Next Article in Journal
Identification of Grape NRT Gene Family and Analysis of Its Expression in Leaves Under Nitrogen-Deficiency Stress
Next Article in Special Issue
Enhancement of Growth and Quality of Winter Watermelon Using LED Supplementary Lighting
Previous Article in Journal
A Comparative Study of Dormex® and Biostimulant Effects on Dormancy Release, Productivity, and Quality in ‘Royal Tioga®’ Sweet Cherry Trees (Prunus avium L.)
Previous Article in Special Issue
The Harnessing of Controlled Environment Agriculture Technologies for Phytochemical and Mineral Element Enrichment in Mesembryanthemum crystallinum
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

CsWRKY46 Is Involved in the Regulation of Cucumber Salt Stress by Regulating Abscisic Acid and Modulating Cellular Reactive Oxygen Species

1
College of Life Science, Shenyang Normal University, 253 Huanghe North Street, Huanggu District, Shenyang 110034, China
2
Shenyang Food and Drug Inspection Institute, 67 Qiuyuehu Street, Shenbei New District, Shenyang 110034, China
*
Author to whom correspondence should be addressed.
Horticulturae 2025, 11(3), 251; https://doi.org/10.3390/horticulturae11030251
Submission received: 9 January 2025 / Revised: 9 February 2025 / Accepted: 21 February 2025 / Published: 26 February 2025

Abstract

:
Soil salinity significantly restricts the growth, development, and productivity of vegetables. Cucumber, a crucial greenhouse vegetable, is helpful for understanding how plants perceive, signal, and respond to salt stress. The WRKY family plays an important role in regulating stress responses. This study utilized the cucumber variety ‘Zhongnong 26’ to investigate the effects of salt stress on morphological changes, physiological and biochemical indices, and molecular regulations. CsWRKY46 was up-regulated in both salt stress and ABA response conditions in the leaves, roots, and fruits of cucumber. Transgenic Arabidopsis lines overexpressing CsWRKY46 (CsWRK46-OE1 and CsWRK46-OE5) showed higher proline accumulation and reduced electrolyte leakage compared to the wild type (WT). These overexpression lines demonstrated higher peroxidase (POD) and glutathione reductase (GR) activity, along with lower ascorbate peroxidase (APX) and catalase (CAT) activity. qRT-PCR analysis revealed elevated expression levels of ABI5 and ABF4 in CsWRKY46-OE lines compared to the WT. Additionally, the overexpression of CsWRKY46 increased the expression of stress-inducible genes such as PSCS1, PY19, and RD19. These findings suggest that CsWRKY46 enhances plant tolerance to salt stress, potentially through ABA regulation and modulation of cellular reactive oxygen species (ROS), and provide a foundation for the identification of new sources of salt stress tolerance for breeding programs.

1. Introduction

Saline-alkali soils are among the most widely distributed soil types globally and represent a significant constraint on crop production [1]. The global area of salt-affected soil is 8.33 × 109 hm2, and the data for China indicate that its area is 1 × 109 hm2 [2]. Prolonged and intense salt stress can cause irreversible damage to plants. High salt concentrations can inhibit or delay germination [3], and reduce seedling growth [4], leaf length, and yield [5].
Cucumber (Cucumis sativus L.) has a wide cultivation area and plays a very important role in vegetable production in China. According to the latest statistics from the FAO, China’s cucumber harvest area reached 1.3115 million hm2 in 2022, with a total yield of 77,307,300 tons [6]. Many studies have investigated the physiological and biochemical responses of cucumber seedlings under salt stress. These responses include cellular dysfunctions such as membrane damage, generation of ROS, protein denaturation, and accumulation of toxic products [7]. However, the mechanism underlying cucumber tolerance to salt stress remains unclear, especially the role of the transcription factors in mediating these responses.
Phytohormones are key regulators in plant responses to stress signaling. Their levels fluctuate in response to changes in abiotic stress conditions, and exogenous application of these hormones can effectively mitigate the damage caused by such stresses [8]. Among phytohormones, abscisic acid (ABA) plays a crucial role in regulating plant growth, development, and responses to abiotic stresses [9]. Studies have demonstrated that exogenous ABA application can increase the salt tolerance of cucumber seedlings under NaCl stress by improving ROS enzyme activities [10]. Recent research further highlights the importance of ABA in enhancing plant tolerance to various abiotic stresses [11].
Many studies have reported that WRKY-like transcription factors play critical regulatory roles in plant tolerance to salt stress [12]. For instance, in maize (Zea mays), the genes ZmWRKY25, 45, 55, and 67 were up-regulated under salt-alkali stress, whereas the ZmWRKY62 gene was down-regulated, suggesting their differential involvement in the response to salt stress [13]. Similarly, in tomato (Solanum lycopersicum), SlWRKY39 was significantly up-regulated under salt stress. Overexpression of SlWRKY39 could improve salt stress tolerance in transgenic tomatoes, likely by promoting proline accumulation, reducing malondialdehyde (MDA) levels, and enhancing the expression of the stress-related gene SlRD22, thereby protecting plants from salt-induced damage [14].
Transcription factors can specifically regulate the expression of several downstream stress-related genes. Our previous research identified many responses of WRKYs to abiotic stress [15], with CsWRKY46 playing a positive role in response to low temperatures by the ABA-dependent pathway [16]. CsWRKY46 and AtWRKY71 in Arabidopsis are homologous genes. Studies have shown that AtWRKY71 activity can accelerate flowering, thereby providing a means for the plant to complete its life cycle in the presence of salt stress [17]. Therefore, this study aimed to investigate the effects of ABA pretreatment on improving the growth and development of cucumber plants under salt stress. Additionally, we explored the expression patterns of the cucumber WRKY gene, CsWRKY46, in leaf tissue, in root tissue, and during fruit expansion. This research provides valuable insights into the mechanisms of salt stress tolerance in cucumbers and offers a reference for further studies on salt stress tolerance in plants.

2. Materials and Methods

2.1. Plant Materials and Treatment

Cucumber ‘Zhongnong 26’ was used as the plant material in this study. The cucumber seeds were purchased from the Institute of Vegetables and Flowers of the Chinese Academy of Agricultural Sciences. The seedlings were planted in vermiculite and peat, with a daytime temperature of 25~28 °C and a nighttime temperature of 16~18 °C. Cucumber seedlings that were 4 weeks old were sprayed with water or 100 μM ABA. Both sides of the leaves were sprayed uniformly until they were wetted completely. After 12 h, the plants underwent the salt stress treatment. In total, there were four treatments: CK (seedlings were sprayed with water); CK+ABA (seedlings were sprayed with ABA); NaCl stress (150 mmol/L NaCl salt stress treatment); NaCl+ABA (seedlings were salt stressed and sprayed with ABA). There were four plants for each sample taken for each treatment and three biological replicates. After the 12 h ABA pretreatment, samples were collected after 0, 1, 3, 5, and 7 d of salt stress, and physiological and biochemical indicators were measured. After 0 h, 3 h, 6 h, 12 h, and 24 h of salt stress, the leaves and roots were sampled to determine the expression levels of the genes encoding the antioxidant enzymes SOD, POD, and CAT. The fruits on days 0, 1, 3, and 4 after anthesis were sampled.

2.2. Construction of the Plant Transformation Plasmid and Arabidopsis Transformation

The pCAMBIA1304-35S-CsWRKY46 plasmid was constructed by amplifying the opening read frame (ORF) of CsWRKY46 via PCR using the following primers: F, 5′CATGCCATGGATGTCGGATGAAATGT (NcoI site underlined) and R, 5′CGGACTAGTCGGCTGTCGGTTGAAAAAC (SpeI site underlined). The primers were designed according to the cucumber CsWRKY46 sequence from our previous research, Ling et al. [15]. This fragment was then subcloned into pCAMBIA1304 (donated by Dr. Xianguo Cheng [16]), which is under the control of the CaMV35S promoter; the integrity of the plasmid was confirmed by sequencing. The recombinant plasmid, pCAMBIA1304-35S-CsWRKY46, was introduced into Agrobacterium tumefaciens strain GV3101, and the transformation of Arabidopsis was performed using to the floral dip method [18]. The transgenic plants were selected on MS (Murashige and Skoog medium, Sigma-Aldrich, Merck, Beijing, China) containing 50 mg/L hygromycin; the transformation was confirmed by RT-PCR analysis. The T3 homozygous lines were used for the phenotypic analysis [16].
Transgenic overexpressed Arabidopsis seeds (CsWRKY46-OE1 and CsWRKY46-OE5) were sterilized and placed at 4 °C for vernalization for 2 to 3 days, then sown on sterile 1/2MS (0.8% agar, 1.5% sucrose, pH 5–8), and then placed in a light incubator to cultivate at a day and night temperature of 28 °C/18 °C (day/night) and with a photoperiod of 16 h. The relative humidity was 70%. WT and transgenic Arabidopsis seeds (CsWRKY46-OE1 and CsWRKY46-OE5) were cultured in a petri dish for 7 days and then transferred to a substrate. After 4 weeks of growth, they were treated with salt stress. After 7 days of treatment, samples were taken to determine physiological indicators. We selected robust plants of the same size and soaked them in NaCl solution, took samples at 0, 3, 6, 12, and 24 h, and stored them at −80 °C for determination of gene expression.

2.3. Measurements of Physiological Indices

The electrolyte leakage rate and the relative water content were determined using the conductance method described by Lee et al. [19]. The SOD and POD activity was determined using a nitroblue tetrazolium (NBT, Sangon biotech, Shanghai, China) photochemical reduction [20] and guaiacol-based phenol colorimetry [21]. The CAT activity, GR activity, and APX activity were measured according to the method by Wang et al. [22]. The proline contents and the solution sugar content were measured as described by Diao et al. [23].

2.4. RNA Extraction and qRT-PCR Analysis for Gene Expression

The total RNA was extracted from the leaves and roots of 4-week-old cucumber plants after treatments and using the Trizol method. The first strands of cDNA were synthesized using 5 μg of total RNA and a Fermentas Revert AidTM First Strand cDNA Synthesis Kit (Thermo scientific, Shanghai, China) in a reaction volume of 20 μL. The primers were designed according to the cucumber CsWRKY46 sequence [15,16] to amplify the full-length CsWRKY46 by RT-PCR. The expected PCR fragment was cloned into the pEASY-T1 vector and sequenced. The quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed using an RG3000 real-time PCR filter. The real-time PCR was performed using the gene-specific primer pairs listed in Table A1. The PCR reactions were performed using the SYBR Green PCR Master Mix (Yeasen biotechnology, Shanghai, China). The PCR conditions were as follows: 95 °C for 5 min, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s. The fluorescence data were collected during the 60 °C step. Each sample was amplified in triplicate for three technical replicates. There were three biological replicates for each treatment. The expression level was normalized to the Actin gene control, and relative expression values were determined against the CK sample or the WT sample using the 2−ΔΔCt method.

2.5. Statistical Analysis

All experiments were performed using three biological replicates. Origin (Version9.0) software was used to perform data analysis and plotting. The results presented in the figure were the mean of three replications, and the means were compared with Duncan’s multiple range test (p < 0.05). All the statistical analyses were performed with the SPSS (Version 20.0) program.

3. Results

3.1. Effects of Exogenous ABA on the Growth of Cucumber Seedlings Under Salt Stress

Two weeks after the salt stress treatment, the plants’ increases in height, stem diameters, and the numbers of leaves of the stressed cucumber seedlings were significantly lower than those of the unstressed control seedlings. Salt stress significantly inhibited the growth of the cucumber seedlings, whereas the exogenous ABA application significantly alleviated this growth inhibition. Pretreatment with exogenous ABA promoted the growth of cucumber seedlings under salt stress. Specifically, the increases in plant height and leaf numbers in the NaCl+ABA treatment group were 5.20% and 4.91% higher, respectively, than those in the salt-stressed plants without ABA. Additionally, the fresh weights and dry weights of the NaCl+ABA group were higher than those in the NaCl treatment group, although these differences were not statistically significant (Table 1).

3.2. Effects of Exogenous ABA on Electrolyte Leakage and Relative Water Content in Cucumber Leaves Under Salt Stress

As shown in Figure 1, the electrical conductivity of cucumber seedlings increased under salt stress compared to the control, and this conductivity gradually rose with prolonged stress duration. However, ABA pretreatment effectively alleviated the increase in electrical conductivity induced by salt stress. Furthermore, the relative water content of cucumber leaves increased after 7 days of salt stress compared to the control (Figure 1). Exogenous ABA application also mitigated this increase in relative water content under salt stress. The results demonstrate that the exogenous application of ABA can effectively alleviate the damage caused by salt stress to cucumber seedlings.

3.3. Effect of ABA Pretreatment on Antioxidant Enzyme Activity Under Salt Stress

The changes in SOD and APX activities exhibited a similar trend after 1 day of salt stress. Both SOD and APX activities were significantly higher than those in the control plants. Similarly, CAT activity was significantly elevated compared to the control after 1 day of salt stress treatment. In contrast, the changes in POD and GR activities followed a similar pattern after 5 days of salt stress, reaching their maximum levels at this time point. These activities were also significantly higher than those in the control plants. However, after 7 days of salt stress, the opposite trend was observed (Figure 2). These findings indicate that exogenous ABA treatment can significantly enhance the ability of plants to scavenge ROS, thereby protecting the cells from damage.

3.4. Effects of ABA Pretreatment on the Expression of Antioxidant Encoding Genes Under Salt Stress

At the genetic level, the trends in the relative expression of genes encoding antioxidant enzymes were consistent with the observed changes in antioxidant enzyme activities. The relative expression levels of genes encoding antioxidant enzymes were up-regulated in both leaves and roots of cucumber seedlings under salt stress. As shown in Figure 3 and Figure 4, the gene expression levels in roots were lower than those in leaves. Specifically, the expression levels of CAT1, CAT2, and CAT3 were all up-regulated under salt stress. However, the application of ABA under salt stress effectively suppressed the expression of these CAT genes. Notably, the expression peaks of CAT genes in roots were delayed compared to those in leaves under salt stress.
Similarly, the expression levels of SOD1, SOD2, SOD3, and SOD4 were all up-regulated both in leaves and roots under salt stress (Figure 3 and Figure 4). ABA pretreatment under salt stress significantly reduced the expression levels of these SOD genes. Additionally, the expression peaks of SOD genes in cucumber roots were delayed compared to those in leaves under salt stress.
The expression levels of POD1, POD2, POD3, POD4, and POD5 were also up-regulated both in cucumber leaves and roots under salt stress. When salt-stressed plants were pretreated with ABA, the gene expression levels of POD2, POD3, POD4, and POD5 in leaves were significantly higher than those in the salt-stressed group after 12 h, 24 h, or 3 h. In roots, ABA pretreatment under salt stress increased the expression levels of POD1, POD3, and POD4 genes.
These results indicated that ABA application can down-regulate the expression of SOD and CAT genes while up-regulating the expression of POD genes in cucumber plants under salt stress. This regulatory pattern aligns with the observed changes in antioxidant enzyme activities, suggesting a coordinated response at both the genetic and enzymatic levels to mitigate oxidative stress induced by salt stress.

3.5. CsWRKY46 Gene Response to Salt Stress and ABA in Cucumber Seedlings

As shown in Figure 5, the CsWRKY46 gene was up-regulated in both cucumber leaves and roots under salt stress. Specifically, in leaves, the up-regulation of CsWRKY46 was obvious at 3 h of salt stress, while ABA pretreatment further increased its expression at 12 h. In roots, the expression level of CsWRKY46 peaked at 12 h under salt stress, and ABA pretreatment delayed this peak to 24 h. These results allow us to speculate that ABA pretreatment delays the expression peak of CsWRKY46 under salt stress. Furthermore, the CsWRKY46 gene exhibited an earlier response to salt stress and ABA compared to the genes encoding ROS enzymes. This temporal pattern implies that the WRKY gene may play a regulatory role in ROS metabolism, potentially influencing the plant’s antioxidant defense mechanisms during stress. These results highlight the importance of CsWRKY46 in mediating cucumber’s response to salt stress and its interaction with ABA signaling pathways.

3.6. CsWRKY46 Gene Responds to Salt Stress in Cucumber Fruit

The expression of the CsWRKY46 gene was detected in 0 d, 1 d, 3 d, and 4 d old cucumber fruits. CsWRKY46 was responsive to both salt stress and the salt stress with ABA pretreatment during fruit expansion. CsWRKY46 was up-regulated in the NaCl +ABA group in cucumber fruit, as it expanded in the first 3 days. However, on the fourth day, its expression was down-regulated in response to NaCl+ABA. In contrast, CsWRKY46 was up-regulated in response to NaCl alone in 4-day-old cucumber fruits (Figure 6).

3.7. Changes in Physiological Indexes of Transgenic Overexpressing CsWRKY46 Plants Under Salt Stress

As shown in Figure 7, under normal conditions, there was no significant difference in electrical conductivity between WT and CsWRKY46-OE lines. However, after 7 days of salt stress, the electrical conductivity increased in both WT and CsWRKY46-OE lines, but the electrical conductivity of the CsWRKY46-OE lines was significantly lower than that of the WT. Similarly, there was no difference in relative water content before salt treatment, and it decreased significantly after 7 days of salt treatment, but there was still no significant difference between the WT and CsWRKY46-OE lines. In terms of proline content, no significant difference was detected between the WT and CsWRKY46-OE lines before salt treatment. However, after 7 days of salt stress, the proline content increased in both groups, with CsWRKY46-OE lines exhibiting significantly higher proline levels compared to the WT. In contrast, the soluble sugar content of CsWRKY46-OE lines was lower than that of the WT after 7 days of salt stress.
In addition, the activity of antioxidant enzymes was measured after 7 days of salt stress. There was no significant difference in antioxidant enzyme activity between WT and transgenic lines under normal conditions. However, POD and GR activities were significantly higher in transgenic lines than those in the WT after salt treatment (Figure 8).
These results suggest that CsWRKY46-OE lines exhibit enhanced tolerance to salt stress, as evidenced by lower electrical conductivity, higher proline accumulation, and increased antioxidant enzyme activities, which may collectively contribute to improved stress tolerance.

3.8. Effects of Salt Stress on Functional Gene Expression in the Downstream of Transgenic Arabidopsis

As overexpression of CsWRKY46 increased the plant tolerance to salt stress. In order to further clarify the molecular mechanism of CsWRKY46 involved in salt stress and ABA signaling regulation, qRT-PCR was used to detect changes in the expression of related functional genes. As shown in Figure 9, there was no significant difference in gene expression between WT and CsWRKY46-OE lines under normal growth conditions. However, after salt treatment, the expression of tested genes was up-regulated. Among them, the expression of ABA-responsive genes such as ABI5 and ABF4 was significantly higher in CsWRKY46-OE lines than in the WT after 12 h of salt stress. DREB2A, RAB18, P5CS1, PYL9, and other genes had the highest expression levels at 6 h under salt stress, with overexpressed lines showing significantly higher expression than the WT. These findings suggest that CsWRKY46 overexpression enhances the transcriptional activation of key stress-responsive and ABA signaling-related genes, which may contribute to improved salt stress tolerance in transgenic plants.

4. Discussion

Cucumbers are highly sensitive to various abiotic stresses, such as salinity, drought, and cold stresses. ABA pretreatment is an effective method that can improve the plant’s tolerance to abiotic stresses. It is helpful to improve the plants in terms of their growth, development, fruit quality, and yield in abiotic stress. WRKY transcription factors, a large family of regulatory proteins, play important roles in mediating plant responses to multiple stresses. Among these, CsWRKY46 has been identified as a gene responsive to salinity drought and cold stresses [15]. It is interesting that CsWRKY46 overexpression Arabidopsis plants are sensitive to ABA during germination [16]. Furthermore, studies on the homologous gene AtWRKY71 in Arabidopsis [17] have revealed its antagonistic role against salt-delayed flowering; this is helpful for understanding how CsWRKY46 works in salt stress.
WRKY transcription factors are known to regulate plant stress responses by regulating pathways by modulating signaling pathways involving key phytohormones such as ABA, salicylic acid (SA), and jasmonic acid (JA) [24,25]. Plant growth ability is a comprehensive indicator of plant response to salt stress [26]. In this study, salt stress significantly inhibited the growth of cucumber seedlings, likely due to impaired water and nutrient uptake, vacuolar accumulation of inorganic ions, and subsequent cytoplasmic dehydration. However, exogenous ABA pretreatment mitigated these inhibitory effects, promoting seedling growth under salt stress.
Electrolyte leakage is one of the important indicators used to measure the damage level caused to plant cell membranes [27]. Under salt stress, the electrolyte leakage in cucumber leaves was increased, indicating that the membrane system of the cucumber plants was disrupted under salt stress. This may have been due to an increase in ROS levels caused by the salt stress. To counteract ROS overproduction, plants employ antioxidant systems involving enzymes such as SOD, POD, CAT, GR, and APX [19]. Salt stress disrupts this balance [28]. The enzymes provide cells with highly efficient machinery to detoxify O2- and H2O2, and maintain cellular balance [29]. This study showed that the changes in ROS and related enzyme activities after salt stress treatment are complicated. Under salt stress, the activities of SOD, POD, APX, and GR increased with the accumulation of ROS. Furthermore, ABA pretreatment under salt stress enhanced the activities of several antioxidant enzymes, effectively mitigating oxidative damage and alleviating the adverse effects of salt stress on cucumber plants. The results are similar to those of Zhu et al., who demonstrated that salt tolerance in transgenic peanut overexpressing AhWRKY75 [30]—involved the up-regulation of genes associated with ROS-scavenging activity and an improved antioxidant system (SOD, POD, and CAT) [31].
ROS metabolism is related not only to enzyme activity but also to the differential expression of genes that encode these enzymes. In this study, the expression levels of genes encoding antioxidant enzymes correlated with their activities. Under salt stress, the expression of SOD, POD, and CAT genes was significantly up-regulated, accompanied by increased enzyme activities. While excessive ROS accumulation is detrimental, low ROS levels act as signaling molecules, inducing defense gene expression and adaptive stress responses [32]. Therefore, maintaining ROS homeostasis is critical for plant stress tolerance.
Transcriptional regulation plays a central role in plant stress responses. Transcription factors, activated by stress signals, bind to cis-acting elements to modulate downstream gene expression [33]. This study indicates that the WRKY transcription factor, CsWRKY46, plays a positive role in cucumber salt stress by regulating ROS-related genes and ROS enzyme activities. It is hypothesized that CsWRKY46 mediates salt stress responses by ROS metabolism regulation. The expression levels of several plant genes are regulated by salt stress, but little is known about the signaling pathways that mediate salt responses [34]. Salt stress up-regulates CsWRKY46 expression in both leaf and root tissues, highlighting its role in seedling growth and fruit development. During early fruit development, CsWRKY46 expression is up-regulated under salt stress but declines as the fruit expands, suggesting its importance in early fruit development. Although the gene function of CsWRKY46 was identified in the model plant Arabidopsis, heterologous expression is still insufficient to reveal the gene function clearly in the cucumber. Further, the gene function of CsWRKY46 will be detected in transgenic cucumbers under salt stress.
Environmental stress usually affects plant physiology and biochemistry. After salt treatment, transgenic plants overexpressing VvWRKY30 had a higher germination rate and longer root systems [35]. In this study, CsWRKY46 overexpression in transgenic lines resulted in lower electrolyte leakage, higher proline accumulation, and enhanced antioxidant enzyme activities compared to wild-type (WT) plants, indicating improved salt stress tolerance. Proline, a key osmoprotectant, accumulates under stress and is closely associated with plant stress resistance [36]. The elevated proline levels in transgenic plants likely contribute to their enhanced stress tolerance. Additionally, the increased antioxidant enzyme activities in transgenic lines protect against oxidative and osmotic damage, consistent with findings by Yu et al. [37].
The expression of stress-related genes is a critical component of plant stress responses. The qRT-PCR results show that CsWRKY46 promotes the expression of the genes in the ABA signaling pathway and the stress-related functional genes, suggesting that CsWRKY46 may enhance the salt tolerance of transgenic plants by the ABA signaling pathway. Therefore, CsWRKY46, as a target gene, is involved in the regulation of salt stress at both the seedling and fruit stages of cucumber; furthermore, the CsWRKY46-transgene-overexpressed Arabidopsis regulates salt stress at physiological and molecular levels. It is speculated that CsWRKY46 enhances salt tolerance by ABA-dependent signaling and ROS-scavenging pathways. This also provides a foundation for the identification of new sources of tolerance to salt stress for breeding programs [38].

5. Conclusions

In this study, CsWRKY46 was found to be up-regulated in response to both salt stress and ABA. It was detected in the leaves, roots, and fruits of cucumber. CsWRKY46 functions as a regulator in plants’ responses to salt stress.
CsWRKY46-OE lines showed an increased tolerance to salt stress compared to WT plants. Specifically, The CsWRKY46-OE lines showed higher proline content, ROS-scavenging enzyme activities, and lower EC content levels than the WT. These results suggest that the overexpression of CsWRKY46 enhances the accumulation of osmotic adjustment substances and boosts the activity of the ROS-scavenging system.
The functional genes responding to abiotic stress and the genes in the ABA pathway were significantly up-regulated in CsWRKY46-OE lines. CsWRKY46 plays a positive role in salt stress by the ABA pathway and ROS regulation.
In conclusion, this study provides valuable insights into the role of CsWRKY46 in cucumber salt stress tolerance and highlights its potential as a target gene for breeding programs aimed at improving stress resilience. By elucidating the molecular mechanisms underlying the function of CsWRKY46, this research contributes to the development of stress-tolerant cucumber varieties, offering a foundation for future agricultural applications.

Author Contributions

X.B. carried out the physiology assays and the molecular genetic studies and drafted the manuscript. P.L. and F.Z. performed the statistical analysis and organization of the literature. C.Z. and H.P. participated in the study’s design and coordination and helped to draft the manuscript. Y.Z. conceived of the study and participated in its design and coordination and helped to draft the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (No. 31301815), the Liaoning Province Science and Technology Plan Project (No. 2022JH2/101300179), and the Liaoning Basic Scientific Research Project (No. LJ232410166068; No.LJ232410166084).

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors on request.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
ABAabscisic acid
OEoverexpression
ROSreactive oxygen species
SAsalicylic acid
JAjasmonic acid

Appendix A

Table A1. Primers used for quantitative real-time PCR assay.
Table A1. Primers used for quantitative real-time PCR assay.
GenePrimer Pairs
CsActinF:TCCACGAGACTACCTACAACTC
R:GCTCATACGGTCAGCGAT
SOD1F:TGGTGAAGATGGCAAGGC
R:GACCAATAATGCCACAGGCTAC
SOD2F:GGTGATGATGGTACTGCTACTTTC
R:CAATAACGCCACAGCCTATTCTC
SOD3F:TCCAGATGGGGTTGCTGA
R:TAATGCCGCATCCGATTC
SOD4F:CAATGCTGATGGAGTAGCAGAG
R:GACCGACAACACCACATGC
POD1F:GTCACCTTGGCATCAGGAC
R:ATGTGTGTGCACCTGATAGAGC
POD2F:GTTAATTTGGCAGGAGGACCG
R:TGTGTGTGCACCAGATAAGGC
POD3F:TGTTTCGTCCAAGGCTGC
R:TCCTTGCACGTCGACAGAG
POD4F:CAATGGGTGTGATGGATCGA
R:GTCCTCCCGACAAGAAAACAG
POD5F:CAATGCACGGGTGTGATG
R:CTCCAGACAGCACAACAGACAC
CAT1F:GCGCGAGAGGTGTGTAATTC
R:AGACCTATCAGCCTGAGACCAGA
CAT2F:GTTAATGCACCTAAGTGTGCTCAC
R:ATCGTTCTTGCCTGTCTGATG
CAT3F:GGTGTGTGATTCCGAAAGAGAA
R:ACCTGTCAGCCTGACTCCAATAC
AtPYL9F:CCTCTTCATCTCGTTTGGTCAC
R:CTCTAAGACTGCCGATTTCAGG
AtCIPK6F: CGGAGTATCGCCGGTGAA
R: CGTGTTTCCGGTGGCAAT
AtABF4F: AACAACTTAGGAGGTGGTGGTC
R: CTTCAGGAGTTCATCCATGTTC
AtABI5F: CAATAAGAGAGGGATAGCGAACGAG
R: CGTCCATTGCTGTCTCCTCCA
AtRAB18F:CAGCAGCAGTATGACGAGTA
R:CAGTTCCAAAGCCTTCAGTC
AtRD19F:TCGGTTTCGTCTGATG
R:GACGGATCCAACTTCTGGTG
AtDREB2AF: CGACTGTTGATTCTCTAT
R: TTATTCATTCCTGTTGTTAC
AtActinF: GGTAACATTGTGCTCAGTGGTGG
R: AACGACCTTAATCTTCATGCTGC

References

  1. Castaares, J.L.; Bouzo, C.A.; Laboratory, P.P. Effect of exogenous melatonin on seed germination and seedling growth in melon (Cucumis melo L.) under salt stress. Hortic. Plant J. 2019, 5, 79–87. [Google Scholar] [CrossRef]
  2. Feng, Q.; Yin, X.; Zhu, M.; Zhang, J.; Liu, W.; Xi, H.; Yu, T.; Yang, L.; Liu, W.; Lu, Z. Overall promotion of integrated management and utilization of saline-alkali land in Northwest China: Conditions, challenges, and recommendations. Bull. Chin. Acad. Sci. 2024, 39, 2060–2073. [Google Scholar]
  3. Tanveer, A.; Arshad, M.; Ayub, M.; Javaid, M.M.; Yaseen, M. Effetct of temperature, light, salinity, drought stress and seeding depth on germination of Cucumis melo var. agrestis. Pak. J. Weed Sci. Res. 2012, 18, 445–459. [Google Scholar]
  4. Kusvuran, S.; Ellïaltıoğlu, S.; Yasar, F.; Abak, K. Effects of salt stress on ion accumulation and activity of some antioxidant enzymes in melon (Cucumis melo L.). Int. J. Food Agric. Environ. 2007, 5, 351–354. [Google Scholar]
  5. Sivritepe, N.; Sivritepe, H.O.; Eris, A. The effects of NaCl priming on salt tolerance in melon seedlings grown under saline conditions. Sci. Hortic. 2003, 97, 229–237. [Google Scholar] [CrossRef]
  6. Zhang, S.P.; Dong, S.Y.; Guan, J.T.; Miao, H.; Liu, X.P.; Gu, X.F. Research progress on molecular breeding of disease resistance in cucumber. Acta Hortic. Sin. 2025, 1, 1–19. [Google Scholar] [CrossRef]
  7. Zhang, Y.; Jiang, W.; Yu, H.; Yang, X. Exogenous abscisic acid alleviates low temperature-induced oxidative damage inseedlings of Cucumis sativus. L. Trans. Chin. Soc. Agric. Eng. (Trans. CSAE) 2012, 28, 221–228. [Google Scholar]
  8. Xiao-Yu, L.I.; Chun-Sheng, M.U. Effects of salt and alkali stresses, and exogenous plant hormones on growth and development of wheat and L. chinensis. Acta Agrestia Sin. 2017, 25, 257. [Google Scholar]
  9. Wu, N.; Nie, D.D.; Chen, L.; Wang, N.N. Progress of exogenous abscisic acid in salt-alkali stress in rice. Mol. Plant Breed. 2018, 16, 275–279. [Google Scholar]
  10. Liu, D.R.; Dong, S.Y.; Miao, H.; Bo, K.L.; Zhang, S.P.; Gu, X.F. Research progress on genetic breeding of Cucumber tolerance for salt stress. China Veg. 2021, 07, 14–23. [Google Scholar]
  11. Cutler, S.R.; Rodriguez, P.L.; Finkelstein, R.R.; Abrams, S.R. Abscisic acid: Emergence of a core signaling network. Annu. Rev. Plant Biol. 2010, 61, 651–679. [Google Scholar] [CrossRef]
  12. Ke, D.X.; Peng, K.P.; Xia, Y.J.; Zhu, Y.Y.; Zhang, D.D. Cloning of salt-stressed responsive gene GmWRKY6 and salt resistance analysis of transgenic Lotus japonicus. Acta Prataculturae Sin. 2018, 27, 95–106. [Google Scholar]
  13. Jue, D.W.; Sang, X.L.; Shu, B.; Liu, L.Q.; Wang, Y.C.; Shi, S.Y. Analysis of abiotic stress expression in maize WRKY transcription factor. Guangdong Agric. Sci. 2017, 44, 15–22+12. [Google Scholar]
  14. Sun, X.C.; Gao, Y.F.; Li, H.R.; Yang, S.Z.; Liu, Y.S. Over-expression of SlWRKY39 leads to enhanced resistance to multiple stress factors in tomato. J. Plant Biol. 2015, 58, 52–60. [Google Scholar] [CrossRef]
  15. Ling, J.; Jiang, W.; Zhang, Y.; Yu, H.; Xie, B. Genome-wide analysis of WRKY gene family in Cucumis sativus. BMC Genom. 2011, 12, 471. [Google Scholar] [CrossRef] [PubMed]
  16. Zhang, Y.; Yu, H.; Yang, X.; Li, Q.; Ling, J.; Wang, H.; Gu, X.; Huang, S.; Jiang, W. CsWRKY46, a WRKY transcription factor from cucumber, confers cold resistance in transgenic-plant by regulating a set of cold-stress responsive genes in an ABA-dependent manner. Plant Physiol. Biochem. 2016, 108, 478–487. [Google Scholar] [CrossRef] [PubMed]
  17. Yu, Y.; Wang, L.; Chen, J.; Liu, Z.; Park, C.-M.; Xiang, F. WRKY71 acts antagonistically against salt-delayed flowering in Arabidopsis thaliana. Plant Cell Physiol. 2018, 59, 414–422. [Google Scholar] [CrossRef] [PubMed]
  18. Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef]
  19. Lee, H.; Guo, Y.; Ohta, M.; Xiong, L.; Stevenson, B.; Zhu, J.K. LOS2, a genetic locus required for cold-responsive gene transcription encodes a bi-functional enolase. EMBO J. 2002, 21, 2692–2702. [Google Scholar] [CrossRef]
  20. Giannopolitis, C.N.; Ries, S.K. Superoxide Dismutases: I. Occurrence in Higher Plants. Plant Physiol. 1977, 59, 309–314. [Google Scholar] [CrossRef] [PubMed]
  21. Moerschbacher, B.M.; Noll, U.M.; Flott, B.E.; Reisener, H.J. Lignin biosynthetic enzymes in stem rust infected, resistant and susceptible near-isogenic wheat lines. Physiol. Mol. Plant Pathol. 1988, 33, 33–46. [Google Scholar] [CrossRef]
  22. Wang, H.; Jiang, Y.; Shi, K.; Zhou, Y.; Yu, J. Effects of light quality on leaf senescence and activities of antioxidant enzymes in cucumber plants. Sci. Agric. Sin. 2010, 43, 529–534. [Google Scholar]
  23. Diao, Q.; Song, Y.; Qi, H. Exogenous spermidine enhances chilling tolerance of tomato (Solanum lycopersicum L.) seedlings via involvement in polyamines metabolism and physiological parameter levels. Acta Physiol. Plant. 2015, 37, 230. [Google Scholar] [CrossRef]
  24. Su, H.L.; Zhang, Y.; Xue, H.; Sun, B. Horticultural plant cold resistance mechanism under WRKY transcription factor and fugar interaction. Mol. Plant Breed. 2022, 14, 1–15. [Google Scholar]
  25. Chen, L.Y.; Li, J.J.; Wang, B.; Du, W.Q.; Gao, M.X.; Liu, H.; Tan, S.Q.; Qiu, L.J.; Wang, X.B. Research progress on the function of WRKY transcription factor response to biotic and abiotic stresses in soybean. J. Plant Genet. Resour. 2022, 23, 323–332. [Google Scholar]
  26. Fan, H.F.; Guo, S.R.; Duan, J.J.; Du, C.X.; Sun, J. Effects of exogenous NO on cucumber (cucumis sativus L.) seedling growth and glutathione antioxidant enzyme system under NaCl stress. Acta Ecol. Sin. 2008, 6, 2511–2517. [Google Scholar]
  27. Hniličková, H.; Hniličk, F.; Orsák, M.; Hejnák, V. Effect of salt stress on growth, electrolyte leakage, Na+ and K+ content in selected plant species. Plant Soil Environ. 2019, 65, 90–96. [Google Scholar] [CrossRef]
  28. Xia, X.J.; Wang, Y.J.; Zhou, Y.H.; Tao, Y.; Mao, W.H.; Shi, K.; Yu, J.Q. Reactive oxygen species are involved in brassinosteroid-induced stress tolerance in cucumber. Plant Physiol. 2009, 150, 801–814. [Google Scholar] [CrossRef]
  29. Xia, X.J. Physiological and Molecular Mechanisms of Brassinolide Regulating Photosynthesis, Stress Resistance and Pesticide Metabolism in Cucumber. Ph.D. Thesis, Zhe Jiang University, Hangzhou, China, 2009. [Google Scholar]
  30. Zhu, H.; Jiang, Y.; Guo, Y.; Huang, J.; Zhou, M.; Tang, Y.; Sui, J.; Wang, J.; Qiao, L. A novel salt inducible WRKY transcription factor gene, AhWRKY75, confers salt tolerance in transgenic peanut. Plant Physiol Biochem. 2021, 160, 175–183. [Google Scholar] [CrossRef]
  31. Rai, G.K.; Mishra, S.; Chouhan, R.; Mushtaq, M.; Chowdhary, A.A.; Rai, P.K.; Kumar, R.R.; Kumar, P.; Perez-Alfocea, F.; Colla, G.; et al. Plant salinity stress, sensing, and its mitigation through WRKY. Front. Plant Sci. 2023, 14, 1238507. [Google Scholar] [CrossRef] [PubMed]
  32. Zhang, X. Functional Analysis of Maize Transcription Factor ABP9 in ROS Metabolic Balance, ABA Signaling and Abiotic Stress Tolerance in Transgenic Arabidopsis Thaliana. Ph.D. Thesis, Chinese Academy of Agricultural Sciences, Beijing, China, 2008. [Google Scholar]
  33. Wei, Z.Y. Cloning and Functional Analysis of Wheat NAC Gene Related to ABA Stress. Master’s Thesis, Shandong University, Jinan, China, 2015. [Google Scholar]
  34. Cai, X.F.; Hu, T.X.; Ye, J.; Zhang, Y.Y.; Li, H.X.; Ye, Z.B. Advances in molecular mechanisms of plant salt stress resistance. J. Huazhong Agric. Univ. 2015, 34, 134–141. [Google Scholar]
  35. Zhu, D.; Hou, L.; Xiao, P.; Guo, Y.; Deyholos, M.K.; Liu, X. VvWRKY30, a grape WRKY transcription factor, plays a positive regulatory role under salinity stress. Plant Sci. 2019, 280, 132–142. [Google Scholar] [CrossRef] [PubMed]
  36. Cao, Y.J.; Wei, Q.; Liao, Y.; Song, H.L.; Li, X.; Xiang, C.B.; Kuai, B.K. Ectopic overexpression of AtHDG11 in tall fescue resulted in enhanced tolerance to drought and salt stress. Plant Cell Rep. 2009, 28, 579–588. [Google Scholar] [CrossRef] [PubMed]
  37. Yu, L.; Wu, S.; Peng, Y.; Liu, R.; Chen, X.; Zhao, P.; Xu, P.; Zhu, J.; Jiao, G.; Pei, Y.; et al. Arabidopsis EDT1HDG11 improves drought and salt tolerance in cotton and poplar and increases cotton yield in the field. Plant Biotechnol. J. 2016, 14, 72–84. [Google Scholar] [CrossRef] [PubMed]
  38. Ma, Z.; Hu, L. WRKY transcription factor responses and tolerance to abiotic stresses in plants. Int. J. Mol. Sci. 2024, 25, 6845. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Electrolyte leakage and relative water content of leaves from cucumber plants subjected to different salt stress and abscisic acid (ABA) treatments. CK, control plants; CK+ABA, plants pretreated with ABA; NaCl, salt-stressed plants; NaCl+ABA, salt-stressed plants pretreated with ABA. Standard error bars (+/− STDEV) represent three independent experiments. Different lowercase letters represent significant differences between values obtained on the same day (p < 0.05, Duncan’s multiple range tests, the same as below).
Figure 1. Electrolyte leakage and relative water content of leaves from cucumber plants subjected to different salt stress and abscisic acid (ABA) treatments. CK, control plants; CK+ABA, plants pretreated with ABA; NaCl, salt-stressed plants; NaCl+ABA, salt-stressed plants pretreated with ABA. Standard error bars (+/− STDEV) represent three independent experiments. Different lowercase letters represent significant differences between values obtained on the same day (p < 0.05, Duncan’s multiple range tests, the same as below).
Horticulturae 11 00251 g001
Figure 2. Changes in antioxidant enzyme activities in leaves of cucumber plants subjected to different salt stress and abscisic acid (ABA) treatments. The superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), ascorbate peroxidase (APX), and glutathione reductase (GR) activities were measured. The treatments are as follows: CK, control plants; CK+ABA, plants pretreated with ABA; NaCl, salt-stressed plants; NaCl+ABA, salt-stressed plants pretreated with ABA. Standard error bars represent three independent experiments. Different lowercase letters represent significant differences between values obtained on the same day.
Figure 2. Changes in antioxidant enzyme activities in leaves of cucumber plants subjected to different salt stress and abscisic acid (ABA) treatments. The superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), ascorbate peroxidase (APX), and glutathione reductase (GR) activities were measured. The treatments are as follows: CK, control plants; CK+ABA, plants pretreated with ABA; NaCl, salt-stressed plants; NaCl+ABA, salt-stressed plants pretreated with ABA. Standard error bars represent three independent experiments. Different lowercase letters represent significant differences between values obtained on the same day.
Horticulturae 11 00251 g002
Figure 3. Changes in relative transcription levels of mRNA in leaves of cucumber plants. The relative transcription levels of the mRNA of catalases (CATs) 1–3, peroxidases (PODs) 1–5, and superoxide dismutases (SODs) 1–4. The treatments shown are salt-stressed plants (NaCl) and salt-stressed plants pretreated with abscisic acid (NaCl+ABA). Standard error bars represent three independent experiments. Different lowercase letters represent significant differences between values obtained at the same time point.
Figure 3. Changes in relative transcription levels of mRNA in leaves of cucumber plants. The relative transcription levels of the mRNA of catalases (CATs) 1–3, peroxidases (PODs) 1–5, and superoxide dismutases (SODs) 1–4. The treatments shown are salt-stressed plants (NaCl) and salt-stressed plants pretreated with abscisic acid (NaCl+ABA). Standard error bars represent three independent experiments. Different lowercase letters represent significant differences between values obtained at the same time point.
Horticulturae 11 00251 g003
Figure 4. Changes in relative transcription levels of mRNA in cucumber roots. The relative transcription levels of the mRNA of catalases (CATs) 1–3, peroxidases (PODs) 1–5, and superoxide dismutases (SODs) 1–4. The treatments shown are salt-stressed plants (NaCl) and salt-stressed plants pretreated with abscisic acid (NaCl+ABA). Standard error bars represent three independent experiments. Different lowercase letters represent significant differences between values obtained at the same time point.
Figure 4. Changes in relative transcription levels of mRNA in cucumber roots. The relative transcription levels of the mRNA of catalases (CATs) 1–3, peroxidases (PODs) 1–5, and superoxide dismutases (SODs) 1–4. The treatments shown are salt-stressed plants (NaCl) and salt-stressed plants pretreated with abscisic acid (NaCl+ABA). Standard error bars represent three independent experiments. Different lowercase letters represent significant differences between values obtained at the same time point.
Horticulturae 11 00251 g004
Figure 5. The CsWRKY46 gene responds to salt stress in cucumber leaves and roots. The treatments shown are salt-stressed plants (NaCl) and salt-stressed plants pretreated with abscisic acid (NaCl+ABA). Standard error bars (+/− STDEV) represent three independent experiments. Different lowercase letters represent significant differences between values obtained at the same time point.
Figure 5. The CsWRKY46 gene responds to salt stress in cucumber leaves and roots. The treatments shown are salt-stressed plants (NaCl) and salt-stressed plants pretreated with abscisic acid (NaCl+ABA). Standard error bars (+/− STDEV) represent three independent experiments. Different lowercase letters represent significant differences between values obtained at the same time point.
Horticulturae 11 00251 g005
Figure 6. Relative expression of the CsWRKY46 gene mRNA in the fruits of cucumber plants subjected to different treatments. The treatments shown are as follows: CK, control; NaCl, salt stress; and NaCl+ABA, salt stress with abscisic acid (ABA) pretreatment. Standard error bars (+/− STDEV) represent three independent experiments. Different lowercase letters represent significant differences between values obtained on the same day.
Figure 6. Relative expression of the CsWRKY46 gene mRNA in the fruits of cucumber plants subjected to different treatments. The treatments shown are as follows: CK, control; NaCl, salt stress; and NaCl+ABA, salt stress with abscisic acid (ABA) pretreatment. Standard error bars (+/− STDEV) represent three independent experiments. Different lowercase letters represent significant differences between values obtained on the same day.
Horticulturae 11 00251 g006
Figure 7. Electrolyte leakage, relative water content, proline, and solution sugar contents in the WT and CsWRKY46 overexpression Arabidopsis lines under salt stress. Four-week-old plants were treated with 150 mmol·L−1 NaCl for 7 days. The data represent the means of three replicates. p < 0.05 (Duncan’s multiple range); similar results were observed in three independent experiments. Different lowercase letters represent significant differences between values obtained on the same day.
Figure 7. Electrolyte leakage, relative water content, proline, and solution sugar contents in the WT and CsWRKY46 overexpression Arabidopsis lines under salt stress. Four-week-old plants were treated with 150 mmol·L−1 NaCl for 7 days. The data represent the means of three replicates. p < 0.05 (Duncan’s multiple range); similar results were observed in three independent experiments. Different lowercase letters represent significant differences between values obtained on the same day.
Horticulturae 11 00251 g007
Figure 8. Changes in POD, GR, APX, and CAT activity in the WT and CsWRKY46 overexpression plants under salt stress. The plants were treated with 150 mmol·L−1 NaCl for 7 days. The data represent the means of three replicates. p < 0.05 (Duncan’s multiple range tests); similar results were observed in three independent experiments. Different lowercase letters represent significant differences between values obtained on the same day.
Figure 8. Changes in POD, GR, APX, and CAT activity in the WT and CsWRKY46 overexpression plants under salt stress. The plants were treated with 150 mmol·L−1 NaCl for 7 days. The data represent the means of three replicates. p < 0.05 (Duncan’s multiple range tests); similar results were observed in three independent experiments. Different lowercase letters represent significant differences between values obtained on the same day.
Horticulturae 11 00251 g008
Figure 9. Expression of marker genes for salt stress in WT and CsWRKY46 overexpression plants by qRT-PCR. The data represent the means of three replicates, and similar results were observed in three independent experiments. Different lowercase letters represent significant differences between values obtained on the same day.
Figure 9. Expression of marker genes for salt stress in WT and CsWRKY46 overexpression plants by qRT-PCR. The data represent the means of three replicates, and similar results were observed in three independent experiments. Different lowercase letters represent significant differences between values obtained on the same day.
Horticulturae 11 00251 g009
Table 1. Effects of exogenous ABA on the growth of cucumber seedlings under salt stress. Different lowercase letters represent significant differences between values obtained on the same day.
Table 1. Effects of exogenous ABA on the growth of cucumber seedlings under salt stress. Different lowercase letters represent significant differences between values obtained on the same day.
TreatmentIncrease in Plant Height (cm)Increase in Stem Thickness (mm)Increase in Leaf
Number
Fresh Weight (g)Dry Weight (g)
CK58.78 ± 2.95 a0.67 ± 0.09 b4 ± 0.25 a5.00 ± 0.19 a0.94 ± 0.01 a
CK+ABA62.67 ± 1.83 a0.94 ± 0.04 a3.67 ± 0.1 a5.07 ± 0.47 a0.95 ± 0.04 a
NaCl21.33 ± 2.76 b0.64 ± 0.06 b2.44 ± 0.11 b3.72 ± 0.34 b0.86 ± 0.02 a
NaCl+ABA24.44 ± 3.97 b0.58 ± 0.03 b2.56 ± 0.09 b3.79 ± 0.59 b0.93 ± 0.10 a
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Bai, X.; Liu, P.; Zhu, F.; Zhang, C.; Pang, H.; Zhang, Y. CsWRKY46 Is Involved in the Regulation of Cucumber Salt Stress by Regulating Abscisic Acid and Modulating Cellular Reactive Oxygen Species. Horticulturae 2025, 11, 251. https://doi.org/10.3390/horticulturae11030251

AMA Style

Bai X, Liu P, Zhu F, Zhang C, Pang H, Zhang Y. CsWRKY46 Is Involved in the Regulation of Cucumber Salt Stress by Regulating Abscisic Acid and Modulating Cellular Reactive Oxygen Species. Horticulturae. 2025; 11(3):251. https://doi.org/10.3390/horticulturae11030251

Chicago/Turabian Style

Bai, Xue, Pengyu Liu, Fangyi Zhu, Chong Zhang, Hongbo Pang, and Ying Zhang. 2025. "CsWRKY46 Is Involved in the Regulation of Cucumber Salt Stress by Regulating Abscisic Acid and Modulating Cellular Reactive Oxygen Species" Horticulturae 11, no. 3: 251. https://doi.org/10.3390/horticulturae11030251

APA Style

Bai, X., Liu, P., Zhu, F., Zhang, C., Pang, H., & Zhang, Y. (2025). CsWRKY46 Is Involved in the Regulation of Cucumber Salt Stress by Regulating Abscisic Acid and Modulating Cellular Reactive Oxygen Species. Horticulturae, 11(3), 251. https://doi.org/10.3390/horticulturae11030251

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop