lee, J.H.; Tzipori, S. Prevalence of Enterocytozoon bieneusi in swine: An 18-month survey at a slaughter-house in Massachusetts. Appl. Environ. Microbiol. 2002, 68, 2595–2599. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Hraiga, B.A. Investigation of Cryptosporidium infection in Lambs and Goat Kids at Al-kut city, wasit province. J. Health Med. Nurs. 2017, 43, 130–134. [Google Scholar]
  26. Alkhaled, M.J.A. Molecular characterization of Cryptosporidium spp. in sheep and goat in Al-Qadisiyah province/Iraq. Iraqi J. Veter-Med. 2017, 41, 31–37. [Google Scholar] [CrossRef] [Scilit]
  27. Hatam-Nahavandi, K.; Ahmadpour, E.; Carmena, D.; Spotin, A.; Bangoura, B.; Xiao, L. Cryptosporidium infections in terrestrial ungulates with focus on livestock: A systematic review and meta-analysis. Parasites Vectors 2019, 12, 453. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Rehena, J.; Bin Harun, A.; Karim, R. Epidemiology of Blastocystis in farm animals: A review. Veter-Parasitol. 2024, 334, 110382. [Google Scholar] [CrossRef] [Scilit]
  29. Salehi, R.; Haghighi, A.; Stensvold, C.R.; Kheirandish, F.; Azargashb, E.; Raeghi, S.; Kohansal, C.; Bahrami, F. Prevalence and subtype identification of Blastocystis isolated from humans in Ahvaz, Southwestern Iran. Gastroenterol. Hepatol. Bed Bench 2017, 10, 235. [Google Scholar] [CrossRef]
  30. Hatam-Nahavandi, K.; Rahimi, H.M.; Rezaeian, M.; Ahmadpour, E.; Badri, M.; Mirjalali, H. Detection and molecular characterization of Blastocystis sp., Enterocytozoon bieneusi and Giardia duodenalis in asymptomatic animals in southeastern Iran. Sci. Rep. 2025, 15, 6143. [Google Scholar] [CrossRef] [Scilit]
  31. Mohammadpour, I.; Bozorg-Ghalati, F.; Gazzonis, A.L.; Manfredi, M.T.; Motazedian, M.H.; Mohammadpour, N. First molecular subtyping and phylogeny of Blastocystis sp. isolated from domestic and synanthropic animals (dogs, cats and brown rats) in southern Iran. Parasit Vectors 2020, 13, 365. [Google Scholar] [CrossRef] [Scilit]
  32. Shan, F.; Wang, F.; Chang, S.; Wang, N.; Liu, Y.; Chen, X.; Zhao, G.; Zhang, L. Predominance of the Blastocystis subtype ST5 among free-living sympatric rodents within pig farms in China suggests a novel transmission route from farms. One Health 2024, 18, 100723. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Tsai, K.-H.; Yen, T.-Y.; Tung, H.-H.; Ho, A.; Chien, Y.-T.; Wang, C.-Y.; Kang, S.-W.; Juan, N.-N.; Lin, F.-L. Surveillance of Emerging Rodent-Borne Pathogens in Wastewater in Taiwan: A One Health Approach. Trop. Med. Infect. Dis. 2024, 9, 282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Shams, M.; Bahrami, A.M.; Mousivand, A.; Shamsi, L.; Asghari, A.; Shahabi, S.; Sadrebazzaz, A. First molecular characterization of Blastocystis subtypes from domestic animals (sheep and cattle) and their animal-keepers in Ilam, western Iran: A zoonotic concern. J. Eukaryot. Microbiol. 2024, 71, e13019. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Kadhum, R.W.; Jaber, N.; Al-Asadi, H.; Abbas, Z.; Al-Maliki, J. Study the prevalence of entamoeba species in children and farm animals in waist province. Web Sci. Sch. J. Multidiscip. Res. 2022, 2, 14–23. [Google Scholar]
  36. Al-Dabbagh, S.M.K.; Alseady, H.H.; Alhadad, E.J. Molecular identification of Entamoeba spp. in humans and cattle in Baghdad, Iraq. Veter-World 2024, 17, 1348–1355. [Google Scholar] [CrossRef] [Scilit]
  37. Idan, S.R.; Al-Hasnawy, M.H. Microscopic and Molecular Diagnosis of Giardia Duodenalis in Human in Babylon Province, Iraq. Int. J. Pharm. Bio-Med. Sci. 2023, 3, 320–327. [Google Scholar] [CrossRef] [Scilit]
  38. Abdullah, D.A.; Alobaidii, W.A.; Alkateb, Y.N.M.; Ali, F.F.; Ola-Fadunsin, S.D.; Gimba, F.I. Molecular detection and prevalence of human-pathologic Enterocytozoon bieneusi among pet birds in Mosul, Iraq. Comp. Immunol. Microbiol. Infect. Dis. 2023, 95, 101964. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Vital, T.P.; Raju, G.P.; Rao, I.S.; Kumar, A.P. Data collection, statistical analysis and machine learning studies of cancer dataset from North Costal Districts of AP, India. Procedia Comput. Sci. 2015, 48, 706–714. [Google Scholar] [CrossRef] [Scilit]
  40. Stensvold, C.R. Blastocystis in stool: Friend, foe or both? J. Travel Med. 2025, 32, taaf011. [Google Scholar] [CrossRef] [Scilit]
  41. Tsaousis, A.D.; Gentekaki, E.; Stensvold, C.R. Advancing research on Blastocystis through a One Health approach. Open Res. Eur. 2024, 4, 145. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Map of Iraq and neighbouring countries. The study area is located in the eastern part of Iraq, within the Diyala Province. The village location is marked with the red pin and lies about 10 km from the Iranian border.
Figure 1. Map of Iraq and neighbouring countries. The study area is located in the eastern part of Iraq, within the Diyala Province. The village location is marked with the red pin and lies about 10 km from the Iranian border.
Parasitologia 05 00034 g001
Figure 2. Methodology summary for the samples and approaches used in the study.
Figure 2. Methodology summary for the samples and approaches used in the study.
Parasitologia 05 00034 g002
Figure 3. Cryptosporidium (A), Blastocystis (B), and Giardia duodenalis (C) from faecal samples.
Figure 3. Cryptosporidium (A), Blastocystis (B), and Giardia duodenalis (C) from faecal samples.
Parasitologia 05 00034 g003
Figure 4. Venn diagram showing the overlap of intestinal protozoan infections among 50 human stool samples. Blastocystis was identified by microscopy, Giardia duodenalis by qPCR, and Cryptosporidium spp. by nested PCR. Only a limited number of co-infections were detected, and no triple infections were observed.
Figure 4. Venn diagram showing the overlap of intestinal protozoan infections among 50 human stool samples. Blastocystis was identified by microscopy, Giardia duodenalis by qPCR, and Cryptosporidium spp. by nested PCR. Only a limited number of co-infections were detected, and no triple infections were observed.
Parasitologia 05 00034 g004
Table 2. Number and percentage of positive samples in the microscopic examination for all sources and parasites used in the study.
Table 2. Number and percentage of positive samples in the microscopic examination for all sources and parasites used in the study.
Type of SourceHumansAnimalsSoilWaterTotal
Name of ParasitesNumber of Positive%Number of Positive%Number of Positive%Number of Positive%Number of Positive%
Cryptosporidium spp.612%1326%15%315%2319.16%
Blastocystis sp.816%3978%945%15%57 47.5%
Goat: 84%
Giardia duodenalis510%48%----97.5%
Total19561048963.57%
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Salman Al-Adilee, Y.M.; Shather, M.M.; Kalef, D.A.; Maxamhud, S.; Akdur Öztürk, E.; Gentekaki, E.; Tsaousis, A.D. Intestinal Microbial Eukaryotes at the Human, Animal and Environment Interface in Rural Iraq. Parasitologia 2025, 5, 34. https://doi.org/10.3390/parasitologia5030034

AMA Style

Salman Al-Adilee YM, Shather MM, Kalef DA, Maxamhud S, Akdur Öztürk E, Gentekaki E, Tsaousis AD. Intestinal Microbial Eukaryotes at the Human, Animal and Environment Interface in Rural Iraq. Parasitologia. 2025; 5(3):34. https://doi.org/10.3390/parasitologia5030034

Chicago/Turabian Style

Salman Al-Adilee, Yaseen Majid, Maulood M. Shather, Dalia A. Kalef, Sadiya Maxamhud, Eylem Akdur Öztürk, Eleni Gentekaki, and Anastasios D. Tsaousis. 2025. "Intestinal Microbial Eukaryotes at the Human, Animal and Environment Interface in Rural Iraq" Parasitologia 5, no. 3: 34. https://doi.org/10.3390/parasitologia5030034

APA Style

Salman Al-Adilee, Y. M., Shather, M. M., Kalef, D. A., Maxamhud, S., Akdur Öztürk, E., Gentekaki, E., & Tsaousis, A. D. (2025). Intestinal Microbial Eukaryotes at the Human, Animal and Environment Interface in Rural Iraq. Parasitologia, 5(3), 34. https://doi.org/10.3390/parasitologia5030034

Article Metrics

Back to TopTop