Transcriptome Analysis of Culex pipiens quinquefasciatus Larvae Exposed to a Semi-Lethal Dose of Vermistatin
Abstract
1. Introduction
2. Materials and Methods
2.1. Mosquitoes and Vermistatin
2.2. Larvae Treatment
2.3. Transcriptomics Sequencing
2.4. Differentially Expressed Gene RNA-Seq Analysis
2.5. Reverse Transcription Quantitative PCR
3. Results
3.1. Analysis of Transcriptome Sequencing
3.2. Differentially Expressed Genes (DEGs)
3.3. GO Annotation and Enrichment Analysis
3.4. KEGG Annotation and Enrichment Analysis
3.5. RNA-Sequencing Validation
3.6. Potential Detoxification and α-Glucosidase Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liu, B.; Gao, X.; Zheng, K.; Ma, J.; Jiao, Z.; Xiao, J.; Wang, H. The Potential Distribution and Dynamics of Important Vectors Culex pipiens pallens and Culex pipiens quinquefasciatus in China under Climate Change Scenarios: An Ecological Niche Modelling Approach. Pest Manag. Sci. 2020, 76, 3096–3107. [Google Scholar] [CrossRef]
- Guo, X.X.; Li, C.X.; Deng, Y.Q.; Xing, D.; Liu, Q.M.; Wu, Q.; Sun, A.J.; Dong, Y.D.; Cao, W.C.; Qin, C.F.; et al. Culex pipiens quinquefasciatus: A Potential Vector to Transmit Zika Virus. Emerg. Microbes Infect. 2016, 5, e102-5. [Google Scholar] [CrossRef] [PubMed]
- Diaz-Badillo, A.; Bolling, B.G.; Perez-Ramirez, G.; Moore, C.G.; Martinez-Munoz, J.P.; Padilla-Viveros, A.A.; Camacho-Nuez, M.; Diaz-Perez, A.; Beaty, B.J.; De Lourdes Munoz, M. The Distribution of Potential West Nile Virus Vectors, Culex pipiens pipiens and Culex pipiens quinquefasciatus (Diptera: Culicidae), in Mexico City. Parasites Vectors 2011, 4, 70. [Google Scholar] [CrossRef] [PubMed]
- Wilson, A.L.; Courtenay, O.; Kelly-Hope, L.A.; Scott, T.W.; Takken, W.; Torr, S.J.; Lindsay, S.W. The Importance of Vector Control for the Control and Elimination of Vector-Borne Diseases. PLoS Negl. Trop. Dis. 2020, 14, e0007831. [Google Scholar] [CrossRef]
- Pridgeon, J.W.; Pereira, R.M.; Becnel, J.J.; Allan, S.A.; Clark, G.G.; Linthicum, K.J. Susceptibility of Aedes aegypti, Culex quinquefasciatus Say, and Anopheles quadrimaculatus Say to 19 Pesticides with Different Modes of Action. J. Med. Entomol. 2008, 45, 82–87. [Google Scholar] [CrossRef]
- Hemingway, J.; Ranson, H.; Magill, A.; Kolaczinski, J.; Fornadel, C.; Gimnig, J.; Coetzee, M.; Simard, F.; Roch, D.K.; Hinzoumbe, C.K.; et al. Averting a Malaria Disaster: Will Insecticide Resistance Derail Malaria Control? Lancet 2016, 387, 1785–1788. [Google Scholar] [CrossRef]
- Fuska, J.; Fuskova, A.; Nemec, P. Vermistatin, an Antibiotic with Cytotoxic Effects, Produced from Penicillium vermiculatum. Biologia 1979, 34, 735–739. [Google Scholar]
- Fuska, J.; Uhrín, D.; Proksa, B.; Votický, Z.; Ruppeldt, J. The Structure of Vermistatin, a New Metabolite from Penicillium vermiculatum. J. Antibiot. 1986, 39, 1605–1608. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Gao, Q.; Hu, Y.; Shi, Y.; Yan, X.; Ding, L.; He, S. Dibetanide, a New Benzofuran Derivative with the Rare Conjugated Triene Side Chain from a Sponge-Associated Fungus Aspergillus Species. J. Mol. Struct. 2023, 1271, 134082. [Google Scholar] [CrossRef]
- Bai, M.; Zheng, C.J.; Tang, D.Q.; Zhang, F.; Wang, H.Y.; Chen, G.Y. Two New Secondary Metabolites from a Mangrove-Derived Fungus Cladosporium sp. JS1-2. J. Antibiot. 2019, 72, 779–782. [Google Scholar] [CrossRef]
- Xia, X.K.; Huang, H.R.; She, Z.G.; Cai, J.W.; Lan, L.; Zhang, J.Y.; Fu, L.W.; Vrijmoed, L.L.P.; Lin, Y.C. Structural and Biological Properties of Vermistatin and Two New Vermistatin Derivatives Isolated from the Marine-Mangrove Endophytic Fungus Guignardia sp. No.4382. Helv. Chim. Acta 2007, 90, 1925–1931. [Google Scholar] [CrossRef]
- Gubiani, J.R.; Wijeratne, E.M.K.; Shi, T.; Araujo, A.R.; Arnold, A.E.; Chapman, E.; Gunatilaka, A.A.L. An Epigenetic Modifier Induces Production of (10′S)-Verruculide B, an Inhibitor of Protein Tyrosine Phosphatases by Phoma sp. Nov. LG0217, a Fungal Endophyte of Parkinsonia Microphylla. Bioorg. Med. Chem. 2017, 25, 1860–1866. [Google Scholar] [CrossRef]
- Arai, M.; Tomoda, H.; Okuda, T.; Wang, H.; Tabata, N.; Masuma, R.; Yamaguchi, Y.; Omura, S. Funicone-Related Compounds, Potentiators of Antifungal Miconazole Activity, Produced by Talaromyces flavus FKI-0076. J. Antibiot. 2002, 55, 172–180. [Google Scholar] [CrossRef]
- Chen, J.; Xu, Z.; Liu, Y.; Yang, F.; Guan, L.; Yang, J.; Li, J.; Niu, G.; Li, J.; Jin, L. Talaromyces sp. Ethyl Acetate Crude Extract as Potential Mosquitocide to Control Culex pipiens quinquefasciatus. Molecules 2023, 28, 6642. [Google Scholar] [CrossRef]
- Cerracchio, C.; Salvatore, M.M.; Del Sorbo, L.; Serra, F.; Amoroso, M.G.; DellaGreca, M.; Nicoletti, R.; Andolfi, A.; Fiorito, F. In Vitro Evaluation of Antiviral Activities of Funicone-like Compounds Vermistatin and Penisimplicissin against Canine Coronavirus Infection. Antibiotics 2023, 12, 1319. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Xia, G.; Chen, S.; Liu, Y.; Li, H.; She, Z. Eurothiocin a and B, Sulfur-Containingbenzofurans from a Soft Coral-Derived Fungus Eurotium Rubrum SH-823. Mar. Drugs 2014, 12, 3669–3680. [Google Scholar] [CrossRef]
- Liu, Y.; Xia, G.; Li, H.; Ma, L.; Ding, B.; Lu, Y.; He, L.; Xia, X.; She, Z. Vermistatin Derivatives with α-Glucosidase Inhibitory Activity from the Mangrove Endophytic Fungus Penicillium SpHN29-3B1. Planta Med. 2014, 80, 912–917. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Karungu, S.; Cai, Q.; Yuan, Z.; Hu, X. Effects of Propoxur Exposure on Insecticidal Susceptibility and Developmental Traits in Culex pipiens quinquefasciatus. Insects 2019, 10, 288. [Google Scholar] [CrossRef]
- Su, T.; Cheng, M.L. Laboratory Selection of Resistance to Spinosad in Culex quinquefasciatus (Diptera: Culicidae). J. Med. Entomol. 2014, 51, 421–427. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. Fastp: An Ultra-Fast All-in-One FASTQ Preprocessor. Bioinformatics 2018, 34, 884–890. [Google Scholar] [CrossRef]
- Kim, D.; Langmead, B.; Salzberg1, S.L. HISAT: A Fast Spliced Aligner with Low Memory Requirements Daehwan HHS Public Access. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [PubMed]
- Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.-C.; Mendell, J.T.; Salzberg, S.L. StringTie Enables Improved Reconstruction of a Transcriptome from RNA-Seq Reads. Physiol. Behav. 2015, 33, 290–295. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated Estimation of Fold Change and Dispersion for RNA-Seq Data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Delannay, C.; Goindin, D.; Kellaou, K.; Ramdini, C.; Gustave, J.; Vega-Rúa, A. Multiple Insecticide Resistance in Culex quinquefasciatus Populations from Guadeloupe (French West Indies) and Associated Mechanisms. PLoS ONE 2018, 13, e0199615. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2-ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
- Reid, W.R.; Zhang, L.; Liu, F.; Liu, N. The Transcriptome Profile of the Mosquito Culex quinquefasciatus Following Permethrin Selection. PLoS ONE 2012, 7, e47163. [Google Scholar] [CrossRef] [PubMed]
- David, J.P.; Coissac, E.; Melodelima, C.; Poupardin, R.; Riaz, M.A.; Chandor-Proust, A.; Reynaud, S. Transcriptome Response to Pollutants and Insecticides in the Dengue Vector Aedes aegypti Using Next-Generation Sequencing Technology. BMC Genom. 2010, 11, 216. [Google Scholar] [CrossRef] [PubMed]
- Djouaka, R.F.; Bakare, A.A.; Coulibaly, O.N.; Akogbeto, M.C.; Ranson, H.; Hemingway, J.; Strode, C. Expression of the Cytochrome P450s, CYP6P3 and CYP6M2 Are Significantly Elevated in Multiple Pyrethroid Resistant Populations of Anopheles gambiae s.s. from Southern Benin and Nigeria. BMC Genom. 2008, 9, 538. [Google Scholar] [CrossRef] [PubMed]
- Vontas, J.; David, J.P.; Nikou, D.; Hemingway, J.; Christophides, G.K.; Louis, C.; Ranson, H. Transcriptional Analysis of Insecticide Resistance in Anopheles stephensi Using Cross-Species Microarray Hybridization. Insect Mol. Biol. 2007, 16, 315–324. [Google Scholar] [CrossRef]
- Gong, Y.; Diao, Q. Current Knowledge of Detoxification Mechanisms of Xenobiotic in Honey Bees. Ecotoxicology 2017, 26, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Liu, N. Insecticide Resistance in Mosquitoes: Impact, Mechanisms, and Research Directions. Annu. Rev. Entomol. 2015, 60, 537–559. [Google Scholar] [CrossRef] [PubMed]
- Khan, M.M.; Khan, A.H.; Ali, M.W.; Hafeez, M.; Ali, S.; Du, C.; Fan, Z.; Sattar, M.; Hua, H. Emamectin Benzoate Induced Enzymatic and Transcriptional Alternation in Detoxification Mechanism of Predatory Beetle Paederus fuscipes (Coleoptera: Staphylinidae) at the Sublethal Concentration. Ecotoxicology 2021, 30, 1227–1241. [Google Scholar] [CrossRef]
- Lushchak, V.I.; Matviishyn, T.M.; Husak, V.V.; Storey, J.M.; Storey, K.B. Pesticide Toxicity: A Mechanistic Approach. EXCLI J. 2018, 17, 1101–1136. [Google Scholar] [CrossRef] [PubMed]
- Siddiqui, J.A.; Luo, Y.; Sheikh, U.A.A.; Bamisile, B.S.; Khan, M.M.; Imran, M.; Hafeez, M.; Ghani, M.I.; Lei, N.; Xu, Y. Transcriptome Analysis Reveals Differential Effects of Beta-Cypermethrin and Fipronil Insecticides on Detoxification Mechanisms in Solenopsis Invicta. Front. Physiol. 2022, 13, 1–18. [Google Scholar] [CrossRef] [PubMed]
- Gong, Y.; Li, T.; Feng, Y.; Liu, N. The Function of Two P450s, CYP9M10 and CYP6AA7, in the Permethrin Resistance of Culex quinquefasciatus. Sci. Rep. 2017, 7, 587. [Google Scholar] [CrossRef] [PubMed]
- Kasai, S.; Weerashinghe, I.S.; Shono, T.; Yamakawa, M. Molecular Cloning, Nucleotide Sequence and Gene Expression of a Cytochrome P450 (CYP6F1) from the Pyrethroid-Resistant Mosquito, Culex quinquefasciatus Say. Insect Biochem. Mol. Biol. 2000, 30, 163–171. [Google Scholar] [CrossRef] [PubMed]
- Komagata, O.; Kasai, S.; Tomita, T. Overexpression of Cytochrome P450 Genes in Pyrethroid-Resistant Culex quinquefasciatus. Insect Biochem. Mol. Biol. 2010, 40, 146–152. [Google Scholar] [CrossRef] [PubMed]
- Yang, T.; Liu, N. Genome Analysis of Cytochrome P450s and Their Expression Profiles in Insecticide Resistant Mosquitoes, Culex quinquefasciatus. PLoS ONE 2011, 6, e29418. [Google Scholar] [CrossRef]
- Zhang, C.; Shi, Q.; Li, T.; Cheng, P.; Guo, X.; Song, X.; Gong, M. Comparative Proteomics Reveals Mechanisms That Underlie Insecticide Resistance in Culex pipiens pallens Coquillett. PLoS Negl. Trop. Dis. 2021, 15, e0009237. [Google Scholar] [CrossRef] [PubMed]
- Balabanidou, V.; Kampouraki, A.; Maclean, M.; Blomquist, G.J.; Tittiger, C.; Juárez, M.P.; Mijailovsky, S.J.; Chalepakis, G.; Anthousi, A.; Lynd, A.; et al. Cytochrome P450 Associated with Insecticide Resistance Catalyzes Cuticular Hydrocarbon Production in Anopheles gambiae. Proc. Natl. Acad. Sci. USA 2016, 113, 9268–9273. [Google Scholar] [CrossRef] [PubMed]
- Poupardin, R.; Riaz, M.A.; Vontas, J.; David, J.P.; Reynaud, S. Transcription Profiling of Eleven Cytochrome P450s Potentially Involved in Xenobiotic Metabolism in the Mosquito Aedes aegypti. Insect Mol. Biol. 2010, 19, 185–193. [Google Scholar] [CrossRef] [PubMed]
- Riaz, M.A.; Chandor-Proust, A.; Dauphin-Villemant, C.; Poupardin, R.; Jones, C.M.; Strode, C.; Régent-Kloeckner, M.; David, J.P.; Reynaud, S. Molecular Mechanisms Associated with Increased Tolerance to the Neonicotinoid Insecticide Imidacloprid in the Dengue Vector Aedes aegypti. Aquat. Toxicol. 2013, 126, 326–337. [Google Scholar] [CrossRef]
- Logan, R.A.E.; Mäurer, J.B.; Wapler, C.; Ingham, V.A. Uridine Diphosphate (UDP)-Glycosyltransferases (UGTs) Are Associated with Insecticide Resistance in the Major Malaria Vectors Anopheles gambiae s.l and Anopheles funestus. Sci. Rep. 2024, 14, 19821. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Fu, W.B.; Si, F.L.; Yan, Z.T.; Zhang, Y.J.; He, Q.Y.; Chen, B. UDP-Glycosyltransferase Genes and Their Association and Mutations Associated with Pyrethroid Resistance in Anopheles sinensis (Diptera: Culicidae). Malar. J. 2019, 18, 62. [Google Scholar] [CrossRef] [PubMed]
- Lu, H.; Xu, Y.; Cui, F. Phylogenetic Analysis of the ATP-Binding Cassette Transporter Family in Three Mosquito Species. Pestic. Biochem. Physiol. 2016, 132, 118–124. [Google Scholar] [CrossRef]
- Xu, J.; Zheng, J.; Zhang, R.; Wang, H.; Du, J.; Li, J.; Zhou, D.; Sun, Y.; Shen, B. Identification and Functional Analysis of ABC Transporter Genes Related to Deltamethrin Resistance in Culex pipiens pallens. Pest Manag. Sci. 2023, 79, 3642–3655. [Google Scholar] [CrossRef] [PubMed]
Gene Identity | Forward Primer Sequence (5′–3′) | Reverse Primer Sequence (5′–3′) |
---|---|---|
RPL8 | GCTGGCCGAAGGTGCGTGGT | TTGCGACCTGGCGGCGTTCC |
CPIJ000293 | TGCTGCTGTGCTCCACTC | GTCTTCGCTGGTGCCACT |
CPIJ001759 | CCGCCGGAAGATGCTTGA | GACTCAGTGGCTTGCCGT |
CPIJ001886 | GCTCGCGGAACTGCATTG | GAGCGATTCCCCGGGAAG |
CPIJ005954 | TGACGATGGTGCGCAGTT | ATGCTACCCTCAGCCGGA |
CPIJ006721 | GCGGATGGTCGAGATGCA | TTGCCTTCGCCATCAGCA |
CPIJ010226 | TCGGATGTGCATCGGACG | GCGCTCAAGATGTGCAGC |
CPIJ010541 | AACGTGAGGCGCATGGAA | ACCGTTGCGAATCCTGCA |
CPIJ010545 | TTTCGGCGCCAGTGACAT | CAACGTCGATCGCATGCG |
CPIJ012943 | GATGGAGCGACGGATGGG | TCGCTACCAACGCTTGCA |
CPIJ013918 | TCAGCGCGCGATCGTAAT | CCCGTTCCATCCGAGAGC |
CPIJ018233 | TGTGGAGGCTCTGCGTTG | ACCCGGTTGCCTTGTGAG |
CPIJ018494 | GCGCTGGTGGTGTTTGTG | CCAGATTGCCCGTCAGCA |
Samples | Raw Reads | Clean Reads | Clean Bases | GC (%) | Q20 (%) | Q30 (%) |
---|---|---|---|---|---|---|
CK1 | 52,305,134 | 51,926,458 | 7,774,431,980 | 50.78 | 98.83 | 96.31 |
CK1 | 54,364,436 | 53,963,162 | 8,088,174,870 | 50.82 | 98.81 | 96.22 |
CK1 | 50,451,260 | 50,074,842 | 7,509,214,644 | 50.63 | 98.82 | 96.27 |
Ver1 | 48,439,190 | 48,129,304 | 7,208,948,179 | 50.44 | 98.84 | 96.32 |
Ver2 | 51,960,662 | 51,575,346 | 7,723,510,476 | 50.26 | 98.76 | 96.09 |
Ver3 | 50,653,416 | 50,240,476 | 7,532,355,356 | 50.45 | 98.8 | 96.21 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, J.; Xu, Z.; Yang, F.; Yang, J.; Kuang, W.; Li, J.; Wang, Y.; Jin, L. Transcriptome Analysis of Culex pipiens quinquefasciatus Larvae Exposed to a Semi-Lethal Dose of Vermistatin. Trop. Med. Infect. Dis. 2025, 10, 31. https://doi.org/10.3390/tropicalmed10020031
Chen J, Xu Z, Yang F, Yang J, Kuang W, Li J, Wang Y, Jin L. Transcriptome Analysis of Culex pipiens quinquefasciatus Larvae Exposed to a Semi-Lethal Dose of Vermistatin. Tropical Medicine and Infectious Disease. 2025; 10(2):31. https://doi.org/10.3390/tropicalmed10020031
Chicago/Turabian StyleChen, Junhui, Zhiyong Xu, Feiying Yang, Jian Yang, Wendong Kuang, Jianghuai Li, Yaqi Wang, and Liang Jin. 2025. "Transcriptome Analysis of Culex pipiens quinquefasciatus Larvae Exposed to a Semi-Lethal Dose of Vermistatin" Tropical Medicine and Infectious Disease 10, no. 2: 31. https://doi.org/10.3390/tropicalmed10020031
APA StyleChen, J., Xu, Z., Yang, F., Yang, J., Kuang, W., Li, J., Wang, Y., & Jin, L. (2025). Transcriptome Analysis of Culex pipiens quinquefasciatus Larvae Exposed to a Semi-Lethal Dose of Vermistatin. Tropical Medicine and Infectious Disease, 10(2), 31. https://doi.org/10.3390/tropicalmed10020031