First Report of the Peach Leaf Spot Caused by Nigrospora sphaerica in China
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Isolation and Purification of Pathogenic Fungi
2.3. Morphological Identification
2.4. Molecular Identification and Phylogenetic Analysis
2.5. Pathogenicity Test
3. Results
4. Discussion
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- RawanRawandoozi, Z.J.; Hartmann, T.P.; Carpenedo, S.; Gasic, K.; da Silva Linge, C.; Cai, L.; Van de Weg, E.; Byrne, D.H. Identification and characterization of QTLs for fruit quality traits in peach through a multi-family approach. BMC Genom. 2020, 21, 522. [Google Scholar] [CrossRef]
- Karim, M.M.; Usman, H.M.; Tan, Q.; Hu, J.-J.; Fan, F.; Hussain, R.; Luo, C.-X. Fungicide resistance in Colletotrichum fructicola and Colletotrichum siamense causing peach anthracnose in China. Pestic. Biochem. Physiol. 2024, 203, 106006. [Google Scholar] [CrossRef] [PubMed]
- Luo, C.-X.; Schnabel, G.; Hu, M.; De Cal, A. Global distribution and management of peach diseases. Phytopathol. Res. 2022, 4, 30. [Google Scholar] [CrossRef]
- Dong, J.; Shi, H.; Wu, Y.; Yang, L.; Zhu, F.; Ji, Z. Identification and pathogenicity analysis of Fusarium spp. on peach in China. BMC Microbiol. 2023, 23, 211. [Google Scholar] [CrossRef]
- Zhou, Y.; Manawasinghe, I.S.; He, Z.; Zhang, W.; Liu, M.; Song, J.; Li, S.; Fan, Z.; Yan, J. Microfungi Associated with Peach Branch Diseases in China. J. Fungi 2024, 10, 217. [Google Scholar] [CrossRef]
- Yang, L.; Wang, L.; Cao, J.; Zhu, Y.; Zhang, L.; Jin, W.; Zhu, F.; Ji, Z. Molecular and Biological Characterization of Two New Species Causing Peach Shoot Blight in China. Plant Dis. 2022, 106, 182–189. [Google Scholar] [CrossRef]
- Jin, S.; Wang, N.; Zhou, Z.; Ji, Z.; Zhang, J. Identification of Bacillus species causing bacterial leaf spot of peach in China. J. Phytopathol. 2022, 170, 811–819. [Google Scholar] [CrossRef]
- Inoue, K.; Nasu, H. Black Spot of Peach Caused by Alternaria alternata (Fr.) Keissler. J. Gen. Plant Pathol. 2000, 66, 18–22. [Google Scholar] [CrossRef]
- Ji, Z.L.; Zhang, S.W.; Zhu, F.; Wan, B.X.; Liang, R.Z. First Report of Arthrinium arundinis Causing Leaf Edge Spot of Peach in China. Plant Dis. 2020, 104, 3077. [Google Scholar] [CrossRef]
- Petrović, E.; Vrandečić, K.; Ćosić, J.; Đermić, E.; Godena, S. First Report of Nigrospora Species Causing Leaf Spot on Olive (Olea europaea L.). Horticulturae 2023, 9, 1067. [Google Scholar] [CrossRef]
- Wang, M.; Liu, F.-l.; Crous, P.W.; Cai, L.-Z. Phylogenetic reassessment of Nigrospora: Ubiquitous endophytes, plant and human pathogens. Persoonia Mol. Phylogeny Evol. Fungi 2017, 39, 118–142. [Google Scholar] [CrossRef] [PubMed]
- Alam, M.W.; Rehman, A.; Ahmad, S.; Sarwar, M.; Nawaz, A.; Khan, S.M.; Ali, S.; Aslam, S.; Mannan, A. First report of Nigrospora sphaerica causing leaf spot of date palm in Pakistan. J. Plant Pathol. 2020, 102, 223. [Google Scholar] [CrossRef]
- Ismail, S.I.; Abd Razak, N.F. First Report of Nigrospora sphaerica Causing Leaf Spot on Watermelon (Citrullus lanatus) in Malaysia. Plant Dis. 2021, 105, 488. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Cernava, T.; Zhou, X.; Yang, L.; Baccelli, I.; Wang, J.; Gou, Y.; Sang, W.; Chen, X. First Report of Passion Fruit Leaf Blight Caused by Nigrospora sphaerica in China. Plant Dis. 2022, 106, 323. [Google Scholar] [CrossRef]
- Wang, Y.; Li, H.; Liu, L.; Javed, K.; Lin, J.; Li, Z.; Ding, H. First Report of Nigrospora sphaerica Causing Leaf Spot on Rhododendron simsii in China. Plant Dis. 2024, 108, 1395. [Google Scholar] [CrossRef]
- Villanueva, J.D.; Solpot, T.C.; Tangonan, N.G. Nigrospora sphaerica causing Leaf Blight Disease of Cacao in the Philippines. Indian Phytopathol. 2023, 76, 915–922. [Google Scholar] [CrossRef]
- Liu, J.; Deng, Y.; Liu, Q.; Zhang, K.; Zhao, Y.; Ma, T.; Chang, W.; Wang, H. First Report of Leaf Blight on Pumpkin Caused by Nigrospora sphaerica in China. Plant Dis. 2024, 108, 2574. [Google Scholar] [CrossRef]
- Hao, Y.; Aluthmuhandiram, J.V.S.; Chethana, K.W.T.; Manawasinghe, I.S.; Li, X.; Liu, M.; Hyde, K.D.; Phillips, A.J.L.; Zhang, W. Nigrospora Species Associated with Various Hosts from Shandong Peninsula, China. Mycobiology 2020, 48, 169–183. [Google Scholar] [CrossRef]
- Lee, S.B.; Milgroom, M.G.; Taylor, J.W. A rapid, high yield mini-prep method for isolation of total genomic DNA from fungi. Fungal Genet. Rep. 1988, 35, 23–24. [Google Scholar] [CrossRef]
- White, T.J.; Bruns, T.D.; Lee, S.B.; Taylor, J.W. 38—Amplification and direct sequencing of fungal ribosomal RNA Genes for phylogenetics. In PCR—Protocols and Applications—A Laboratory Manual; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press, Inc.: Cambridge, MA, USA, 1990; pp. 315–322. [Google Scholar]
- Woudenberg, J.H.C.; Aveskamp, M.M.; Gruyter, J.; Spiers, A.G.; Crous, P. Multiple Didymella teleomorphs are linked to the Phoma clematidina morphotype. Persoonia 2009, 22, 56–62. [Google Scholar] [CrossRef]
- Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
- Shi, J.; Li, B.; Wang, S.; Zhang, W.; Shang, M.; Wang, Y.; Liu, B. Occurrence of Neopestalotiopsis clavispora Causing Apple Leaf Spot in China. Agronomy 2024, 14, 1658. [Google Scholar] [CrossRef]
- Bansal, N.; Juwantha, R.; Pandey, S. Morphology and ITS-based phylogeny revealed Nigrospora sphaerica causing leaf spot and blight disease of Bambusa polymorpha in India. Physiol. Mol. Plant Pathol. 2024, 132, 102315. [Google Scholar] [CrossRef]
- Khoo, Y.W.; Khaw, Y.S.; Tan, H.T.; Li, S.-F.; Chong, K.P. First Report of Stem Brown Spot on ‘Thai Gold’ Selenicereus megalanthus in Malaysia Caused by Nigrospora sphaerica. Plant Dis. 2023, 107, 223. [Google Scholar] [CrossRef]
- Sadid, K.N.E.; Hossain, M.A.; Munshi, A.R.; Karim, M.R. First detection, isolation and molecular characterization of banana leaf spot diseases caused by Nigrospora sphaerica and Neocordana musae in Bangladesh. Arch. Phytopathol. Plant Prot. 2023, 56, 1112–1125. [Google Scholar] [CrossRef]
- Li, J.; Xu, J.; Wang, H.; Wu, C.; Zheng, J.; Zhang, C.; Han, Y. First Report of Fungal Pathogens Causing Leaf Spot on Sorghum–Sudangrass Hybrids and Their Interactions with Plants. Plants 2023, 12, 3091. [Google Scholar] [CrossRef]
- Zeng, Y.; Luo, M.-Y.; Yang, M.-f.; Jiang, Y.-L. First Report of Leaf Spot on Zanthoxylum bungeanum Caused by Nigrospora sphaerica in China. Plant Dis. 2024, 108, 812. [Google Scholar] [CrossRef]
- Tejaswini, G.S.; Mahadevakumar, S.; Joy, J.; Chandranayaka, S.; Niranjan Raj, S.; Devi, L.; Sowjanya, R.; Sowmya, R. First Report of Nigrospora sphaerica Associated with Leaf Spot Disease of Crossandra infundibuliformis in India. Plant Dis. 2023, 107, 2218. [Google Scholar] [CrossRef]
Gene | Primer | Sequence (5′–3′) | Size |
---|---|---|---|
ITS | ITS1 | TCCGTAGGTGAACCTGCGG | 555 bp |
ITS4 | TCCTCCGCTTATTGATATGC | ||
TEF1-a | EF1-728F | CATCGAGAAGTTCGAGAAGG | 279 bp |
EF1-986R | TACTTGAAGGAACCCTTACC | ||
TUB2 | Bt2a | GGTAACCAAATCGGTGCTGCTTTC | 434 bp |
Bt2b | ACCCTCAGTGTAGTGACCCTTGGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, H.; Wang, H.; Ishfaq, S.; Guo, W. First Report of the Peach Leaf Spot Caused by Nigrospora sphaerica in China. Horticulturae 2024, 10, 1260. https://doi.org/10.3390/horticulturae10121260
Li H, Wang H, Ishfaq S, Guo W. First Report of the Peach Leaf Spot Caused by Nigrospora sphaerica in China. Horticulturae. 2024; 10(12):1260. https://doi.org/10.3390/horticulturae10121260
Chicago/Turabian StyleLi, Huan, Han Wang, Shumila Ishfaq, and Wei Guo. 2024. "First Report of the Peach Leaf Spot Caused by Nigrospora sphaerica in China" Horticulturae 10, no. 12: 1260. https://doi.org/10.3390/horticulturae10121260
APA StyleLi, H., Wang, H., Ishfaq, S., & Guo, W. (2024). First Report of the Peach Leaf Spot Caused by Nigrospora sphaerica in China. Horticulturae, 10(12), 1260. https://doi.org/10.3390/horticulturae10121260