Abstract
Leptospirosis is an anthropozoonosis disease of worldwide distribution caused by mobile spirochetes of the genus Leptospira and rodents, mainly rats, are described as its primary reservoir. In Algeria, there is limited data about the prevalence of Leptospira spp. in humans and animals, as well as Leptospira carriage in wild rodents. The study aimed to highlight the importance of rodents as a reservoir of Leptospira bacterium in Blida city in Algeria by detecting and identifying circulating Leptospira species in the rodent population. A total of 101 rodents, 95 Rattus Norvegicus, 5 Rattus Rattus, and 1 Mus Musculus were captured and tested for pathogenic Leptospira spp. byreal-time PCR targeting the Leptospira 16S rRNA (rrs) gene, revealing a total prevalence of 40.6%, 95% IC [30.9–50.8%]. Positive samples were subjected to species-specific real-time PCR assays targeting L. interrogans, L. noguchii, L. borgpetersenii, and L. kirschneri for species identification. However, positive samples for which Leptospira-species could not be determined were subjected to conventional PCR targeting the partial 16S rRNA (rrs) gene, and amplified DNA was subjected to sequencing. Leptospira spp. was detected in 36 kidney, 16 urine, and three lung specimens. L. interrogans was identified in 39 rodents and L. borpetersenii in one rodent; however, one rodent with renal carriage could not be typed due to poor DNA quality. This study provides the first description of pathogenic Leptospira spp. in wild rodents in Algeria. These findings suggest a high potential risk of leptospirosis transmission from rodents to humans and animals in Algeria and therefore imply the adoption of prophylactic measures. In addition, further studies, including different animals and rodent species, should be conducted to clarify the epidemiology of this disease in Algeria.
Keywords:
leptospirosis; Algeria; Blida; rodents; L. interrogans; L. borpetersenii; Rattus Norvegicus; Rattus Rattus; Mus Musculus 1. Introduction
Leptospirosis is an emerging rodent-borne disease [1] most commonly found in tropical and subtropical regions [2]. It affects more than one million people annually, with 60,000 deaths recorded [3]. Infection in humans and animals is caused by pathogenic Leptospira spp. [4]. Leptospires are divided into more than 300 serovars, grouping 25 serogroups [5,6] and 69 genomic species [7], including four species that have been recently isolated from fresh water in Algeria [8]. Leptospires are maintained in several wild and domestic animal hosts [2] through the renal carriage and are excreted in the urine for several months [9]. Infection in humans and animals mainly occurs through contact with tissues of infected mammalian hosts, mainly rodents, or indirect exposure to soil or water contaminated by leptospires [10].Rodents are considered the most important reservoir of pathogenic Leptospira spp. worldwide due to their close contact with humans and domestic animals [11].
L. interrogans, L. borgpetersenii, and L. kirschneri are the most abundant species circulating in humans and animals worldwide [12], with L. interrogans being the most described in rodents [13] and recognized as the most common species infecting humans [14]. Consequently, long-term active surveillance and investigations of the Leptospira-carriage status of rodents can contribute to understanding animal-to-human transmission, investigating outbreaks, and identifying source populations of leptospirosis [15].
In humans, clinical manifestations of leptospirosis range from mild febrile illness (in 90% of cases) [16] to life-threatening renal failure, pulmonary hemorrhage, and/or cardiac complication [17]. In dogs, clinical manifestations vary from asymptomatic to hepatic and renal failure, with hemorrhagic and pulmonary disorders frequently occurring [18]. In livestock, the disease causes reproductive failures and economic losses [19] and recurrent uveitisis observed in horses [20].
Data on circulating leptospires varies between regions [13]. Few data, mostly serological, describe the circulating strains of leptospires in Algeria. Two unique studies performed the Microscopic Agglutination Test (MAT) on humans. The first was conducted between 2006 and 2007 in the region of Tizi Ouzou and revealed human infection by serogroup Icterohemorrhagiae in more than 60% of the cases [21]. The second was conducted between 1 January 2005 and 31 December 2008 in the infectious diseases department of the University Hospital of Tizi-Ouzou. It brought together 173 hospitalized patients and revealed the predominance of serogroups Icterohemorragiae and Canicola in infected patients [22].
Regarding domestic animals, a recent study relative to the urinary carriage of leptospires in stray dogs and cats in the Algiers region was carried out in 2018 [23] and demonstrated the occurrence of L. interrogans in 5 of 107 dogs’ urine by PCR. In the same region, a second study in 2017 investigated the causes of abortion in dairy cattle through serological screening of 360 cattle from 54 farms and reported L. interrogans serovarHardjo in 14 cows [24]. Finally, a recent study carried out on cattle between 2015 and 2019 in the state of Setif in northeastern Algeria performed an Indirect Enzyme-Linked Immunosorbent Assay on 406 cattle from 48 herds and reported L.interrogans serovar Hardjo in 31.25% of the herds and 5.42% of the cattle [25].
To the best of our knowledge, no study describing Leptospira-carriage in wild rodents has been carried out in Algeria until today. Nevertheless, a unique study was conducted in some farms of the Algiers region in which twenty Rattus Norvegicus were trapped and investigated for leptospirosis by serology (MAT) and culture of kidney and urine. Results of the latter study showed that only 2 of the 20 rats included in the study showed (low) antibody titers of 1:40 and 1:160 against serovars Gripotyphosa and Australis, respectively, by MAT. Furthermore, no evidence of the bacterium was revealed by culture [26]. Consequently, knowledge of the circulation of Leptospira strains in wild rodents is lacking in Algeria. Therefore, information regarding leptospirosis and Leptospira circulating serogroups in Algeria are required to implement appropriate prophylaxis measures, if needed. The objectives of the present study were to assess rodent Leptospira carriage rates in Blida, a central northern city of Algeria, and identify circulating Leptospira species.
2. Materials and Methods
2.1. Regulatory and Ethical Aspects
Rodents were captured in collaboration with the Service of Hygiene of Blida under the authorization number BHC/340/2018. Rodents were anesthetized and euthanized in accordance with the ethical standard of the Laboratory of Animal Reproduction Biotechnologies (LBRA), Institute of veterinary science, university Blida1, under the authorization number (98/LBRA/Univ Blida/20). The species included in this study (RattusNorvegicus, Rattus rattus, and Mus musculus) are classified as species of the least concern on the IUCN list [27,28,29], which have the lowest level of protection in this classification.
2.2. Rodent’s Capture
Rodent’s capture campaign took place in the region of Blida, Algeria (Figure 1) between 11 November 2018 and 9 June 2020. A total of nine distinct sites were targeted, including six urban areas (Site 1: 36°27′45″ N 2°50′15″ E, Site 2: 36°29′57″ N 2°50′43″ E, Site 3: 36°28′02.6″ N 2°49′16.3″ E), Site 4: 36°28′52.8″ N 2°51′04.5″ E, Site 5: 36°31′39.4″ N 2°53′26.4″ E, Site 6: 36°29′12″ N 2°48′21″ E, two rural areas (Site 7: 36°30′28″ N 2°53′48″ E, Site 8: 36°29′51″ N 2°45′29″ E) and one peri-urban environment (Site 9: 36°27′24″ N 2°48′47″ E) (Figure 1). The sites were chosen depending on different criteria such as site accessibility and safety, availability of personnel, help accorded by the owners, and the existence of rodents. The trapping was conducted in one session and for one month solely for each site, except for sites 1 and 9 (three sessions during twelve months for site 1 and two sessions during six months for site 2).Most of the rodents were captured during the rainy season between October and April. Rodents were captured using spring cages of suitable size for rats (approximately 30 cm× 15 cm× 15 cm). Each site had five to ten traps along the walls at intervals of two meters. The traps were collected every morning, and the captured rodents were promptly transferred to the inspection site and sacrificed. All cages were cleaned prior to being reinstalled. Furthermore, rodent species were determined according to demographic characteristics such as body measurements (head and body length, tail and skull length, foot and ear length) and fur color [30]. The sex and age of each animal were also recorded [31].
Figure 1.
Geographic localization of the sites of capture.
2.3. Collecting Samples
Following their euthanasia and the disinfection of the abdomen with alcohol, rodents were autopsied. Kidneys and lungs were collected and stored at −20 °C. When possible, urine samples were collected directly from the bladder of the animal using a 1mL sterile syringe. The samples were then sent to the USC1233 Unit at VetAgroSup, veterinary campus of Lyon, France, in cold conditions in less than 24 h.
2.4. DNA Extraction
DNA was extracted from samples using the QIAamp DNA Mini Kit from Qiagen (Qiagen, Courtaboeuf, France) following the manufacturer’s recommendations.
Initially, pretreatment of the samples was carried out. Kidneys and lungs were rinsed with sterile PBS, and a portion of 20 to 25 mg from each tissue (targeting the cortico-medular area for kidneys) was used for DNA extraction. The tissue portions were crushed using a 5 mL syringe and added to an Eppendorf tube containing 180 µL of T1 lysis buffer and 20 µL of Proteinase K. After being vigorously vortexed, samples were incubated 1 to 3 h at 56 °C in a dry bath until the complete and homogeneous dissolution of the tissues. Samples were again vortexed, and then 200 μL of B3 lysis buffer was added. The negative control of extraction or NCS (Negative Control Sample) was prepared in an Eppendorf tube containing all added reagents without sample tissue. For urine, 1 mL was centrifuged for 10 min at 4000 rpm in a sterile Eppendorf tube. The supernatant was discarded, then the pellet was washed with 1 mL of PBS. After a second centrifugation for 10 min at 4000 rpm, the pellet was collected with 200 µL of lysis buffer B3 and added to an Eppendorf tube containing 25 µL of proteinase K. The NCS was prepared in an Eppendorf tube containing all added reagents with 200 μL of PBS.
After carrying out the appropriate pretreatment, all samples were vortexed and incubated for 10 to 15 min at 70 °C in a dry bath. Then, 200 µL of 100% ethanol was added before vortexing again. Samples were transferred to the extraction columns on a silica membrane and centrifuged for 1 min at 11,000 rpm. The columns were then washed twice by centrifuging for 1 min at 11,000 rpm, first with 500 μL of BW buffer and then with 600 μL of B5 buffer. The collection tubes were changed following each wash to avoid contamination. The columns were dried by centrifuging in vacuo again for 1 min at 11,000 rpm, then sterile Eppendorf tubes were added under the columns. Finally, 50 µL of BE buffer preheated to 70 °C was added to columns to allow DNA elution. After 1 min of impregnation at room temperature, columns were centrifuged for 1 min at 11,000 rpm, and the eluted DNAs were collected.
2.5. Detection and Identification of Pathogenic Leptospires by Real-Time PCR Assays
The detection of pathogenic leptospires was performed by real-time PCR targeting a partial region of the Leptospira 16S rRNA (rrs) gene using primers and probes as described by Waggoner et al. [32] (Table 1).
Table 1.
Primers and probes used for real-time PCR.
Leptospira-positive samples were subsequently tested with the individual species-specific assays (for a total of four probe/primers sets) targeting respectively L. interrogans, L. noguchii, L. borgpetersenii and L. kirschneri (Table 1) [33]. The amplification reactions were optimized individually for all probes and associated primers using the AgPath-ID™ One-Step RT-PCR Reagents (Life technologies, Courtaboeuf- Les Ulis, France), according to the manufacturer’s instructions. The Mx3000P real-time PCR detection system (Agilent Technology, Courtaboeuf- Les Ulis, France) was used for all assays. Each reaction was conducted in a total volume of 25 µL consisting of 2X RT-PCR Buffer, 300 nM of each primer, 400 nM of TaqMan probe, and 4 µL of DNA template solution. Amplification conditions were: 95 °C for 10 min, followed by 40 cycles of 15 s at 95 °C and 1min at the optimized annealing temperature for each probe. Positive and negative controls were included in each PCR run. The positive control consisted of the mixture with Leptospira DNA as a template: L. interrogans Icterohaemorrhagiae 19 ENVN, L. noguchii Panama panama, L. borgpetersenii Sejroe Sejroe M84, and L. kirschneri GrippotyphosaGrippotyphosa Moskva-V, for L. interrogans, L. noguchii, L. borgpetersenii, and L. kirschneri respectively, and the negative control consisted of 5 µL sterile water added to a well containing the same mixture. Data analyses were performed by the detection system of the real-time PCR equipment, according to the manufacturer’s instructions.
2.6. Conventional PCR and Sequencing
Leptospira-positive samples that could not be typed by the individual species-specific real-time PCR were prone to conventional PCR, and amplified DNA was subjected to sequencing.
A conventional PCR targeting the partial 16S gene, encoding the subunit of the 16S ribosomal RNA, was performed. Amplification and sequencing of this partial region (330 bp) allow the detection and identification of the genomic species of pathogenic leptospires [34]. PCRs were carried out using the HotStarTaq DNA Polymerase from Qiagen (Qiagen Courtaboeuf-Les Ulisville, France). Each reaction was conducted in a total volume of 25 µL consisting of H2O, 10x PCR Buffer, MgCl2, dNTP mix, Primer F at 10 μM (sequence 5’-3’: GGCGGCGCGTCTTAAACATG), Primer R at 10 μM (sequence 5’-3’: TTCCCCCCATTGAGCAAGATT), GoTaq G2 Hot Start Polymerase and 5 µL of DNA template solution. Positive and negative controls were included in the PCR run as described above. The PCR program consisted of an initial denaturation step at 95 °C for 15 min, followed by 40 cycles each, including a second denaturation step at 95 °C for 30 s, a hybridization step at 57 °C for 30 s and an elongation step at 72 °C for 1 min, and a final elongation step at 72 °C for 10 min.
The amplified DNAs were revealed by electrophoresis on 1.5% agarose gel prepared from TBE 10X buffer. Reading was carried out using a UV reader following 20 min DNA migration at 135 volts.
The 16S conventional PCR DNA positive samples were prone to sequencing by Genoscreen, Lille, France platform. The sequences obtained were adjusted using ChromasProsoftware. Finally, sequences were compared to the GenBank database on the NCBI (National Center for Biotechnology Information) website using the BLAST (Basic Local Alignment Search Tool) [35] and to an internal database, and genomic species were identified by homology.
3. Results
3.1. Capture of Rodents
One hundred and one (101) rodents were captured, including 95 Rattus Norvegicus, 5 Rattus Rattus, and 1 Mus Musculus. Among them, fifty-two (52/101, 51.5%) were males, and forty-nine (49/101, 48.5%) were females. We identified eighty-nine (89/101, 88%) adults, four (4/101, 4%) sub adults and eight (8/101, 8%) young rodents. The majority of rodents were captured in the urban area (62/101, 61.4%), whereas twenty-seven (27/101, 26.7%) were captured in peri-urban areas, and twelve (12/101, 11.9%) in the rural area (Table 2).
Table 2.
Distribution of number of positive rodents according to their features.
3.2. Detection of the Leptospira DNA by Real-Time PCR
Forty (40/95, 42.1%, 95% IC [32–52.7%]) Rattus Norvegicus and one (1/5, 20%, 95% IC [0.5–71.6%]) Rattus Rattus revealed positivity in at least one of the sampled specimen by real-time PCR (Table 3).
Table 3.
Prevalence of Leptospira in the rodent species.
In total, 52 specimens were positive, counting thirty-six (36/101, 35.64%) kidneys, thirteen (13/24, 54.2%) urines, and three (3/101, 3%) lungs (Table 4) (Table S1).
Table 4.
Distribution of positive rodent specimens according to Leptospira species identification method.
According to rodents’ gender, twenty-four (24/52, 46.2%) males and seventeen (17/49, 34.7%) females were positive. Regarding the age group, thirty-nine (39/89, 44.1%) adults, one (1/4, 25%) sub adult, and one (1/8, 12.5%) young rodents were positive. Moreover, twenty-eight (28/62, 45.2%) captured rodents in urban areas, ten (10/27, 37%) captured in peri-urban areas, and three (3/12, 25%) in rural areas were positive.
3.3. Leptospira Species Identification
Leptospira species identification was performed on all positive DNA samples by individual species-specific PCR assays targeting L. interrogans, L. noguchii, L. borgpetersenii, and L. kirschneri. Of the 52 positive samples, 42 could be identified as L. interrogans, including thirty (30/36) kidney, eleven (11/13) urine, and one (1/3) lung samples. However, 8 of the 52 positive samples, including five (5/36) kidneys, one (1/13) urine and two (2/3) lungs, could not be typed using species-specific PCR (Table 4). Of these eight samples, seven (7/8) were identified as L. interrogans and one (1/8) as L. borpetersenii by sequencing. However, two positive DNA samples, one (1/13) urine and one (1/36) kidney, could not be typed due to poor DNA quality (Table S1, Figure S1). In total, L. interrogans and L. borpetersenii were identified in 49 and one positive DNA sample, respectively (Table 5).
Table 5.
The total number of Leptospira species identified using species-specific PCR identification or DNA sequencing.
4. Discussion
To the best of our knowledge, this is the first study to describe Leptospira-carriage in wild rodents in Algeria, highlighting the need to develop effective prophylaxis measures in the nation to ensure human and animal protection.
Among the one hundred and one (101) captured rodents, forty-one (41/101) were carrying leptospires in at least one of the sampled specimens, and the total prevalence of infected rodents was 40.6%, 95% [30.9–50.8%]. The prevalence reported in this study is relatively high when compared with the prevalence reported in wild rodents in Africans and Mediterranean countries; in Niger (1.3%, 8/578) [36], in Egypt, (19%, 19/100) [37]; (24%, 65/270) [38], in Kenya (18.3%, 41/224) [39], in Spain (10.52%, 2/19) [40] and in France (10.43%, 12/115) [41]. Nevertheless, our prevalence is slightly higher than 35.2% (81/230) reported in rodents in Italy [42].
Three of forty-one (3/41) positive rodents belonging to Rattus Norvegicus presented pulmonary carriage. The pulmonary localization of Leptospira spp. in wild rodents has only been described once in the literature following the serovar Icterohaemorrhagiae on the ciliated epithelium of the bronchi of 3 Rattus Norvegicus trapped in the Lyonnaise region, in France [43]. Experimental infection of R. Norvegicus with L. interrogans demonstrated the persistence of leptospires for several months in kidneys and its elimination from other tissue, including lungs, within a maximum of 9 days [44].
Among rodents for which urine specimen was collected, four revealed Leptospira in urine solely. This finding was unexpected, given that urine excretion results from the renal carriage. Nevertheless, leptospires are recognized to colonize a defined number of niches in kidney specimens proportional to the infecting dose [45]. However, only a limited portion (20-25mg) of (kidney) specimen was used in the DNA extraction step. This might have resulted in a negative PCR due to the localization of leptospires on a specific portion of the kidney (not collected), making the actual prevalence underestimated.
According to rodent species, forty (40/95) Rattus Norvegicus and one (1/5) Rattus Rattus reported a prevalence of 42.1%, 95% IC [32–52.7%] and 20%, 95% IC [0.5–71.6%], respectively. Consequently, Rattus Norvegicus revealed a higher prevalence than Rattus Rattus. The latter result is consistent with studies carried out in Benin [46] (Rattus Norvegicus; 27.3%, Rattus Rattus; 13.3%), Singapore (Rattus Norvegicus; 46.8%, Rattus Rattus; 10.4%) [47] and Mahé Island, Seychelles (Rattus Norvegicus; 54.0%, Rattus Rattus; 4.4%) [48]. Furthermore, our finding makes sense given that R. rattus favors dry habitats, whereas R. norvegicus favors wet habitats [49], with garbage dumps and sewers, where leptospires are found in the majority, explaining the strong association between R. norvegicus and the high prevalence of Leptospira spp. [47].
Males were more exposed to Leptospira infection (46.2%) than females (34.7%); our result is in accordance with studies conducted on rodents in Kenya and Salvador, where 17.9% [39] and 97% of Leptospira-positive rats were males [50]. In contrast, a study in Austria [51] reported that female rats were more infected (37.5%) than males (18%). Furthermore, the proportion of positive individuals increased with the age of rodents, with Leptospira being identified in 44.1% of adults, 25% of sub adults, and 12.5% of juveniles. Our result is compatible with the one reported in studies conducted on rodents in Vancouver and Salvador [52], in Brazil [53], and in Salvador, Bahia [50]. Physiological, immunological, and behavioral characteristics associated with age are reported to play an important role in the transmission of infections [54]. Effectively, males and adults of R. norvegicus have a social behavior of huddling and fighting, along with an active search for food [55]. Aggressive behavior, such as fighting and biting, is known to facilitate the transmission of Leptospira infection [56]. The proportion of positive individuals also increased with urbanization (45.2% in urban areas, 37% in peri-urban areas, and 25% in rural areas). Rats living in rural habitats commonly grow at a lower rate, whereas the abundance of nutritional sources with less competition for it in urban areas and the abundance of possible shelters afforded by urban landscapes promote the proliferation of rats [57,58]. Consequently, the high density of rats in urban areas associated with stagnant water could ease the spread of leptospires among rodents in urban areas [13].
Finally, the genomic leptospira species was investigated by the individual species-specific real-time PCR assays targeting L. interrogans, L. noguchii, L. borgpetersenii, and L. kirschneri or by sequencing the amplified DNA of the 16S gene. L. interrogans was identified in 49 of the 52 positive sample specimens corresponding to 39 individuals. However, L. borpetersenii was identified in one kidney sample corresponding to one individual. L. interrogans is described as the most common genomic species in wild rats (Rattus spp.) worldwide [13] and the most frequent species infecting humans [14]. In Algeria, L. interrogans was implicated in many cases of human leptospirosis between 2005 and 2008 [21,22] and was identified in 5 dogs in 2017 in northern Algeria [23]. L. borpetersenii was found in a single individual in our survey; this species was also associatedwith rats species; Rattus Norvegicus in South Africa [59] and Madagascar [14] and Rattus Rattus in Sardinia [49] and Japan [60]. The low rate of carriage of L. borpetersenii in rodents observed in the present study can be explained by the fact that L. borpetersenii colonizesfewer rat kidneys [61] when compared to L. interrogans known to persist for several months in kidneys [44]. L. interrogans transmission commonly occurs via contaminated surface water, whereas epidemiological data support a host-to-host transmission cycle for L. borgpetersenii [62].
5. Conclusions
The present study revealed the presence of Leptospira spp. in wild rodents in Algeria with the identification of L. interrogans and L. borgpetersenii infectious species. The study highlighted the importance of rodents as a potential reservoir of Leptospira in northern Algeria, constituting a high risk of transmission to humans and animals, therefore adapting effective prophylactic measures. However, since the rodents included in this study derived from the region of Blida (Algeria), the identified Leptospira strains may not be typical of those present in other parts of Algeria. Thus, further studies should be carried out on rodents and other animal species in the rest of the country in order to clarify the circulating Leptospira strains.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/tropicalmed7110335/s1. Figure S1: Flow diagram summarizing all PCRs reactions, and Table S1: Detailed information of all positive samples for Leptospira species identification.
Author Contributions
Conceptualization, L.L, D.K, R.K.; Methodology, M.L.G., K.G., A.A., L.L., Z.D.; Validation, D.K., M.L.G., K.G., A.A., L.L.; Formal Analysis, M.L.G., A.A., L.L.; Investigation, D.K., A.A., L.L.; Resources, Z.D.; Data Curation, R.K.; Writing—Original Draft Preparation, D.K., A.A., Z.D., L.L. Writing—Review & Editing, D.K., M.L.G., K.G., A.A., Z.D., L.L., R.K., E.H.; Visualization, Z.D.; Supervision, D.K., K.G., R.K., Z.D.; Funding Acquisition, Z.D., L.L. All authors have read and agreed to the published version of the manuscript.
Funding
This work was supported by the French National Agency for Food, Environmental and Occupational Health & Safety and VetAgro Sup, USC 1233 RongeursSauvages, Risque Sanitaire et Gestion des Populations.
Institutional Review Board Statement
This study was conducted with the approval of the Laboratory of Animal Reproduction Biotechnologies (LBRA), Institute of veterinary science, university Blida1, under the authorization number (98/LBRA/Univ Blida/20).
Data Availability Statement
The data used to support this study are available from the corresponding author upon request.
Acknowledgments
The authors would like to thank the Service of Hygiene of Blida, particularly doctor Ouchfoun Ahmed, the Chief Service for the help provided during the rodent trapping.
Conflicts of Interest
The authors declare no conflict of interest.
References
- Evangelista, K.V.; Coburn, J. Leptospira as an emerging pathogen: A review of its biology, pathogenesis and host immune responses. Future Microbiol. 2010, 5, 1413–1425. [Google Scholar] [CrossRef]
- Bharti, A.R.; Nally, J.E.; Ricaldi, J.N.; Matthias, M.A.; Diaz, M.M.; Lovett, M.A.; Levett, P.N.; Gilman, R.H.; Willig, M.R.; Gotuzzo, E. Leptospirosis: A zoonotic disease of global importance. Lancet Infect. Dis. 2003, 3, 757–771. [Google Scholar] [CrossRef]
- Costa, F.; Hagan, J.E.; Calcagno, J.; Kane, M.; Torgerson, P.; Martinez-Silveira, M.S.; Stein, C.; Abela-Ridder, B.; Ko, A.I. Global morbidity and mortality of leptospirosis: A systematic review. PLoS Negl. Trop. Dis. 2015, 9, e0003898. [Google Scholar] [CrossRef] [PubMed]
- Bomfim, M.R.Q.; Barbosa-Stancioli, E.F.; Koury, M.C. Detection of pathogenic leptospires in urine from naturally infected cattle by nested PCR. Vet. J. 2008, 178, 251–256. [Google Scholar] [CrossRef] [PubMed]
- Levett, P.N. Systematics of leptospiraceae. In Leptospira and Leptospirosis; Adler, B., Ed.; Springer: Berlin/Heidelberg, Germany, 2015; p. 387. [Google Scholar] [CrossRef]
- Mohammed, H.; Nozha, C.; Hakim, K.; Abdelaziz, F.; Rekia, B. Leptospira: Morphology, classification and pathogenesis. J. Bacteriol. Parasitol. 2011, 2, 120. [Google Scholar] [CrossRef]
- NCBI National Center for Biotechnology Information Database. Available online: https://www.ncbi.nlm.nih.gov/genome (accessed on 30 December 2021).
- Korba, A.A.; Lounici, H.; Kainiu, M.; Vincent, A.T.; Mariet, J.F.; Veyrier, F.J.; Goarant, C.; Picardeau, M. Leptospira ainlahdjerensis sp. nov., Leptospira ainazelensis sp. nov., Leptospira abararensis sp. nov.and Leptospira chreensis sp. nov., four new species isolated from water sources in Algeria. Int. J. Syst. Evol. Microbiol. 2021, 71, 5148. [Google Scholar] [CrossRef] [PubMed]
- Ko, A.I.; Goarant, C.; Picardeau, M. Leptospira: The dawn of the molecular genetics era for an emerging zoonotic pathogen. Nat. Rev. Microbiol. 2009, 7, 736–747. [Google Scholar] [CrossRef] [PubMed]
- Ellis, W.A. Animal leptospirosis. Curr. Top. Microbiol. Immunol. 2015, 387, 99–137. [Google Scholar] [CrossRef]
- Plank, R.; Dean, D. Overview of the epidemiology, microbiology, and pathogenesis of Leptospira spp. in humans. Microbes Infect. 2000, 2, 1265–1276. [Google Scholar] [CrossRef]
- Thaipadungpanit, J.; Wuthiekanun, V.; Chierakul, W.; Smythe, L.D.; Petkanchanapong, W.; Limpaiboon, R.; Apiwatanaporn, A.; Slack, A.T.; Suputtamongkol, Y.; White, N.J.; et al. A dominant clone of Leptospira interrogans associated with an outbreak of human leptospirosis in Thailand. PLoS Negl. Trop. Dis. 2007, 1, e56. [Google Scholar] [CrossRef]
- Boey, K.; Shiokawa, K.; Rajeev, S. Leptospira infection in rats: A literature review of global prevalence and distribution. PLoS Negl. Trop. Dis. 2019, 13, e0007499. [Google Scholar] [CrossRef] [PubMed]
- Rahelinirina, S.; Bourhy, P.; Andriamiaramanana, F.; Garin, B.; Rajerison, M. High prevalence of Leptospira spp. in rodents in an urban setting in Madagascar. Am. J. Trop. Med. Hyg. 2019, 100, 1079–1081. [Google Scholar] [CrossRef]
- Xu, G.; Qiu, H.; Liu, W.; Jiang, X.; Chang, Y.F.; Wang, J.; Li, Z.; Zhu, Y.; Zhang, C.; Xiao, F. Serological and molecular characteristics of pathogenic Leptospira in rodent populations in Fujian Province, China, 2018–2020. BMC Microbiol. 2022, 22, 151. [Google Scholar] [CrossRef]
- World Health Organization. Human Leptospirosis: Guidance for Diagnosis, Surveillance and Control, World Health Organization. 2003. Available online: http://www.who.int/csr/don/en/WHO_CDS_CSR_EPH_2002.23.pdf (accessed on 20 December 2020).
- Levett, P.N. Leptospirosis. J. Clin. Microbiol. Rev. 2001, 2, 296–326. [Google Scholar] [CrossRef]
- Andre-Fontaine, G. Canine leptospirosis—Do we have a problem? Vet. Microbiol. 2006, 117, 19–24. [Google Scholar] [CrossRef] [PubMed]
- Pappas, G.; Papadimitriou, P.; Siozopoulou, V.; Christou, L.; Akritidis, N. The globalization of leptospirosis: Worldwide incidence trends. Int. J. Infect. Dis. 2008, 12, 351–357. [Google Scholar] [CrossRef] [PubMed]
- Verma, A.; Matsunaga, J.; Artiushin, S.; Pinne, M.; Houwers, D.J.; Haake, D.A.; Stevenson, B.; Timoney, J.F. Antibodies to a novel leptospiral protein, LruC, in the eye fluids and sera of horses with Leptospira-associated uveitis. Clin. Vaccine Immunol. 2012, 19, 452–456. [Google Scholar] [CrossRef] [PubMed]
- Afiri, M.; Toudeft, F.; AitKaid, D. Leptospirosis epidemic: 48 cases. Med. Sante Trop. 2013, 23, 234. [Google Scholar] [CrossRef] [PubMed]
- Afiri, M. Renal manifestations of leptospirosis: 88 cases. Med. Sante Trop. 2013, 23, 234–235. [Google Scholar] [CrossRef]
- Zaidi, S.; Bouam, A.; Bessas, A.; Hezil, D.; Ghaoui, H.; Ait-Oudhia, K.; Drancourt, M.; Bitam, I. Urinary shedding of pathogenic Leptospira in stray dogs and cats, Algiers: A prospective study. PLoS ONE 2018, 13, e0197068. [Google Scholar] [CrossRef] [PubMed]
- Derdour, S.Y.; Hafsi, F.; Azzag, N.; Tennah, S.; Laamari, A.; China, B.; Ghalmi, F. Prevalence of the main infectious causes of abortion in dairy cattle in Algeria. J. Vet. Res. 2017, 61, 337. [Google Scholar] [CrossRef] [PubMed]
- Benseghir, H.; Amara-Korba, A.; Azzag, N.; Hezil, D.; Ghalmi, F. Seroprevalence of and associated risk factors for Leptospira interrogans serovar Hardjo infection of cattle in Setif, Algeria. Afr. J. Clin. Exp. Microbiol. 2020, 21, 185–191. [Google Scholar] [CrossRef]
- Yahiaoui, W.I.; Amara-Korba, A.; Aggad, H.; Khelef, D. Seroprevalence of leptospirosis in some farms of Algiers (Algeria). Lucr. Stiintifice-Univ. De StiinteAgric. A Banat. Timis. Med. Vet. 2018, 51, 111–118. [Google Scholar]
- Ruedas, L.A. Rattus Norvegicus (Errata Version Published in 2020), IUCN Red List Threat. Species. 2016, p. e.T19353A165118026. Available online: https://www.iucnredlist.org (accessed on 29 December 2020).
- Krystufek, B.; Palomo, L.; Hutterer, R.; Mitsain, G.; Yigit, N. RattusRattus (Errata Version), IUCN Red List Threat. Species. 2017, p. e.T19360A115148682. Available online: https://www.iucnredlist.org/species/19360/192565917 (accessed on 29 December 2020).
- Musser, G.; Hutterer, R.; Krystufek, B.; Yigit, N.; Mitsain, G. MusMusculus (Errata Version), IUCN Red List of Threatened Species. 2017, p. e.T13972A115117618. Available online: https://www.iucnredlist.org/species/13972/197519724 (accessed on 29 December 2020).
- Ahmim, M. Les Mammiferes d’Algerie. Des Origines A Nos Jours; Ministère de l’Aménagement du Territoire et de l’Environnement: Alger, Algérie, 2004; p. 266. [Google Scholar]
- Herbreteau, V.; Jittapalapong, S.; Rerkamnuaychoke, W.; Chaval, Y.; Cosson, J.F.; Morand, S. Protocols for Field and Laboratory Rodent Studies; Kasetsart University: Bangkok, Thailand, 2011; p. 51. [Google Scholar]
- Waggoner, J.J.; Balassiano, I.; Abeynayake, J.; Sahoo, M.K.; Mohamed-Hadley, A.; Liu, Y.; Vital-Brazil, J.M.; Pinsky, B.A. Sensitive real-time PCR detection of pathogenic Leptospira spp. and a comparison of nucleic acid amplification methods for the diagnosis of leptospirosis. PLoS ONE 2014, 9, e112356. [Google Scholar] [CrossRef] [PubMed]
- Ferreira, A.S.; Costa, P.; Rocha, T.; Amaro, A.; Vieira, M.L.; Ahmed, A.; Thompson, G.; Hartskeerl, R.A.; Inácio, J. Direct detection and differentiation of pathogenic Leptospira species using a multi-gene targeted real time PCR approach. PLoS ONE 2014, 9, e112312. [Google Scholar] [CrossRef] [PubMed]
- Postic, D.; Riquelme-Sertour, N.; Merien, F.; Perolat, P.; Baranton, G. Interest of partial 16S rDNA gene sequences to resolve heterogeneities between Leptospira collections: Application to L. meyeri. Res. Microbiol. 2000, 151, 333–341. [Google Scholar] [CrossRef]
- BLAST: Basic Local Alignment Search Tool. Available online: https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 30 December 2020).
- Dobigny, G.; Garba, M.; Tatard, C.; Loiseau, A.; Galan, M.; Kadaoure, I.; Rossi, J.P.; Picardeau, M.; Bertherat, E. Urban market gardening and rodent-borne pathogenic Leptospira in arid zones: A case study in Niamey, Niger. PLoS Negl. Trop. Dis. 2015, 9, e0004097. [Google Scholar] [CrossRef]
- Felt, S.A.; Wasfy, M.O.; Wael, F.; Samir, A.; Rahaman, B.A.; Boshra, M.; Parker, T.M.; Hatem, M.E.; El-Bassiouny, A.A.; Murray, C.K. Cross-species surveillance of Leptospira in domestic and peri-domestic animals in Mahalla City, Gharbeya Governorate, Egypt. Am. J. Trop. Med. Hyg. 2011, 84, 420–425. [Google Scholar] [CrossRef]
- Samir, A.; Soliman, R.; El-Hariri, M.; Abdel-Moein, K.; Hatem, M.E. Leptospirosis in animals and human contacts in Egypt: Broad range surveillance. Rev. Soc. Bras. Med. Trop. 2015, 48, 272–277. [Google Scholar] [CrossRef] [PubMed]
- Halliday, J.E.B.; Knobel, D.L.; Allan, K.J.; Bronsvoort, B.M.D.C.; Handel, I.; Agwanda, B.; Cutler, S.J.; Olack, B.; Ahmed, A.; Hartskeerl, R.A.; et al. Urban leptospirosis in Africa: A cross-sectional survey of Leptospira infection in rodents in the Kibera urban settlement, Nairobi, Kenya. Am. J. Trop. Med. Hyg. 2013, 89, 1095–1102. [Google Scholar] [CrossRef] [PubMed]
- Millán, J.; Cevidanes, A.; Chirife, A.D.; Candela, M.G.; León-Vizcaíno, L. Risk factors of Leptospira infection in Mediterranean periurban micromammals. Zoonoses Public Health 2018, 65, e79–e85. [Google Scholar] [CrossRef]
- Izquierdo-Rodríguez, E.; Fernandez-Alvarez, A.; Martín-Carrillo, N.; Marchand, B.; Feliu, C.; Miquel, J.; Foronda, P.; Quilichini, Y. Pathogenic Leptospira species in rodents from Corsica (France). PLoS ONE 2020, 15, e0233776. [Google Scholar] [CrossRef] [PubMed]
- Vitale, M.; Agnello, S.; Chetta, M.; Amato, B.; Vitale, G.; Bella, C.D.; Vicari, D.; Presti, V.D.M.L. Human leptospirosis cases in Palermo Italy. The role of rodents and climate. J. Infect. Public Health 2018, 11, 209–214. [Google Scholar] [CrossRef]
- Zilber, A.L.; Belli, P.; Artois, M.; Kodjo, A.; Djelouadji, Z. First Observation of Leptospira interrogans in the Lungs of Rattusnorvegicus. Biomed Res. Int. 2016, 2016, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Athanazio, D.A.; Silva, E.F.; Santos, C.S.; Rocha, G.M.; Vannier-Santos, M.A.; McBride, A.J.A.; Ko, A.I.; Reis, M.G. Rattusnorvegicus as a model for persistent renal colonization by pathogenic Leptospira interrogans. Acta Trop. 2008, 105, 176–180. [Google Scholar] [CrossRef]
- Ratet, G.; Veyrier, F.J.; Fantond’Andon, M.; Kammerscheit, X.; Nicola, M.A.; Picardeau, M.; Boneca, I.G.; Werts, C. Live imaging of bioluminescent Leptospira interrogans in mice reveals renal colonization as a stealth escape from the blood defenses and antibiotics. PLoS Negl. Trop. Dis. 2014, 8, e3359. [Google Scholar] [CrossRef]
- Houemenou, G.; Ahmed, A.; Libois, R.; Hartskeerl, R.A. Leptospira spp. Prevalence in Small Mammal Populations in Cotonou, Benin. ISRN Epidemiol. 2013, 2013, 8. [Google Scholar] [CrossRef]
- Griffiths, J.; Yeo, H.L.; Yap, G.; Mailepessov, D.; Johansson, P.; Low, H.T.; Siew, C.C.; Lam, P.; Ng, L.C. Survey of rodent-borne pathogens in Singapore reveals the circulation of Leptospira spp., Seoul hantavirus, and Rickettsia typhi. Sci. Rep. 2022, 12, 1–14. [Google Scholar] [CrossRef]
- Biscornet, L.; Révillion, C.; Jégo, S.; Lagadec, E.; Gomard, Y.; Le Minter, G.; Rocamora, G.; Guernier-Cambert, V.; Mélade, J.; Dellagi, K. Predicting the presence of leptospires in rodents from environmental indicators opens up opportunities for environmental monitoring of human leptospirosis. Remote Sens. 2021, 13, 325. [Google Scholar] [CrossRef]
- Krøjgaard, L.H.; Villumsen, S.; Markussen, M.D.K.; Jensen, J.S.; Leirs, H.; Heiberg, A.C. High prevalence of Leptospira spp. in sewer rats (Rattusnorvegicus). Epidemiol. Infect. 2009, 137, 1586–1592. [Google Scholar] [CrossRef]
- Santos, A.A.N.; Ribeiro, P.D.S.; da França, G.V.; Souza, F.N.; Ramos, E.A.G.; Figueira, C.P.; Reis, M.G.; Costa, F.; Ristow, P. Leptospirainterrogans biofilm formation in Rattus norvegicus (Norway rats) natural reservoirs. PLoS Negl. Trop. Dis. 2021, 15, e0009736. [Google Scholar] [CrossRef] [PubMed]
- Desvars-Larrive, A.; Smith, S.; Munimanda, G.; Bourhy, P.; Waigner, T.; Odom, M.; Gliga, D.S.; Walzer, C. Prevalence and risk factors of Leptospira infection in urban brown rats (Rattus norvegicus), Vienna, Austria. Urban Ecosyst. 2020, 23, 775–784. [Google Scholar] [CrossRef]
- Minter, A.; Himsworth, C.G.; Byers, K.A.; Childs, J.E.; Ko, A.I.; Costa, F. Tails of two cities: Age and wounding are associated with carriage of Leptospira interrogans by Norway rats (Rattus norvegicus) in ecologically distinct urban environments. Front. Ecol. Evol. 2019, 7, 14. [Google Scholar] [CrossRef]
- Minter, A.; Diggle, P.J.; Costa, F.; Childs, J.; Ko, A.I.; Begon, M. Evidence of multiple intraspecific transmission routes for Leptospira acquisition in Norway rats (Rattus norvegicus). Epidemiol. Infect. 2017, 145, 3438–3448. [Google Scholar] [CrossRef] [PubMed]
- Theuerkauf, J.; Perez, J.; Taugamoa, A.; Niutoua, I.; Labrousse, D.; Gula, R.; Bogdanowicz, W.; Jourdan, H.; Goarant, C. Leptospirosis risk increases with changes in species composition of rat populations. Naturwissenschaften 2013, 100, 385–388. [Google Scholar] [CrossRef]
- Schweinfurth, M.K. The social life of Norway rats (Rattus norvegicus). Elife 2020, 9, e54020. [Google Scholar] [CrossRef]
- Mohamed-Hassan, S.N.; Bahaman, A.R.; Mutalib, A.R.; Khairani-Bejo, S. Serological prevalence of leptospiral infection in wild rats at the National Service Training Centres in Kelantan and Terengganu. Trop. Biomed. 2010, 27, 30–32. [Google Scholar] [PubMed]
- Guiry, E.; Buckley, M. Urban rats have less variable, higher protein diets. Proc. R. Soc. B Boil. Sci. 2018, 285, 20181441. [Google Scholar] [CrossRef]
- Desvars-Larrive, A.; Baldi, M.; Walter, T.; Zink, R.; Walzer, C. Brown rats (Rattus norvegicus) in urban ecosystems: Are the constraints related to fieldwork a limit to their study? Urban Ecosyst. 2018, 21, 951–964. [Google Scholar] [CrossRef]
- Moseley, M.; Naidoo, K.; Bastos, A.; Retief, L.; Frean, J.; Telfer, S.; Rossouw, J. Multi-locus sequence analyses reveal a clonal L. borgpetersenii genotype in a heterogeneous invasive Rattus spp. community across the City of Johannesburg, South Africa. Parasit. Vectors 2020, 13, 1–9. [Google Scholar] [CrossRef]
- Shinya, S.; Muraoka, Y.; Negishi, D.; Koizumi, N. Molecular epidemiology of Leptospira spp. among wild mammals and a dog in AmamiOshima Island, Japan. PLoS ONE 2021, 16, e0249987. [Google Scholar] [CrossRef] [PubMed]
- Cordonin, C.; Turpin, M.; Bringart, M.; Bascands, J.L.; Flores, O.; Dellagi, K.; Mavingui, P.; Roche, M.; Tortosa, P. Pathogenic Leptospira and their animal reservoirs: Testing host specificity through experimental infection. Sci. Rep. 2020, 10, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Bulach, D.M.; Zuerner, R.L.; Wilson, P.; Seemann, T.; McGrath, A.; Cullen, P.A.; Davis, J.; Johnson, M.; Kuczek, E.; Alt, D.P. Genome reduction in Leptospira borgpetersenii reflects limited transmission potential. Proc. Natl. Acad. Sci. USA 2006, 103, 14560–14565. [Google Scholar] [CrossRef] [PubMed]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).