Next Article in Journal
Arbuscular Mycorrhizae Contribute to Growth, Nutrient Uptake, and Ornamental Characteristics of Statice (Limonium sinuatum [L.] Mill.) Subject to Appropriate Inoculum and Optimal Phosphorus
Next Article in Special Issue
Fungicidal Effect of Guava Wood Vinegar against Colletotrichum coccodes Causing Black Dot Disease of Potatoes
Previous Article in Journal
Effects of CO2 Enrichment on Carbon Assimilation, Yield and Quality of Oriental Melon Cultivated in a Solar Greenhouse
Previous Article in Special Issue
Resistance of Tunisian Melon Landraces to Podosphaera xanthii
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 9
Issue 5
10.3390/horticulturae9050562
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Natural Products Obtained from Argentinean Native Plants Are Fungicidal against Citrus Postharvest Diseases

by
Norma Hortensia Alvarez
1,2,
María Inés Stegmayer
1,
Gisela Marisol Seimandi
1,*,
José Francisco Pensiero
1,2,
Juan Marcelo Zabala
1,2,
María Alejandra Favaro
1,2 and
Marcos Gabriel Derita
1,3,*
1
ICiAgro LitoraL, Universidad Nacional del Litoral, CONICET, Kreder 2805, Esperanza, Santa Fe 3080HOF, Argentina
2
Facultad de Ciencias Agrarias, Universidad Nacional del Litoral, Kreder 2805, Esperanza, Santa Fe 3080HOF, Argentina
3
Cátedra de Farmacognosia, Facultad de Ciencias Bioquímicas y Farmacéuticas, Universidad Nacional de Rosario, Suipacha 531, Rosario, Santa Fe S2002LRK, Argentina
*
Authors to whom correspondence should be addressed.
Horticulturae 2023, 9(5), 562; https://doi.org/10.3390/horticulturae9050562
Submission received: 31 March 2023 / Revised: 28 April 2023 / Accepted: 5 May 2023 / Published: 9 May 2023
(This article belongs to the Special Issue Sustainable Control Strategies of Plant Pathogens in Horticulture)
Browse Figures
Review Reports Versions Notes

Abstract

:
Natural products obtained from plants constitute an alternative to chemically synthesized fungicides, whose improper use might have caused the development of resistant fungal strains. In the present work, 40 products obtained from 20 native Argentinean plant species were tested against three citrus postharvest pathogens: Penicillium digitatum, Penicillium italicum, and Geotrichum citri-aurantii. Natural products were obtained by classical solvent extraction methods and the fungicidal evaluation was carried out by agar diffusion tests using commercial fungicides as negative controls and dimethyl sulfoxide as a positive one. The inhibition percentages were determined 7 and 14 days post inoculation of each fungus. Most of the products tested showed inhibition percentages higher than 50% for G. citri-aurantii, but only 20% of them were active against P. digitatum and P. italicum. The most promising products which inhibited (100%) the growth of at least one of the three phytopathogens were extracted from the following plants: Orthosia virgata, Petiveria alliacea, Funastrum clausum, Solanum caavurana, and Solanum pilcomayense. These products were tested over inoculated oranges and there were no statistically significant differences between the treatments with a commercial fungicide and the methanolic extract in the control of fruit rot. The products extracted from native plants have fungicide potential, but further studies are required.

Graphical Abstract

1. Introduction

Fruits of Citrus spp. (Rutaceae) are cultivated in more than one hundred countries and their fruits are widely consumed throughout the world. Postharvest handling tries to achieve the highest quality fruits, increasing their postharvest life and reducing production losses, thus obtaining commercially suitable fruits [1]. According to the latest estimates by Federcitrus (2022), Argentina produces 1,038,168 tons of oranges; 77,000 of them are destined for the export market [2]. Postharvest losses produced by phytopathogenic origin (approximately 30% of the production) are considered of economic importance. Green and blue molds, caused by Penicillium digitatum (Pers.: Fr.) Sacc. and Penicillium italicum Wehmer, respectively (order Eurotiales, Aspergillaceae family), and sour rot caused by Geotrichum citri-aurantii Ferraris (order Saccharomycetales, Dipodascaceae family), are the most economically important postharvest diseases as they affect not only the quantity but also the quality of citrus fruits which, once infected, must be discarded from the production lot [1,2,3,4,5]. Penicillium digitatum and P. italicum cause citrus diseases by invading wounds in the fruit rind. Wounds occur during the harvest and subsequent handling of fruit in the packinghouse or during commercialization, but some infections can occur before harvest through injuries, cracks, or wounds made by insects in the field. In this case, the fruit infected long before harvest usually drops from the tree, but fruit infected three days before harvest cannot be detected and may be harvested, becoming a source of contamination [2]. A circular area surrounding the infection site (rind wound) appears water-soaked, soft, and decolorized. In the meantime, the fungus grows, and an aerial white mycelium develops in the center of the lesion and expands radially. In the case of green mold, after 7–8 days the central area of the lesion becomes olive green colored and surrounded by a broad band of dense and non-sporulating white mycelium. In contrast, blue mold presents a central sporulating area, blue or bluish green colored [1].
Geotrichum citri-aurantii causes sour rot; this fungus lives in dead plant tissue or orchard soils and it may cause diseases in fruits. Symptoms include maceration and disintegration of the fruit cuticle and pulp. Once the fruits rot, they generate a strong fermented and rancid smell. If high humidity conditions are present, a very thin white mycelium appears on the fruits, rapidly disappearing [3,4].
These three postharvest diseases have been controlled worldwide for many years solely by the application of conventional fungicides after harvest such as (1) Imazalil (IMZ) [(RS)-1-(β-allyloxy-2,4-dichlorophenethyl) imidazole], which constitutes the most common fungicide employed postharvest by the citrus industry; (2) Thiabendazole (TBZ) [2-(1,3-thiazol-4-yl) benzimidazole], which belongs to the benzimidazole group of fungicides and has been used for the control of citrus molds; (3) Sodium ortho-phenylphenate (SOPP) [sodium (1,1′-biphenyl)-2-olate], which is currently used in combinate fungicide formulations; (4) Guazatine and propiconazole, which have been used in Europe, South Africa, and Australia for the control of G. citri-aurantii; and finally, pyrimethanil (PYR) (4,6-dimethyl-N-phenyl-2-pyrimidinamine], fludioxonil (FLU) [4-(2,2-difluoro-1,3-benzodioxol-4-yl)-1H-pyrrole-3-carbonitrile, azoxystrobin (AZX) [methyl-(2E)-2-{2-[6-(2-cyanophenoxy) pyrimidin-4-yloxy] phenyl}-3-methoxyacrylate], and Trifloxystrobin (TFX) (methyl-(E)-methoxyimino-{(E)-α-[1-(α,α,α-trifluoro-m-tolyl) ethylideneaminoxy]-o-tolyl}acetate) are classified as “reduced-risk” fungicides [1,5]. IMZ and TBZ are used alone, in mixtures, or separately applied in sequence. These have constituted the most widely used treatments for more than 25 years, which has contributed to the proliferation of resistant fungal strains [6]. Consequently, the excessive or inadequate use of these fungicides represents a risk to human and animal health, due to food contamination and the accumulation of toxic residues in the environment. Due to marketing globalization and climate change, the problem is growing at an accelerated pace [7,8].
In this context, there are some new alternatives for the control of diseases that occur in citrus postharvest, such as biological control, natural products obtained from different sources, and thermotherapy [9]. Biological control is based on the utilization of antagonistic microorganisms to reduce/keep the population of some phytopathogens below the levels that cause economic losses [10]. Another alternative is the use of natural products obtained from plant extracts or essential oils, which have revealed non-toxic action and biodegradability but are potent antibiotics against phytopathogens [8,11,12]. Finally, through cycles of considerable temperature changes on fruits, fungal infections can be reduced [9].
Plants provide unlimited opportunities for evaluating and isolating new antifungal compounds because of their vast chemical diversity; in fact, numerous antifungal compounds currently used against human pathogens have been isolated from them [13,14].
The aim of this study consisted of the discovery of new botanical products obtained from native Argentinean species with potential fungicide properties. For this, we selected 20 native plants from the central zone of Argentina which were evaluated for their fungicide properties against morphologically and molecularly characterized strains of P. italicum, P. digitatum, and G. citri-aurantii (isolated from citrus that presented the correspondent disease symptoms), by using a high-throughput and simple bioassay. Data were collected 7 and 14 days after fungal inoculation and each sample was classified according to its fungal growth inhibition percentage. Statistical analyses were performed based on the part of each plant used and the type of extract in which the most active compounds might be present. The methanolic extract obtained from S. pilcomayense was evaluated over postharvest oranges artificially inoculated with P. digitatum. Finally, a discussion on the most active species, their ethnopharmacological uses, and phytochemistry, was accomplished.

2. Materials and Methods

2.1. Plant Material

The plants were collected from farms and at the side of roads in areas surrounding the Litoral region of Argentina, between the years 2019 and 2020. Each plant sample was identified, and a Voucher Specimen was deposited in the Herbarium of the FCA-UNL “Arturo Ragonese” (Herbario SF), Kreder 2805-(3080HOF)-Esperanza, Argentina (Table 1). After harvesting, the plants were dried in a suitable environment (a dark room with low relative humidity), while their different parts (leaves, flowers, fruits, or the whole plant) were separated according to the type of extract that had to be prepared. Three species (Orthosia virgata, Solanum argentinum, and Solanum pilcomayense) were collected in different zones to detect differences in their bioactivities which may be associated with phytochemical changes determined by the environment.

2.2. Extraction Process

For the preparation of the extracts, air-dried aerial parts of each species (100 g) were pulverized and successively macerated with 250 mL of dichloromethane (DCM) and 250 mL of methanol (MeOH) under mechanical stirring (3 × 24 h each) to obtain the corresponding extracts after filtration and evaporation. These solvents were selected based on their differential extraction capability of less polar metabolites (DCM) and more polar metabolites (MeOH). In this way, most of the compounds present in the plant species under study were extracted.

2.3. Fungal Strains

Monosporic strains of Geotrichum and Penicillium spp. called NA1, NA2, and NA3 were obtained from orange fruits that presented typical symptoms of sour rot, green mold rot, and blue mold rot, and cultivated in Potato-Dextrose-Agar medium (PDA) [15,16,17,18]. The strains were morphologically characterized and conserved in the Mycology Reference Center (CEREMIC-UNR, Rosario, Argentina) under the codes CCC-5-2019 (NA1), CCC-102 (NA2), and CCC-101 (NA3). Isolates were also conserved at −20 °C on dried filter paper in the mycological collection of ICiAgro Litoral, UNL, CONICET, FCA, Argentina.

2.4. Molecular Characterization

The identity of the isolates was confirmed through molecular characterization. For that, fungal genomic DNA was extracted from 7-day-old cultures grown on PDA at 20–25 °C as described in Gupta et al. [15] and was used as the template for PCR amplification of a segment of the ITS (Internal Transcribed Spacer) region of ribosomal nuclear DNA (rDNA) using the primers ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAAGG) [16]. PCR reactions were performed on a Techne TC-312 thermal cycler (Techne, Cambridge, UK) in 20 µL reaction mixtures containing 1× PCR buffer, 2.5 mM MgCl2, 0.4 µM each primer, 0.2 mM dNTPs, 1 U of Taq DNA polymerase (PB-L, Productos Bio-Lógicos®, Rosario, Argentina), and 100 ng of genomic DNA. Amplifications were programmed to carry out an initial denaturation at 94 °C for 5 min, followed by 36 cycles, each consisting of a denaturation step at 94 °C for 30 s, an annealing step, and an extension step at 57 °C for 30 s and at 72 °C for 30 s. The final extension was carried out at 72 °C for 7 min. PCR products were visualized under ultraviolet light on 1.5% (w/v) agarose gel in 1× TAE buffer stained with GelRed (Biotium Inc., Fremont, CA, USA). A UST-30M-8E, Biostep transilluminator (Biostep, Jahnsdorf, Germany) was used. The amplified products were purified and sequenced with the same primers in Macrogen (Seoul, Republic of Korea). The identification was performed by comparing the sequences with all fungal sequences of the GenBank Nucleotide Database hosted by the National Center for Biotechnology Information (NCBI, https://www.ncbi.nlm.nih.gov/ accessed on 15 December 2022) using BLASTn (Nucleotide Basic Local Alignment Search Tool) [17]. All the sequences generated in this study were deposited in GenBank.
The inoculum for bioassays was obtained according to the Clinical & Laboratory Standards Institute reported procedures and adjusted to 1 × 104 Colony Forming Units (CFU) mL−1 [18].

2.5. In Vitro Susceptibility Test

Diffusion tests were carried out using 9 cm diameter sterile Petri dishes provided with four divisions so that each sample was tested in quadruplicate. Plant extract solutions were prepared at a concentration of 50 mg mL−1 in DMSO and once dissolved, 400 µL of this stock solution was diluted in 20 mL of molten PDA culture medium. After vigorous shaking and before the mixture was solidified, 5 mL was poured into each of the four compartments of the Petri dishes and cooled down. A conidia concentration between 104 and 105 CFU mL−1 was inoculated inside a well located in the center of each compartment once the medium containing 1000 ppm of each plant extract was solidified, according to our previous methodology developed and published [7,13]. A negative control was prepared using the commercial fungicide Imazalil® and the solvent DMSO without plant extract served as a positive (growth) control. Once the mycelium of the control plates completely covered the surface of the medium (approximately 7 days), the mycelium diameter of each plant-treated plate was carried out by scanning the plates with ImageJ® software [19]. The average inhibition percentages with their standard deviations were determined at 7 and 14 days after inoculation.

2.6. Fungicidal Assays on Wounded Oranges Using S. pilcomayense Methanolic Extract

Oranges (cv. “Salustiana”) were harvested from the Experimental Field of Intensive and Forestry Crops (Facultad de Ciencias Agrarias, Universidad Nacional del Litoral) at the mature stage and sorted based on size and absence of physical injuries or disease infection. They were artificially inoculated with P. digitatum following the methodology described by Di Liberto et al. [20]. Three groups of 10 oranges were used: (1) control with sterile water, (2) treatment with 3000 ppm aqueous solution of S. pilcomayense methanolic extract, and (3) treatment with 3000 ppm aqueous solution of Imazalil®. The treatments were carried out after 2 h of inoculation, by 5 s immersion of each fruit into a beaker with the corresponding solutions mentioned above. For the in vivo test, the 3000 ppm concentration of the extract was chosen because we did not have a good response when we treated the fruits with a 1000 ppm concentration. So, we decided to hardly increase the fungicidal concentration resulting from the in vitro assays.
The fruits were stored at 25 °C and 85% RH for 14 days. After storage, the degree of P. digitatum sporulation on the surface of decayed fruits was evaluated on a 0 to 4 scale (sporulation index). With this scale, the severity of the disease was visually quantified assuming the following values: 0 (negligible sporulation); 1 (fruit with lesions on up to 10% of its surface); 2 (fruit with injuries on between 10 and 30% of its surface); 3 (fruit with lesions on between 30 and 50% of its surface); and 4 (refers to dense fungal sporulation over the entire fruit that infected more than 50% of its surface) [20]. The sporulation index for each fruit was treated as a replicate, and each treatment mean was subjected to statistical analysis.

2.7. Statistical Analysis

For the in vitro test, the differences in the mean percentage of fungal growth in the presence of each extract were compared with positive and negative controls by statistical analysis with a 95% Confidence Interval (CI) according to our published results [13].
For the in vivo test, experimental data were analyzed statistically by one-way ANOVA followed by Tukey’s multiple comparison tests (α = 0.05) using the GraphPad Prism 7.0 software and according to Di Liberto et al. [20].

3. Results

3.1. Plant Extract Yields

The part of each plant used and the corresponding DCM and MeOH extract yields (g/100 g of dried plant material) are provided in Table 2. For the cases of duplicated species under study, O. virgata showed similar crude extract percentages (2.4 and 2.3 for DCM extracts; 4.1 and 5.0 for MeOH extracts), but S. argentinum and S. pilcomayense presented differences in DCM yields and both (DCM and MeOH) yields, respectively.

3.2. Fungicidal Evaluation of the Selected Plant Extracts against P. digitatum, P. italicum, and G. citri-aurantii

Fungal isolates NA1, NA2, and NA3 were morphologically identified by CEREMIC-UNR as G. citri-aurantii (CCC-5-2019), P. digitatum (CCC-102), and P. italicum (CCC-101), respectively. Figure 1 shows the typical symptoms and signs caused by each fungus on oranges, the morphological characteristics of the colonies developed after isolation, and the microscopic features of their conidia. Typical green, blue, and white sporulation were observed above the rots and in the plates.
To confirm morphological identification, DNA was extracted from the three fungal isolates, and the ITS region was amplified and sequenced. BLASTn searches revealed that the fungal isolate sequences NA1, NA2, and NA3 presented 99.4%, 100%, and 100% of identity with previously characterized strains of G. citri-aurantii (EU131181, [21]), P. digitatum (MT448740, [22]), and P. italicum (MK736929, [23]), respectively. The nucleotide sequences were deposited in GenBank (accession numbers OQ132875, OQ132876, and OQ132877 for NA1, NA2, and NA3 isolates, respectively).
Table 3 shows the fungicidal activities (percentages of inhibition in quadruplicate using the agar diffusion test) of 40 extracts obtained from different parts of 20 plant species evaluated against the orange phytopathogens P. digitatum, P. italicum, and G. citri-aurantii determined 7 days post inoculation. Table 4 shows the fungicidal activities of the plant extracts under study, but now determined 14 days post inoculation.
From Table 3 and Table 4, many comments should be highlighted: Among all the DCM extracts obtained from the 20 species evaluated against P. digitatum, none of them presented 100% of inhibition, but the most active ones after 7 days of incubation were obtained from T. tricholepis, A. inundata, and P. stelligerum (80.0, 79.3, and 75.2% of fungal growth inhibition). These percentages decreased after 14 days of incubation to 76.8, 67.2%, and 50.2%, respectively. Penicillium italicum inhibition by DCM extracts was lower than for P. digitatum since no extract of this type exceeded 70% growth inhibition at 7 days post inoculation. In contrast, many DCM extracts showed high inhibition against G. citri-aurantii (O. virgata, T. tricholepis, A. inundata, P. lapathifolium, and some species of Solanum diminished the fungal growth by more than 70%) and remarkably, F. clausum and P. alliacea completely interrupted the growth of G. citri-aurantii even 14 days after inoculation, representing potent fungicide products.
Regarding MeOH extracts, it can be observed that they were more active than DCM extracts. Orthosia virgata, F. clausum, T. tricholepis, P. alliacea, and S. caavurana methanolic extracts inhibited the growth of P. digitatum by more than 80%. Moreover, A. inundata and the two collections of S. pilcomayense presented 100% P. digitatum inhibition even more than 14 days after inoculation. P. italicum inhibition by methanolic extracts was not as high as P. digitatum inhibition: P. alliacea and S. caavurana extracts inhibited 81.3 and 87.8%, respectively, but this activity diminished after 14 days. Remarkably, A. inundata and both collections of S. pilcomayense maintained their P. italicum 100% inhibition activity for more than 14 days. Concerning G. citri-aurantii inhibition by methanolic extracts, it was 100% inhibited for more than 14 days by O. virgata and both collections of S. pilcomayense and S. caavurana, with the activity of A. inundata also being remarkable, which showed more than 90% inhibition even at day 14 post inoculation.
An interesting topic to remark on is the case of O. virgata and S. pilcomayense which were collected from two different locations on the same date. The high fungicidal activity of O. virgata was only observed for one of the collections (Gral. Obligado, Santa Fe, 28°42′54.8″ S 59°23′13.7″ W); meanwhile, the potent activity of S. pilcomayense was shown for both collections (Gral. Obligado, Santa Fe, 28°13′42.2″ S 59°06′52.6″ W and San Javier, Santa Fe, 30°03′23.2″ S 59°51′34.8″ W).

3.3. Analysis of the Results by Categories of Fungicidal Action

The results were divided into the following categories for percentage analysis: inactive extract (fungal growth inhibition less than 50%), moderately active extract (fungal growth inhibition between 50 and 80%), and active extract (fungal growth inhibition more than 80%).
None of the DCM extracts tested against P. digitatum were rated as active according to the above classification, but 80% of them were moderately active and 20% appeared to be inactive after 7 days of inoculation. The percentage of moderately active DCM extracts decreased from 80% to 45% and the percentage of inactive ones increased from 20% to 55%. These results may suggest that some DCM extracts could be fungistatic for a short period but not fungicidal. For P. italicum, most of the DCM extracts were inactive (90%), with only 10% of them moderately active after 7 days. This fungus represents the most resistant to DCM extracts among the three phytopathogenic strains under study. In contrast, G. citri-aurantii was the most susceptible phytopathogen to DCM extracts, since 35% of them were active at 7 days but decreased to 20% at 14 days after inoculation, 60% were moderately active after 7 days and decreased to 15% after 14 days, and the percentage of inactive DCM extracts against G. citri-aurantii was 5% after 7 days, increasing to 65% after 14 days (Figure 2).
Regarding MeOH extracts (Figure 3), 55% were active, 35% were moderately active, and 10% were inactive against P. digitatum 7 days post inoculation, and after 14 days 20% were active and 25% of them were moderately active. Additionally, 25, 35, and 40% of MeOH extracts were active, moderately active, and inactive, respectively, against P. italicum 7 days after inoculation; meanwhile, the percentages of active and moderately active extracts decreased after 14 days to 15 and 10%, respectively. The percentages of active MeOH extracts against G. citri-aurantii were the same 7 and 14 days post inoculation (25%), but the moderately active extracts after 7 days (50%) decreased to 0% after 14 days, increasing the percentages of inactive extracts. These results may suggest that the MeOH extracts that displayed strong activities against G. citri-aurantii have potential as fungicides due to their fungicidal activity being maintained for more than 14 days.

3.4. Curative Effect of S. pilcomayense Methanolic Extract over Oranges Infected with P. digitatum

The effect of the most active extract from S. pilcomayense was examined on postharvest fresh oranges cv. “Salustiana” infected with an inoculum of P. digitatum (Figure 4), where the wound-inoculated fruits were treated with the bioactive extract by dipping as described in the Section 2. After 14 days of the treatment applications, no significant differences in the disease severity were observed for both treatments (3000 ppm aqueous solution of S. pilcomayense methanolic extract, and 3000 ppm aqueous solution of Imazalil®). The control fruits (those which had been only inoculated with the pathogen, but not treated with any fungicide) showed marked symptoms of the disease caused by the pathogen (see the sporulation index in each fruit of the control set). Contrarily, both treatments (S. pilcomayense methanolic extract and commercial imazalil) reduced the green mold sporulation index significantly (p = 0.03) with respect to the control oranges, showing no significant differences between them.

4. Discussion

Although a considerable number of native Argentinean plant species were evaluated in this work for their fungicidal properties against three economically important citrus pathogens, only six of them have demonstrated high fungal inhibition. Additionally, the place of collection played an important role in the bioactivity of O. virgata, indicating the importance of environmental conditions on the production of bioactive secondary metabolites [24]. MeOH extracts obtained from all the species produced higher yields than DCM extracts, and this fact may be due to the number and type of molecules that can be extracted by the solvent methanol [24]. Moreover, MeOH extracts were more active than DCM extracts, especially against both species of Penicillium, the two phytopathogens which were more difficult to control in this work. Regarding Geotrichum, both types of extracts (DCM and MeOH) displayed more than 50% inhibition.
A literature review of the six most active species lets us state that they have been hardly evaluated against other microbiological activities, and in some cases a few references were found. Remarking on the importance of our native sources’ knowledge, a discussion about their biological activities and phytochemical studies found in the literature is presented below:
Orthosia virgata (Figure 5a) belongs to the Apocynaceae family and it is commonly known as “Liana de leche” [25]. To the best of our knowledge, there are no reports about the bioactivities and phytochemistry of this species and even its genus, which turns O. virgata into an interesting source to go on studying. The Apocynaceae family has been reported widely for indole-containing compounds which are under clinical use including vinblastine and vincristine (anticancer), atevirdine (anti-HIV), yohimbine (erectile dysfunction), reserpine (antihypertension), ajmalicine (vascular disorders), ajmaline (anti-arrhythmic), and vincamine (vasodilator). The main genera of the Apocynaceae family are Alstonia, Rauvolfia, Kopsia, Ervatamia, and Tabernaemontana. These genera consist of 400 members which represent 20% of Apocynaceae species, but only 30 (7.5%) species were investigated, whereas the rest are promising to be investigated. Orthosia does not belong to the most studied genus of this family, a fact that makes it even more attractive. Monoterpene Indole Alkaloids (MIAs) present in this family, deserve the curiosity and attention of researchers due to their chemical diversity and biological activities. These compounds were considered an impending source of drug lead [26].
Funastrum clausum (Figure 5b) also belongs to the Apocynaceae family and it is commonly known as “Bejuco sapo” [27]. These plants exude sticky white latex containing the endopeptidases funastrain and funastrain c II which exhibit cysteine proteolytic activity [28]. This fact may be the reason why the products obtained from this species provided potent fungicidal action during the assays developed in this work. This was the only report found in the literature for this species and its genus, so it constitutes one of the promising species belonging to the Apocynaceae family mentioned above [26].
Albizia inundata (Figure 5c) belongs to the Fabaceae family and it is commonly known as “Pacará”, “Timbó blanco” or “Palo flojo” [29]. The Albizia genus is phytochemically characterized by the presence of lignanoids, flavonoids, and phenolic glycosides [30]. Moreover, olean-type triterpene saponins isolated from A. inundata exhibited cytotoxicity against melanoma cells and human head and neck squamous cell carcinoma [31,32]. Also, these compounds showed high anti-plasmodial and anticandidal activities probably due to triterpene saponins’ capacity for disrupting cellular membranes [33]. So, it is possible that saponins from A. inundata may be responsible for the anti-phytopathogenic activities found in this work.
Petiveria alliacea (Figure 5d) belongs to the Phytolaccaceae family and it is commonly known as “Guiné”, “Pipi” or “Mucuracaá” [34,35]. Pharmacological studies reported that extracts obtained from different parts of P. alliacea showed diverse effects on animal behavior affecting the central nervous system [35]. Rosado-Aguilar et al. [36] demonstrated that methanolic extracts obtained from the stem and leaves presented 100% larvae and adult mortality of Rhipicephalus microplus. This result proposed that P. alliacea may be a promising acaricide against resistant strains of R. microplus [36]. The antimicrobial activities of P. alliacea have been widely reported: (1) the hexane extracts inhibited Staphylococcus aureus with a Minimum Inhibitory Concentration (MIC) of 240 µg/mL; (2) the methanolic extract showed activity against Enterococcus faecalis (MIC = 240 µg/mL); (3) the hydroalcoholic extract was active against Candida parapsilosis (MIC = 250 µg/mL), C. kefyr and C. albicans (MIC = 760 µg/mL); (4) The tearful principle (Z)-thiobenzaldehyde-S-oxide obtained from P. alliacea demonstrated antimicrobial activity against C. albicans, Klebsiella pneumoniae, Escherichia coli, S. aureus and S. agalactiae [37]. Moreover, thiosulfonates isolated from this plant, and their degradation products inhibited at low concentrations (MIC values ≤ 64 µg/mL) the following microorganisms: Bacillus cereus, Mycobacterium smegmatis, Micrococcus luteus, S. agalactiae, S. aureus, E. coli, Stenotrophomonas maltophila, K. pneumoniae, and the fungus Aspergillus flavus, Mucor racemosus, Pseudallescheria boydii, C. albicans, C. tropicalis and Issatchenkia orientalis [37,38]. A compound named DTS, which is a polysulfide often identified in P. alliacea, led to a reversible disassembly of microtubules through the decrease of the total expression of tubulin (0.1 µM) and caused a decrease in phosphorylation of erk1/erk2 protein kinases (0.5 µM) in SH-SY5Y cell line, what may be the mode of action for its biocidal activities [37]. Some studies affirm that the bioactivity of P. alliacea leaf extracts could be attributed to the main triterpene metabolite named isoarborinol [39].
Solanum pilcomayense (Figure 5e) belongs to the Solanaceae family and it is commonly known as “Tomatillo del monte” [40]. Few reports have been found in the literature about its components or bioactivities; the most highlighting study was performed by Muelas-Serrano et al. [41] who demonstrated some antiprotozoal activity of aerial part extracts against Trypanosoma cruzi and Trichomonas vaginalis [41]. More recently, a study examined the antioxidant compositions and their capacities in three New Zeeland tamarillo (Solanum spp.) cultivars. It showed that tamarillo peels possessed higher amounts of phenolic compounds, total phenolic content, and antioxidant activity than the pulps. Pulps had higher anthocyanins concentration than peels. The antioxidant capacity of tamarillos exhibited relatively high values and was strongly correlated with high total phenolic content. The presence of these bioactive compounds highlights the potential of tamarillo for further utilization in the food and pharmaceutical industries. Tamarillo remains underutilized despite its bioactive components [42].
Finally, S. caavurana (Figure 5f) also belongs to the Solanaceae family and it is commonly known as “Palo agui”, “Laranjinha do mato”, or “Jurubeba-branca” [40]. The ripe fruits of S. caavurana contain a wide variety of steroidal alkaloids such as 4-tomatiden-3-one, 5α-tomatidan-3-one, and caavuranamide as well as glycoalkaloids. Regarding the nutritional components of the fruit, it contains proteins (4.2%), lipids (1.5%), and carbohydrates (56.7%). The bioactive caavuranamide (steroid alkaloid) showed significant antibacterial activity (MIC = 135 µg/mL) against Rhodococcus equi, a similar value to the commercial chloramphenicol (MIC = 124 µg/mL) [43]. Solanaceae fruits constitute a source of food in many countries. In a recent study, the proximate composition of two Solanaceae fruits from Brazilian Cerrado was evaluated. The results showed that the pulp had a high moisture content (74.6–85.4 g/100 g) and soluble fiber (1.3–2.0 g/100 g) content, and low fat, protein, and ash content. Potassium is the main mineral found in both fruits. The major components revealed 24 phenolic compounds, most being hydroxycinnamic acids derivatives and chlorogenic acid. The antioxidant capacity of the fruits ranged from 1.3 to 11.5 µmol TE/100 mL of extract [44]. These results indicated that the Solanum genus can be interesting for the Brazilian fruit market and that it has the potential to be exploited for agroindustry diversification of fruit products. In addition, our work demonstrated the fungicidal capacity of a related species of Solanum.

5. Conclusions

Many efforts have been made to promote reducing the use of chemical fungicides on postharvest fruits worldwide. In this sense, the use of microorganisms as biological controllers has been highly developed in recent decades, but their safety has sometimes been questioned. The high mutation capacity may turn a benefic bacterium into a pathogenic one which could cause plant or human diseases. On the other hand, plant species contain a complex mixture of molecules that should be explored, not only to treat human diseases but also to prevent and control fruit or plant diseases. So, this type of study should be encouraged to reduce the use of agrochemicals, especially in small or familiar farms. In this work, we isolated and characterized (by morphological and molecular means) three strains of the most important citric phytopathogens in our region. Through a high-throughput screening method, we demonstrated that six Argentinean native plants (O. virgata, P. alliacea, F. clausum, A. inundata, S. caavurana, and S. pilcomayense) inhibited 100% of the growth of at least one of the three orange phytopathogens tested (P. digitatum, P. italicum, and G. citri-auranti). Additionally, an aqueous solution of 3000 ppm of S. pilcomayense crude methanolic extract concentration was highly fungicidal on postharvest oranges inoculated with P. digitatum. However, more studies are needed, such as on the chemical standardization of the extracts, their evaluation against other phytopathogens to detect spectra and mechanisms of action, human cytotoxicity, and technological formulations to determine the correct dose for the control of each disease on fruits.

Author Contributions

Conceptualization, N.H.A., G.M.S. and M.G.D.; methodology, N.H.A., M.A.F. and M.G.D.; software, G.M.S., J.M.Z. and M.I.S.; validation, J.F.P., J.M.Z. and M.G.D.; formal analysis, N.H.A., G.M.S., M.A.F. and M.G.D.; investigation, N.H.A., G.M.S. and M.I.S.; resources, J.F.P., M.A.F. and M.G.D.; data curation, J.M.Z., M.A.F. and M.G.D.; writing—original draft preparation, N.H.A. and M.G.D.; writing—review and editing, J.F.P., M.A.F. and M.G.D.; visualization, M.I.S. and G.M.S.; supervision, M.G.D.; project administration, J.F.P., M.A.F. and M.G.D.; funding acquisition, J.F.P., M.A.F. and M.G.D. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the ANPCyT under grant PICT-2020-SERIEA-02504 and PICT-2021-CAT-II-00097, and by CONICET under grant PIP 11220210100388CO.

Data Availability Statement

Not applicable.

Acknowledgments

N.H.A., M.I.S. and G.M.S. thank CONICET for their scholarships. J.M.Z. and J.F.P. acknowledge the ProDoCoVa program.

Conflicts of Interest

The authors report there are no competing interests to declare.

References

  1. Palou, L. Penicillium digitatum, Penicillium italicum (green mold, blue mold). In Postharvest Decay, Control Strategies; Bautista-Baños, S., Ed.; Academic Press: Valencia, Spain, 2014; pp. 45–102. [Google Scholar] [CrossRef]
  2. La Actividad Citrícola. Available online: https://www.federcitrus.org/wp-content/uploads/2022/07/La-Actividad-Citricola-2022.pdf (accessed on 12 March 2023).
  3. Eckert, J.W.; Eaks, I.L. Postharvest disorders and diseases of citrus fruits. In The Citrus Industry: Division of Agriculture and Natural Resources; Reuter, W., Calavan, E.C., Carman, G.E., Eds.; California Press: Los Angeles, CA, USA, 1989; pp. 179–260. [Google Scholar]
  4. Ogawa, J.M.; Zehr, E.; Bird, G.W.; Ritchie, D.F.; Uriu, K.; Uyemoto, J.K. Compendium of Stone Fruit Diseases; American Phytopathological Society: Saint Paul, MN, USA, 1995; pp. 1–168. [Google Scholar]
  5. Smilanick, J.L.; Mansour, M.F.; Gabler, F.M.; Sorenson, D. Control of citrus postharvest green mold and sour rot by potassium sorbate combined with heat and fungicides. Postharvest Biol. Technol. 2008, 47, 226–238. [Google Scholar] [CrossRef]
  6. Ismail, M.; Zhang, J. Post-harvest citrus diseases and their control. Outlooks Pest Manag. 2004, 15, 29–35. [Google Scholar] [CrossRef]
  7. Stegmayer, M.I.; Álvarez, N.H.; Favaro, M.A.; Fernandez, L.N.; Carrizo, M.E.; Reutemann, A.G.; Derita, M.G. Argentinian wild plants as controllers of fruits phytopathogenic fungi: Trends and perspectives. In Wild Plants: The Treasure of Natural Healers; Rai, M., Bhattarai, S., Feitosa, C., Eds.; CRC Press: Boca Raton, FL, USA, 2020; pp. 121–137. [Google Scholar]
  8. Di Liberto, M.G.; Stegmayer, M.I.; Svetaz, L.A.; Derita, M.G. Evaluation of Argentinean medicinal plants and isolation of their bioactive compounds as an alternative for the control of postharvest fruits phytopathogenic fungi. Rev. Bras. Farmacogn. 2019, 29, 686–688. [Google Scholar] [CrossRef]
  9. Moura, V.S.; Moretto, R.K.; Machado, B.I.; Kupper, K.C. Alternativas de controle de doenças de pós-colheita em citros. Citrus Res. Technol. 2019, 40, e1044. [Google Scholar] [CrossRef]
  10. Carmona-Hernandez, S.; Reyes-Pérez, J.J.; Chiquito Contreras, R.G.; Rincon-Enriquez, G.; Cerdan-Cabrera, C.R.; Hernandez-Montiel, L.G. Biocontrol of postharvest fruit fungal diseases by bacterial antagonists: A review. Agronomy 2019, 9, 121. [Google Scholar] [CrossRef]
  11. Stegmayer, M.I.; Fernández, L.; Álvarez, N.; Olivella, L.; Gutiérrez, H.; Favaro, M.A.; Derita, M. Aceites esenciales provenientes de plantas nativas para el control de hongos fitopatógenos que afectan a frutales. Rev. FAVE Cienc. Agrar. 2021, 20, 317–329. [Google Scholar] [CrossRef]
  12. Rodriguez, A.; Derita, M.; Borkosky, S.; Socolsky, C.; Bardón, A.; Hernández, M. Bioactive farina of Notholaena sulphurea (Pteridaceae): Morphology and histochemistry of glandular trichomes. Flora 2018, 240, 144–151. [Google Scholar] [CrossRef]
  13. Stegmayer, M.I.; Fernández, L.N.; Álvarez, N.H.; Seimandi, G.M.; Reutemann, A.G.; Derita, M.G. In vitro antifungal screening of Argentine native or naturalized plants against the phytopathogen Monilinia fructicola. Comb. Chem. High Throughput Screen. 2022, 25, 1158–1166. [Google Scholar] [CrossRef]
  14. Svetaz, L.; Zuljan, F.; Derita, M.; Petenatti, E.; Tamayo, G.; Cáceres, A.; Cechinel Filho, V.; Giménez, A.; Pinzón, R.; Zacchino, S.A.; et al. Value of the ethnomedical information for the discovery of plants with antifungal properties. A survey among seven Latin American countries. J. Ethnopharmacol. 2010, 127, 137–158. [Google Scholar] [CrossRef]
  15. Gupta, V.K.; Tuohy, M.G.; Gaur, R. Methods for high-quality DNA extraction from fungi. In Laboratory Protocols in Fungal Biology; Springer: New York, NY, USA, 2012; pp. 403–406. [Google Scholar]
  16. White, T.J.; Bruns, T.D.; Lee, S.B.; Taylor, J.W. Amplification and direct sequencing of fungal ribosomal RNA Genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Academic Press: Cambridge, MA, USA, 1990; pp. 315–322. [Google Scholar]
  17. Boratyn, G.M.; Camacho, C.; Cooper, P.S.; Coulouris, G.; Fong, A.; Ma, N.; Zaretskaya, I. BLAST: A more efficient report with usability improvements. Nucleic Acids Res. 2013, 41, 29–33. [Google Scholar] [CrossRef]
  18. CLSI (Clinical and Laboratory Standards Institute). Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi, 3rd ed.; CLSI Standard M38; CLSI: Berwyn, PA, USA, 2017; pp. 1–35. [Google Scholar]
  19. Rasband, W.S. Available online: https://imagej.nih.gov/ij/ (accessed on 7 February 2020).
  20. Di Liberto, M.G.; Seimandi, G.M.; Fernández, L.N.; Ruiz, V.E.; Svetaz, L.A.; Derita, M.G. Botanical control of citrus green mold and peach brown rot on fruits assays using a Persicaria acuminata phytochemically characterized extract. Plants 2021, 10, 425. [Google Scholar] [CrossRef] [PubMed]
  21. Hernández-Montiel, L.G.; Holguín-Peña, R.J.; Latisnere-Barragan, H. First report of sour rot caused by Geotrichum citri-aurantii on Key Lime (Citrus aurantifolia) in Colima State, Mexico. Plant Dis. 2010, 94, 488. [Google Scholar] [CrossRef] [PubMed]
  22. Deng, J.; Kong, S.; Wang, F.; Liu, Y.; Liao, I.; Lu, Y.; Zhang, F.; Wu, J.; Wang, L.; Li, X. Identification of a new Bacillus sonorensis strain KLBC GS-3 as a biocontrol agent for postharvest green mold in grapefruit. Biol. Control 2020, 151, 104393. [Google Scholar] [CrossRef]
  23. Khan, I.H.; Javaid, A. Molecular characterization of Penicillium italicum causing blue mold on lemon in Pakistan. J. Plant Pathol. 2022, 104, 845–846. [Google Scholar] [CrossRef]
  24. Derita, M.; Leiva, M.; Zacchino, S. Influence of plant part, season of collection and content of the main active constituent, on the antifungal properties of Polygonum acuminatum Kunth. J. Ethnopharmacol. 2009, 124, 377–383. [Google Scholar] [CrossRef]
  25. Paye, I.A.; Pensiero, J.F.; Grenón, D.A.; Exner, E. Irupé: Sitio web de imágenes de la flora nativa de Argentina asociado al herbário SF. Rev. FAVE Cienc. Agrar. 2021, 20, 19–31. [Google Scholar] [CrossRef]
  26. Mohammed, A.E.; Abdul-Hameed, Z.H.; Alotaibi, M.O.; Bawakid, N.O.; Sobahi, T.R.; Abdel-Lateff, A.; Alarif, W.M. Chemical diversity and bioactivities of monoterpene indole alkaloids (MIAs) from six Apocynaceae genera. Molecules 2021, 26, 488. [Google Scholar] [CrossRef] [PubMed]
  27. Rodríguez, I.L.; Guadarrama Olivera, M.A.; Ortiz Guadarrama, M.; Labastida Astudillo, M.; Jiménez Pérez, N.D.C. Funastrum clausum (Jacq.) Schltr.: El Bejuco De Leche. Kuxulkab 2021, 27, 59–61. [Google Scholar] [CrossRef]
  28. Morcelle, S.R.; Barberis, S.; Priolo, N.; Caffini, N.O.; Clapés, P. Comparative behavior of proteinases from the latex of Carica papaya and Funastrum clausum as catalysts for the synthesis of Z-Ala-Phe-OMe. J. Mol. Catal. B Enzym. 2006, 41, 117–124. [Google Scholar] [CrossRef]
  29. Zabala, J.M.; Exner, E.; Cerino, C.; Buyatti, M.; Cuffia, C.; Marinoni, L.; Kern, V.; Pensiero, J.F. Recursos fitogenéticos forestales, forrajeros, de interés apícola y paisajístico nativos de la provincia de Santa Fe (Argentina). Rev. FAVE Cienc. Agrar. 2021, 20, 99–131. [Google Scholar] [CrossRef]
  30. He, Y.; Wang, Q.; Ye, Y.; Liu, Z.; Sun, H. The ethnopharmacology, phytochemistry, pharmacology and toxicology of genus Albizia: A review. J. Ethnopharmacol. 2020, 257, 112677. [Google Scholar] [CrossRef] [PubMed]
  31. Hussain, M.M. A short review on phytoconstituents from genus Albizzia and Erythrina. Bangladesh Pharmacol. J. 2018, 21, 160–172. [Google Scholar] [CrossRef]
  32. Zhang, H.P.; Samadi, A.K.; Rao, K.V.; Cohen, M.S.; Timmermann, B.N. Cytotoxic oleanane-type saponins from Albizia inundata. J. Nat. Prod. 2011, 74, 477–482. [Google Scholar] [CrossRef] [PubMed]
  33. Shetu, H.J. Phytochemical and Biological Evaluation of Albizia richadiana (Benth. Fabaceae Family). Bachelor’s Thesis, BRAC University, Dhaka, Bangladesh, 2015. [Google Scholar]
  34. Luz, D.A.; Pinheiro, A.M.; Silva, M.L.; Monteiro, M.C.; Prediger, R.D.; Maia, C.S.F.; Fontes-Junior, E.A. Ethnobotany, phytochemistry and neuropharmacological effects of Petiveria alliacea L. (Phytolaccaceae): A review. J. Ethnopharmacol. 2016, 185, 182–201. [Google Scholar] [CrossRef]
  35. Blainski, A.; Piccolo, V.K.; Mello, J.C.P.; de Oliveira, R.M. Dual effects of crude extracts obtained from Petiveria alliacea L. (Phytolaccaceae) on experimental anxiety in mice. J. Ethnopharmacol. 2010, 128, 541–544. [Google Scholar] [CrossRef]
  36. Rosado-Aguilar, J.A.; Aguilar-Caballero, A.; Rodriguez-Vivas, R.I.; Borges-Argaez, R.; Garcia-Vazquez, Z.; Mendez-Gonzalez, M. Acaricidal activity of extracts from Petiveria alliacea (Phytolaccaceae) against the cattle tick, Rhipicephalus (Boophilus) microplus (Acari: Ixodidae). Vet. Parasitol. 2010, 168, 299–303. [Google Scholar] [CrossRef]
  37. Silva do Nascimento, S.; Okabe, D.; Pinto, A.; de Oliveira, F.; da Paixão, T.; Souza Siqueira, M.L.; Baetas, A.C.; de Andrade, M. Antimicrobial and anticancer potential of Petiveria alliacea L. (Herb to “Tame the Master”): A review. Pharmacogn. Rev. 2018, 12, 85–93. [Google Scholar] [CrossRef]
  38. Ramos, M.A.; Machado, L.P. Potencial antifúngico de tipi (Petiveria alliacea L.) em fungos de Aspergillus flavus. Rev. Cient. FAESA 2020, 16, 32–41. [Google Scholar]
  39. Zavala-Ocampo, L.M.; Aguirre-Hernández, E.; Pérez-Hernández, N.; Rivera, G.; Marchat, L.A.; Ramírez-Moreno, E. Antiamoebic activity of Petiveria alliacea leaves and their main component, isoarborinol. J. Microbiol. Biotechnol. 2017, 27, 1401–1408. [Google Scholar] [CrossRef]
  40. Palchetti, M.V.; Cantero, J.J.; Barboza, G.E. Solanaceae diversity in South America and its distribution in Argentina. Anais Acad. Brasil. Cienc. 2020, 92, 1–17. [Google Scholar] [CrossRef]
  41. Muelas-Serrano, S.; Nogal, J.J.; Martınez-Dıaz, R.A.; Escario, J.A.; Martınez-Fernández, A.R.; Gómez-Barrio, A. In vitro screening of American plant extracts on Trypanosoma cruzi and Trichomonas vaginalis. J. Ethnopharmacol. 2000, 71, 101–107. [Google Scholar] [CrossRef] [PubMed]
  42. Diep, T.; Pook, C.; Yoo, M. Phenolic and anthocyanin compounds and antioxidant activity of tamarillo (Solanum betaceum Cav.). Antioxidants 2020, 9, 169. [Google Scholar] [CrossRef] [PubMed]
  43. Vaz, N.P.; Costa, E.V.; Santos, E.L.; Mikich, S.B.; Marques, F.A.; Braga, R.M.; Delarmelina, C.; Duarte, M.; Ruiz, A.N.; Souza, V.H.; et al. Caavuranamide, a novel steroidal alkaloid from the ripe fruits of Solanum caavurana Vell. (Solanaceae). J. Braz. Chem. Soc. 2012, 23, 361–366. Available online: https://www.scielo.br/pdf/jbchs/v23n2/a25v23n2.pd (accessed on 26 May 2022). [CrossRef]
  44. Aparecida Pereira, A.P.; Figueiredo Angolini, C.F.; Paulino, B.N.; Chatagnier Lauretti, L.B.; Orlando, E.A.; Siqueira Silva, J.G.; Neri-Numa, I.A.; Pimentel Souza, J.D.; Lima Pallone, J.A.; Nogueira Eberlin, M.; et al. A comprehensive characterization of Solanum lycocarpum St. Hill and Solanum oocarpum Sendtn: Chemical composition and antioxidant properties. Food Res. Int. 2019, 124, 61–69. [Google Scholar] [CrossRef] [PubMed]
Horticulturae 09 00562 g001 550
Figure 1. (a) Symptoms and signs caused by Geotrichum citri aurantii, Penicillium digitatum, and Penicillium italicum in orange; (b) morphological characteristics of morphologically and molecularly characterized colonies isolates on PDA media; (c) typical microscopic conidia features observed at magnification 40×; (d) tested plates with 0% inhibition; (e) tested plates with 50% inhibition; (f) tested plates with 80% inhibition; and (g) tested pates with 100% inhibition. Note: in some cases, the coloration of the medium may be due to the plant extract dissolved in it.
Figure 1. (a) Symptoms and signs caused by Geotrichum citri aurantii, Penicillium digitatum, and Penicillium italicum in orange; (b) morphological characteristics of morphologically and molecularly characterized colonies isolates on PDA media; (c) typical microscopic conidia features observed at magnification 40×; (d) tested plates with 0% inhibition; (e) tested plates with 50% inhibition; (f) tested plates with 80% inhibition; and (g) tested pates with 100% inhibition. Note: in some cases, the coloration of the medium may be due to the plant extract dissolved in it.
Horticulturae 09 00562 g001
Horticulturae 09 00562 g002 550
Figure 2. Percentage of active, moderately active, and inactive DCM extracts evaluated (a) 7 days and (b) 14 days after inoculation.
Figure 2. Percentage of active, moderately active, and inactive DCM extracts evaluated (a) 7 days and (b) 14 days after inoculation.
Horticulturae 09 00562 g002
Horticulturae 09 00562 g003 550
Figure 3. Percentage of active, moderately active, and inactive MeOH extracts evaluated (a) 7 days and (b) 14 days after inoculation.
Figure 3. Percentage of active, moderately active, and inactive MeOH extracts evaluated (a) 7 days and (b) 14 days after inoculation.
Horticulturae 09 00562 g003
Horticulturae 09 00562 g004 550
Figure 4. Sporulation index (0 to 4 scale, in which the value 0 was assigned to negligible sporulation and 4 referred to dense fungal sporulation over the entire fruit) after 14 days of inoculation of P. digitatum on wound-inoculated oranges: (a) control fruits, (b) fruits treated with 3000 ppm aqueous solution of S. pilcomayense methanolic extract, and (c) fruits treated with 3000 ppm aqueous solution of commercial imazalil.
Figure 4. Sporulation index (0 to 4 scale, in which the value 0 was assigned to negligible sporulation and 4 referred to dense fungal sporulation over the entire fruit) after 14 days of inoculation of P. digitatum on wound-inoculated oranges: (a) control fruits, (b) fruits treated with 3000 ppm aqueous solution of S. pilcomayense methanolic extract, and (c) fruits treated with 3000 ppm aqueous solution of commercial imazalil.
Horticulturae 09 00562 g004
Horticulturae 09 00562 g005 550
Figure 5. Pictures of the most active plant species acting as fungicides in the present study: (a) Orthosia virgata, (b) Funastrum clausum, (c) Albizia inundata, (d) Petiveria alliacea, (e) Solanum pilcomayense, and (f) Solanum caavurana. Source: database Irupé [20].
Figure 5. Pictures of the most active plant species acting as fungicides in the present study: (a) Orthosia virgata, (b) Funastrum clausum, (c) Albizia inundata, (d) Petiveria alliacea, (e) Solanum pilcomayense, and (f) Solanum caavurana. Source: database Irupé [20].
Horticulturae 09 00562 g005
Table
Table 1. Plant species used for extracts preparation to be tested against the orange pathogens Penicillium digitatum, P. italicum, and Geotrichum citri-aurantii. Botanic family, Voucher specimen, collection data, and place of collection or acquisition are also reported.
Table 1. Plant species used for extracts preparation to be tested against the orange pathogens Penicillium digitatum, P. italicum, and Geotrichum citri-aurantii. Botanic family, Voucher specimen, collection data, and place of collection or acquisition are also reported.
FamilyPlant Scientific NameV. specimenCollection Data and Place of
Acquisition
ApocynaceaeAraujia brachystephana (Griseb.) Fontella & Goyder Pensiero et Zabala 1380013/08/2019, San Javier, Santa Fe, 30°03′23.2″ S 59°51′34.8″ W
Forsteronia glabrescens Müll. Arg.Pensiero et Zabala 1380413/08/2019, Gral. Obligado, Santa Fe, 28°42′54.8″ S 59°23′13.7″ W
Orthosia virgata (Poir.) E. Fourn.Pensiero et Zabala 1380213/08/2019, San Javier, Santa Fe, 30°03′23.2″ S 59°51′34.8″ W
Orthosia virgata (Poir.) E. Fourn.Pensiero et Zabala 1380513/08/2019, Gral. Obligado, Santa Fe, 28°42′54.8″ S 59°23′13.7″ W
Funastrum clausum (Jacq.) Schltr.Pensiero et Zabala 1379713/08/2019, San Javier, Santa Fe, 30°03′23.2″ S 59°51′34.8″ W
BromeliaceaeTillandsia tricholepis BakerPensiero et Zabala 1379813/08/2019, San Javier, Santa Fe, 30°03′23.2″ S 59°51′34.8″ W
FabaceaeAlbizia inundata (Mart.) Barneby & J.W. GrimesPensiero et Zabala 1381614/08/2019, Gral. Obligado, Santa Fe, 28°12′53.9″ S 59°08′58.3″ W
Vachellia caven (Molina) Seigler & EbingerDerita M. 3917/03/2019, Las Colonias, Santa Fe, 31°26′30.3″ S 60°56′24.7″ W
PhytolaccaceaePetiveria alliacea L.Pensiero et Zabala 1397513/08/2019, San Javier, Santa Fe, 30°03′23.2″ S 59°51′34.8″ W
PolygonaceaePolygonum stelligerum Cham.Derita M. 5516/03/2019, San Pedro, Bs As, 33°40′11.6″ S 59°39′38.4″ W
Polygonum lapathifolium L.Derita M. 5416/03/2019, San Pedro, Bs As, 33°40′11.6″ S 59°39′38.4″ W
RanunculaceaeClematis montevidensis Spreng.Pensiero et Zabala 1382417/08/2019, Vera, Santa Fe, 29°28′17.6″ S 60°05′27.7″ W
NictaginaceaePisonia zapallo GrisebPensiero et Zabala 1380813/08/2019, Gral. Obligado, Santa Fe, 28°42′54.8″ S 59°23′13.7″ W
SolanaceaeSolanum argentinum Bitter & LilloPensiero et Zabala 1382016/08/2019, Tapenagá, Chaco, 27°53′17.9″ S 59°51′39.4″ W
Solanum argentinum Bitter & LilloPensiero et Zabala 1381716/08/2019, Lib. San Martín, Chaco, 26°07′13.9″ S 59°56′25.1″ W
Solanum granulosum-leprosum DunalPensiero et Zabala 1380613/08/2019, Gral. Obligado, Santa Fe, 28°42′54.8″ S 59°23′13.7″ W
Solanum pilcomayense MorongPensiero et Zabala 1381514/08/2019, Gral. Obligado, Santa Fe, 28°13′42.2″ S 59°06′52.6″ W
Solanum pilcomayense MorongPensiero et Zabala 1380113/08/2019, San Javier, Santa Fe, 30°03′23.2″ S 59°51′34.8″ W
Solanum caavurana Vell.Pensiero et Zabala 1381314/08/2019, Gral. Obligado, Santa Fe, 28°13′42.2″ S 59°06′52.6″ W
VerbenaceaeLantana megapotamica (Spreng.) Tronc.Pensiero et Zabala 1379613/08/2019, San Javier, Santa Fe, 30°03′23.2″ S 59°51′34.8″ W
Table
Table 2. Part of each plant used and the corresponding DCM and MeOH extract yields (g/100 g of dried plant material).
Table 2. Part of each plant used and the corresponding DCM and MeOH extract yields (g/100 g of dried plant material).
Plant Scientific NamePart UsedDCM Extract Yield (%)MeOH Extract Yield (%)
A. brachystephanaAerial parts2.410.7
F. glabrescensAerial parts1.97.3
O. virgataAerial parts2.44.1
O. virgataAerial parts2.35.0
F. clausumAerial parts3.77.2
T. tricholepisWhole plant3.44.4
A. inundataAerial parts1.13.4
V. cavenFlowers1.37.3
P. alliaceaAerial parts0.43.0
P. stelligerumLeaves0.72.8
P. lapathifoliumLeaves0.63.0
C. montevidensisAerial parts1.010.2
P. zapalloAerial parts1.37.7
S. argentinumAerial parts0.77.0
S. argentinumAerial parts3.57.7
S. granulosum-leprosumAerial parts3.25.0
S. pilcomayenseAerial parts1.37.6
S. pilcomayenseAerial parts0.53.2
S. caavuranaAerial parts1.410.3
L. megapotamicaAerial parts0.44.5
Table
Table 3. Fungicidal activity % of inhibition (calculated as the average of the inhibition percentage of the four sectors in which the Petri dish was divided) of 40 extracts obtained from different parts of 20 plant species evaluated against the orange phytopathogens Penicillium digitatum, P. italicum, and Geotrichum citri-aurantii determined 7 days post inoculation. Different letters mean significant statistical differences.
Table 3. Fungicidal activity % of inhibition (calculated as the average of the inhibition percentage of the four sectors in which the Petri dish was divided) of 40 extracts obtained from different parts of 20 plant species evaluated against the orange phytopathogens Penicillium digitatum, P. italicum, and Geotrichum citri-aurantii determined 7 days post inoculation. Different letters mean significant statistical differences.
Plant Scientific NameP. digitatumP. italicumG. citri-aurantiiControls
DCMMeOHDCMMeOHDCMMeOH+(DMSO)−(IMZ)
A. brachystephana61.0 ± 5.2 c44.3 ± 6.2 a30.9 ± 6.5 a30.5 ± 5.3 a65.4 ± 5.0 c66.6 ± 1.8 c0.0 ± 0.0 a100.0 ± 0.0 b
F. glabrescens52.9 ± 7.1 c75.1 ± 1.5 c45.8 ± 6.9 a54.1 ± 5.4 c71.0 ± 0.4 c70.1 ± 2.8 c0.0 ± 0.0 a100.0 ± 0.0 b
O. virgata55.3 ± 2.9 c50.9 ± 5.9 c33.2 ± 6.5 a48.4 ± 6.5 a88.0 ± 4.9 b50.8 ± 1.9 c0.0 ± 0.0 a100.0 ± 0.0 b
O. virgata70.6 ± 2.0 c86.3 ± 3.8 b31.6 ± 4.9 a48.5 ± 4.7 a99.2 ± 0.7 b100.0 ± 0.0 b 0.0 ± 0.0 a100.0 ± 0.0 b
F. clausum62.4 ± 3.8 c81.5 ± 1.5 b40.8 ± 4.4 a43.1 ± 6.9 a100.0 ± 0.0 b33.0 ± 5.2 a0.0 ± 0.0 a100.0 ± 0.0 b
T. tricholepis80.0 ± 2.2 b c85.9 ± 0.7 b60.8 ± 7.0 c67.1 ± 3.6 c87.8 ± 1.5 b54.9 ± 1.0 c0.0 ± 0.0 a100.0 ± 0.0 b
A. inundata79.3 ± 2.1 b c100.0 ± 0.0 b35.7 ± 5.2 a100.0 ± 0.0 b79.3 ± 7.0 b c97.3 ± 0.5 b0.0 ± 0.0 a100.0 ± 0.0 b
V. caven59.5 ± 4.0 c76.8 ± 3.5 c36.2 ± 3.8 a58.1 ± 6.5 c56.5 ± 5.1 c32.3 ± 4.2 a0.0 ± 0.0 a100.0 ± 0.0 b
P. alliacea72.5 ± 1.7 c83.3 ± 3.8 b53.2 ± 2.8 c81.3 ± 2.2 b100.0 ± 0.0 b62.9 ± 3.9 c0.0 ± 0.0 a100.0 ± 0.0 b
P. stelligerum75.2 ± 2.3 c80.1 ± 2.8 b32.8 ± 6.5 a57.0 ± 5.3 c76.0 ± 2.1 c38.4 ± 4.1 a0.0 ± 0.0 a100.0 ± 0.0 b
P. lapathifolium64.2 ± 6.4 c80.7 ± 0.9 b c33.0 ± 3.2 a43.8 ± 5.2 a82.1 ± 3.5 b40.2 ± 3.9 a0.0 ± 0.0 a100.0 ± 0.0 b
C. montevidensis49.4 ± 5.2 a56.4 ± 5.1 c24.6 ± 3.2 a45.8 ± 2.7 a65.5 ± 2.8 c52.7 ± 4.6 c0.0 ± 0.0 a100.0 ± 0.0 b
P. zapallo73.2 ± 4.0 c81.7 ± 2.2 b37.5 ± 4.7 a51.8 ± 4.7 c90.6 ± 7.9 b70.0 ± 4.2 c0.0 ± 0.0 a100.0 ± 0.0 b
S. argentinum45.2 ± 6.3 a62.3 ± 5.3 c29.0 ± 3.3 a62.7 ± 5.1 c63.8 ± 0.9 c73.3 ± 1.9 c0.0 ± 0.0 a100.0 ± 0.0 b
S. argentinum73.3 ± 4.0 c70.0 ± 5.6 c27.9 ± 4.0 a51.6 ± 4.8 c75.0 ± 6.8 c48.6 ± 4.9 a0.0 ± 0.0 a100.0 ± 0.0 b
S. granulosum-leprosum54.7 ± 6.0 c49.5 ± 4.5 a44.6 ± 4.7 a40.0 ± 4.3 a41.3 ± 5.4 a61.5 ± 5.1 c0.0 ± 0.0 a100.0 ± 0.0 b
S. pilcomayense44.5 ± 4.9 a100.0 ± 0.0 b15.3 ± 3.4 a100.0 ± 0.0 b74.4 ± 2.4 c100.0 ± 0.0 b0.0 ± 0.0 a100.0 ± 0.0 b
S. pilcomayense46.4 ± 4.7 a100.0 ± 0.0 b41.9 ± 5.3 a100.0 ± 0.0 b71.0 ± 1.9 c100.0 ± 0.0 b0.0 ± 0.0 a100.0 ± 0.0 b
S. caavurana60.0 ± 5.6 c94.6 ± 1.5 b35.5 ± 3.5 a87.8 ± 1.3 b79.8 ± 4.5 c100.0 ± 0.0 b0.0 ± 0.0 a100.0 ± 0.0 b
L. megapotamica75.0 ± 2.2 c56.3 ± 4.4 c34.9 ± 4.8 a41.6 ± 3.4 a70.3 ± 1.2 c62.9 ± 5.1 c0.0 ± 0.0 a100.0 ± 0.0 b
Table
Table 4. Fungicidal activity % of inhibition (calculated as the average of the inhibition percentage of the four sectors in which the Petri dish was divided) of 40 extracts obtained from different parts of 20 plant species evaluated against the orange phytopathogens Penicillium digitatum, P. italicum, and Geotrichum citri-aurantii determined 14 days post inoculation. Different letters mean significant statistical differences.
Table 4. Fungicidal activity % of inhibition (calculated as the average of the inhibition percentage of the four sectors in which the Petri dish was divided) of 40 extracts obtained from different parts of 20 plant species evaluated against the orange phytopathogens Penicillium digitatum, P. italicum, and Geotrichum citri-aurantii determined 14 days post inoculation. Different letters mean significant statistical differences.
Plant Scientific NameP. digitatumP. italicumG. citri-aurantiiControls
DCMMeOHDCMMeOHDCMMeOH+(DMSO)−(IMZ)
A. brachystephana40.8 ± 2.5 a18.4 ± 3.4 a0.0 ± 0.0 a7.2 ± 2.3 a13.7 ± 3.2 a39.5 ± 4.3 a0.0 ± 0.0 a100.0 ± 0.0 b
F. glabrescens38.0 ± 3.8 a38.8 ± 4.3 a30.6 ± 4.6 a10.3 ± 2.1 a26.1 ± 3.7 a37.2 ± 4.9 a0.0 ± 0.0 a100.0 ± 0.0 b
O. virgata37.9 ± 5.2 a33.7 ± 4.3 a7.7 ± 2.1 a33.8 ± 4.6 a80.0 ± 4.4 b c29.7 ± 3.2 a0.0 ± 0.0 a100.0 ± 0.0 b
O. virgata45.9 ± 3.9 a57.0 ± 3.6 c0.0 ± 0.0 a16.9 ± 3.2 a90.4 ± 6.0 b100.0 ± 0.0 b0.0 ± 0.0 a100.0 ± 0.0 b
F. clausum50.3 ± 4.5 a c53.6 ± 3.7 c15.1 ± 3.6 a31.2 ± 4.6 a100.0 ± 0.0 b16.0 ± 1.2 a0.0 ± 0.0 a100.0 ± 0.0 b
T. tricholepis76.8 ± 2.7 c69.1 ± 1.8 c55.0 ± 2.7 c39.1 ± 6.5 a26.7 ± 1.7 a46.9 ± 2.8 a0.0 ± 0.0 a100.0 ± 0.0 b
A. inundata60.3 ± 2.7 c100.0 ± 0.0 b34.3 ± 6.2 a100.0 ± 0.0 b71.5 ± 5.3 c92.5 ± 0.2 b0.0 ± 0.0 a100.0 ± 0.0 b
V. caven42.3 ± 3.7 a33.0 ± 6.1 a30.0 ± 5.8 a11.0 ± 3.0 a0.0 ± 0.0 a22.0 ± 5.1 a0.0 ± 0.0 a100.0 ± 0.0 b
P. alliacea67.2 ± 2.9 c58.8 ± 6.7 c41.0 ± 2.0 a57.8 ± 3.3 c100.0 ± 0.0 b34.4 ± 5.8 a0.0 ± 0.0 a100.0 ± 0.0 b
P. stelligerum50.2 ± 1.5 a c42.3 ± 4.3 a0.0 ± 0.0 a0.0 ± 0.0 a59.1 ± 4.1 c21.5 ± 1.6 a0.0 ± 0.0 a100.0 ± 0.0 b
P. lapathifolium37.8 ± 6.5 a33.0 ± 5.3 a0.0 ± 0.0 a0.0 ± 0.0 a22.1 ± 3.6 a20.5 ± 1.2 a0.0 ± 0.0 a100.0 ± 0.0 b
C. montevidensis41.4 ± 6.2 a10.4 ± 2.1 a0.0 ± 0.0 a11.6 ± 4.5 a0.0 ± 0.0 a31.6 ± 4.3 a0.0 ± 0.0 a100.0 ± 0.0 b
P. zapallo52.9 ± 5.9 c39.5 ± 4.4 a18.3 ± 4.4 a0.0 ± 0.0 a10.3 ± 2.7 a44.6 ± 5.3 a0.0 ± 0.0 a100.0 ± 0.0 b
S. argentinum29.5 ± 4.3 a40.2 ± 6.7 a0.0 ± 0.0 a13.8 ± 2.3 a0.0 ± 0.0 a37.5 ± 5.8 a0.0 ± 0.0 a100.0 ± 0.0 b
S. argentinum50.1 ± 6.3 a c50.1 ± 5.2 a c0.0 ± 0.0 a27.8 ± 3.5 a39.3 ± 4.5 a33.1 ± 2.8 a0.0 ± 0.0 a100.0 ± 0.0 b
S. granulosum-leprosum38.4 ± 4.3 a10.4 ± 3.7 a29.9 ± 4.7 a0.0 ± 0.0 a0.0 ± 0.0 a37.4 ± 3.6 a0.0 ± 0.0 a100.0 ± 0.0 b
S. pilcomayense32.4 ± 4.7 a100.0 ± 0.0 b0.0 ± 0.0 a100.0 ± 0.0 b17.8 ± 4.7 a100.0 ± 0.0 b0.0 ± 0.0 a100.0 ± 0.0 b
S. pilcomayense32.8 ± 4.8 a100.0 ± 0.0 b27.4 ± 3.7 a100.0 ± 0.0 b0.0 ± 0.0 a100.0 ± 0.0 b0.0 ± 0.0 a100.0 ± 0.0 b
S. caavurana50.4 ± 5.5 a c88.3 ± 2.2 b18.2 ± 3.2 a55.7 ± 4.3 c71.0 ± 3.9 c100.0 ± 0.0 b0.0 ± 0.0 a100.0 ± 0.0 b
L. megapotamica62.9 ± 5.4 c23.6 ± 5.3 a34.6 ± 4.2 a22.5 ± 4.4 a0.0 ± 0.0 a34.6 ± 3.4 a0.0 ± 0.0 a100.0 ± 0.0 b
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Alvarez, N.H.; Stegmayer, M.I.; Seimandi, G.M.; Pensiero, J.F.; Zabala, J.M.; Favaro, M.A.; Derita, M.G. Natural Products Obtained from Argentinean Native Plants Are Fungicidal against Citrus Postharvest Diseases. Horticulturae 2023, 9, 562. https://doi.org/10.3390/horticulturae9050562

AMA Style

Alvarez NH, Stegmayer MI, Seimandi GM, Pensiero JF, Zabala JM, Favaro MA, Derita MG. Natural Products Obtained from Argentinean Native Plants Are Fungicidal against Citrus Postharvest Diseases. Horticulturae. 2023; 9(5):562. https://doi.org/10.3390/horticulturae9050562

Chicago/Turabian Style

Alvarez, Norma Hortensia, María Inés Stegmayer, Gisela Marisol Seimandi, José Francisco Pensiero, Juan Marcelo Zabala, María Alejandra Favaro, and Marcos Gabriel Derita. 2023. "Natural Products Obtained from Argentinean Native Plants Are Fungicidal against Citrus Postharvest Diseases" Horticulturae 9, no. 5: 562. https://doi.org/10.3390/horticulturae9050562

APA Style

Alvarez, N. H., Stegmayer, M. I., Seimandi, G. M., Pensiero, J. F., Zabala, J. M., Favaro, M. A., & Derita, M. G. (2023). Natural Products Obtained from Argentinean Native Plants Are Fungicidal against Citrus Postharvest Diseases. Horticulturae, 9(5), 562. https://doi.org/10.3390/horticulturae9050562

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop