Next Article in Journal
The Effect of Maternal Obesity on Placental Autophagy in Lean Breed Sows
Previous Article in Journal
Integrated Transcriptome Analysis Reveals the Lung miRNA–mRNA Regulatory Network Associated with Avian Pathogenic E. coli Infection
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Luteolin Alleviates Inflammation Induced by Staphylococcus aureus in Bovine Mammary Epithelial Cells by Attenuating NF-κB and MAPK Activation

1
School of Physical Education, Wuhan Business University, Wuhan 430056, China
2
Department of Clinical Veterinary Medicine, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430056, China
3
College of Animal Science and Technology, Chongqing Three Gorges Vocational College, Chongqing 404155, China
4
College of Veterinary Medicine, Yunnan Agricultural University, Kunming 650201, China
5
Department of College of Veterinary Medicine, South China Agricultural University, Guangzhou 510642, China
*
Author to whom correspondence should be addressed.
Vet. Sci. 2025, 12(2), 96; https://doi.org/10.3390/vetsci12020096
Submission received: 19 November 2024 / Revised: 11 January 2025 / Accepted: 23 January 2025 / Published: 27 January 2025
(This article belongs to the Section Veterinary Microbiology, Parasitology and Immunology)

Simple Summary

Infection of udder tissue by pathogens is the main cause of bovine mastitis. Mastitis results in substantial financial losses for the dairy industry by reducing milk production, compromising the quality of dairy products, and elevating mortality rates. The most common pathogen causing mastitis is Staphylococcus aureus. The initial line of defence of mammary tissue consists of immune cells and mammary epithelial cells. Antibiotics are typically used to treat mastitis nowadays. However, the overuse of these medications has increased bacterial resistance, endangering human health. As a result, creating extremely efficient treatments with minimal toxicity and residue is essential. Research indicates that luteolin, a plant extract, has a number of advantageous qualities, including neuroprotective, anti-inflammatory, antioxidant, and antitumor actions. We examined the potential of luteolin as a therapeutic agent for the treatment of bovine mammary epithelial cells in the context of Staphylococcus aureus infection, thereby establishing a foundation for future management strategies for bovine mastitis. It is anticipated that this extract will find widespread application in the future.

Abstract

The internalization of S. aureus in bMECs is a major pathogenic mechanism leading to mastitis, causing significant economic losses in the dairy industry. Numerous plants contain Lut, a natural flavonoid with anti-inflammatory and antioxidant properties. However, little is known about Lut’s ability to reduce inflammation caused by S. aureus in bMECs. This research aimed to evaluate the mechanism by which Lut reduces S. aureus-induced inflammation in bMECs. Through GO and KEGG enrichment analysis, researchers analyzed the differentially expressed genes in bMECs infected with S. aureus in NCBI GEO (GSE139612) and also analyzed the targets of Lut predicted by various online platforms. These studies identified two overlapping signaling pathways, the NF-κB and the MAPK pathways. We stimulated bMECs with S. aureus for two hours and then added Lut for ten hours, with a total duration of twelve hours. The expression levels of TLR2-MyD88-TRAF6 components, inflammatory cytokines, and protein phosphorylation associated with the MAPK and NF-κB signaling pathways were then assessed. Based on all of the results, Lut inhibited the generation of inflammatory cytokines in bMECs that were induced by S. aureus through the TLR2, NF-κB, and MAPK signaling pathways. This process might account for the anti-inflammatory properties of Lut.

1. Introduction

Mastitis in dairy cows is widely recognized as the most prevalent and economically impactful disease affecting global dairy herds, resulting in substantial financial losses [1]. An estimated 200 distinct species of microorganisms have been identified as potential causative agents of mastitis in cows. Among these, bacteria, fungi, and viruses are the predominant pathogenic microbes associated with this condition [2]. Among them, Staphylococcus aureus (S. aureus) is one of the most common causes of bovine mastitis worldwide [3]. Antibiotics are now used to treat bovine mastitis induced by S. aureus, but their residues pose serious risks to human health [4]. Therefore, veterinarians and related professionals have invested a lot of energy in strengthening the local innate immune system to defend against dangerous microorganisms.
In order to identify harmful pathogens and regulate inflammation, mammary epithelial cells express pathogen recognition receptors (PRRs), which promote the synthesis of cytokines [5,6]. Innate immune responses are significantly influenced by toll-like receptors (TLRs) [7]. Myeloid differentiation factor 88 (MyD88), which consists of two primary do-mains—the C-terminal Toll/IL-1R (TIR) domain and the N-terminal death domain—must be activated intracellularly for TLR2 signaling to be successful. The TIR domain of MyD88 interacts with the TIR domain of the TLR receptor during ligand attachment. The death domain of IL-1 receptor-associated kinase (IRAK), a serine/threonine kinase, is located in its N-terminal region and directly interacts with the death domain of MyD88. IRAK becomes phosphorylated, which attracts TNF receptor-associated factor 6 (TRAF6). When TLR2 interacts with S. aureus, it activates intracellular signaling pathways, such as nuclear factor kappa-B (NF-κB) and mitogen-activated protein kinase (MAPK), leading to inflammatory reactions [8,9,10]. In rat mammary tissue, TLR2 activation after S. aureus stimulation stimulates the phosphorylation of the MAPK (p38, ERK, JNK) and NF-κB (IκBα, p65) signaling pathways [11]. A number of important inflammatory mediators, including cytokines and chemokines, are synthesized through NF-κB and MAPK signaling [12]. Potential treatments for S. aureus-induced mastitis may be evaluated using a wealth of information from natural compounds with a wide range of biological traits, including antioxidant, anti-inflammatory, and anticancer activities.
Luteolin (Lut) is a member of the family of natural flavonoid compounds [13]. There are numerous varieties of flowers, herbs, vegetables, and spices from which it can be derived. Lut was found to inhibit the excessive release of proinflammatory markers in previous studies [14,15]. It has been demonstrated that Lut significantly reduces the phosphorylation of the NF-κB pathway in endometritis caused by S. aureus [16]. Lut may simultaneously reduce IL-1β-induced THP-1 adhesion to ARPE-19 cells and inhibit inflammatory responses by blocking the activation of the MAPK and NF-κB pathways [17]. A particular dose of Lut has been shown to cause DNA damage and apoptosis [18], and it may prevent the NF-κB pathway from producing inflammatory mediators in RAW264.7 cells infected with the pseudorabies virus [19]. The effect of Lut on bovine mastitis is still unknown, though. This work aims to improve our knowledge of the signaling pathways linked to Lut and investigate its function in the inflammatory response that S. aureus induces in bovine mammary epithelial cells (bMECs).

2. Materials and Methods

2.1. Chemicals and Reagents

Lut was obtained from Shanghai Yuanye Bio-Technology Co., Ltd., located in Shanghai, China. S. aureus (ATCC 25923), which can cause mastitis in dairy cows, was acquired via Shanghai Fuxiang Biotechnology Co., Ltd., located in Shanghai, China [20]. The Nanjing Jiancheng Bioengineering Institute in Nanjing, China is the source of the cytokine ELISA kits (IL-1β, IL-6, and TNF-α). RT-qPCR and CCK8 reagents were purchased from Yeasen Biotechnology, Shanghai, China. Primary and secondary antibodies (TLR2, phospho-IκBα (p-IκBα), phospho-p65 (p-p65), phospho-JNK (p-JNK), phospho-ERK (p-ERK), phospho-p38 (p-p38), and β-actin) were procured from Cell Signaling Technologies, Beverly, MA, USA.

2.2. Bioinformatics Analysis

Data related to S. aureus-induced inflammatory responses of bMECs were downloaded from GEO databases for the current investigation (http://www.ncbi.nlm.nih.gov/geo/ accessed on 18 November 2024, GSE139612). After identifying differentially expressed genes (DEGs), we performed enrichment analyses utilizing the Kyoto Encyclopedia of Genes and Genomes (KEGG) database (https://www.kegg.jp/) and the Gene Ontology (GO) resource (http://geneontology.org/). The Traditional Chinese Medicine Systems Pharmacology database (TCMSP, https://old.tcmsp-e.com/tcmsp.php accessed on 18 November 2024) was used to assess the druggability of Lut. The SwissTarget Prediction (http://www.swisstargetprediction.ch/) and Herb (http://herb.ac.cn) were used to identify possible targets of Lut. Furthermore, GO and KEGG studies were used to perform enrichment analysis of targets of Lut.

2.3. High-Pressure Liquid Chromatography (HPLC) Analysis

Lut was dissolved in methanol to form solution A. Then, solution A was combined with a 0.05% trifluoroacetic acid aqueous solution to prepare mobile phase A. Mobile phase B consisted of acetonitrile, as previously described in the HPLC procedure [21]. The Lut solution was added into a Sinochrom ODS-BP chromatographic column (4.6 × 250 mm, 5 μm) at a detection wavelength of 346 nm.

2.4. Cell Counting Kit-8 (CCK-8)

The effect of Lut on MAC-T cell viability was investigated using CCK-8. First, 100 μL of media was used to culture the cells in an incubator at 37 °C with 5% CO2. A density of 1 × 105 cells per well was used for seeding in a 96-well plate. When the cells reached 90% growth, Lut (2.5 μg/mL, 5 μg/mL, 7.5 μg/mL, and 10 μg/mL) was added, and they were incubated for 12 h. After adding 10 μL of CCK-8 reagent to each well, the cells were incubated for 4 h at 37 °C in the dark. A microplate reader was used to measure the optical density (OD) at 450 nm.

2.5. Cell Culturing and Treatment Groups

The cells were grown using the bovine mammary epithelial cell line MAC-T, which was acquired from the American Type Culture Collection (ATCC, Manassas, VA, USA), in compliance with previous studies [22]. To sustain the cell culture, a 1:1 ratio of DMEM/F-12 mix supplied by Gibco (Waltham, MA, USA) was mixed with 10% fetal bovine serum. The cultivated cells were kept at 37 °C in a humidified environment with 5% CO2.
Lysogenic broth (LB) was used to cultivate S. aureus, and the LB plate counting method was used to determine the colony-forming units (CFUs) [23]. MAC-T cells in a suitable suspension state were aseptically seeded into each well of a 6-well plate. The multiplicity of infection (MOI) for S. aureus was set at 10. The introduction of S. aureus into five of the wells occurred after the cell density reached 60% to 70%. Following a two-hour incubation period, three groups were administered varying amounts of Lut. Dexamethasone (DEX), as a therapeutic drug for comparison, was added to one group. The six groups were as follows:
(1)
Control group (C.G.): without any treament;
(2)
S. aureus group (S.A.G.): only added S. aureus for 12 h;
(3)
S. aureus + Lut group (2.5 μg/mL): added S. aureus for 2 h and then added Lut (2.5 μg/mL) for a total of 12 h;
(4)
S. aureus + Lut group (5 μg/mL): added S. aureus for 2 h and then added Lut (5 μg/mL) for a total of 12 h;
(5)
S. aureus + Lut group (7.5 μg/mL): added S. aureus for 2 h and then added Lut (7.5 μg/mL) for a total of 12 h;
(6)
S. aureus + DEX group (DEX) (5 μg/mL): added S. aureus for 2 h and then added DEX (5 μg/mL) for a total of 12 h.

2.6. Enzyme-Linked Immunosorbent Assay (ELISA) Assay

The quantities of cytokines generated by S. aureus-stimulated MAC-T cells at varying Lut concentrations were quantitatively detected through ELISA. The control group and the dexamethasone intervention group stimulated by S. aureus were also tested. As directed by the manufacturer’s instructions, the amounts of TNF-α, IL-1β, and IL-6 were quantitatively measured using an ELISA kit.

2.7. Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)

Total RNA was extracted from MAC-T cells using the TRIzol reagent (Solarbio, Bei-jing, China). An ultra-differential spectrophotometer Q5000 was used to assess the purity of the RNA, following the manufacturer’s instructions. After detecting RNA concentration, qPCR reagent (gDNA digester+), Hieff ® qPCR SYBR ® Super mixing, and Hieff ® III First strand cDNA synthesis were mixed. To determine the expression levels of the target genes, RT-qPCR was employed. Table 1 lists the primer sequences that were employed in this investigation. For quantitative analysis, the 2−ΔΔCt technique [24] was used, with the GAPDH gene as the internal reference gene.

2.8. Western Blotting

The protein content of the total protein extracted from MAC-T cells using RIPA rea-gents was measured using the BCA protein detection kit in accordance with the manufacturer’s instructions. Then, 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was used to separate the protein. The gel was then applied to the PVDF membrane to transfer the mold. The membrane was then incubated for two hours in 5% skim milk powder. The membrane was then subjected to three TBST washes. The membrane was then exposed to the main antibody for the whole night at 4 °C. After that, the membrane was cleaned once again using the proper amount of TBST. After the second antibody was added, the membrane was incubated for an hour at 37 °C.

2.9. Data Analysis

GraphPad Prism 8 software (San Diego, CA, USA) was used to conduct the statistical analysis. Data were expressed as mean ± SEM from three separate experiments. After per-forming the normality test, Student’s t-tests or one-way ANOVA were used to analyze group differences. Significance levels were indicated as # p < 0.01, * p < 0.05, and ** p < 0.01 when compared to the control group, the S. aureus group, and the S. aureus group, respectively.

3. Results

3.1. DEG Study of Inflammation Caused by S. aureus from the GEO Database

Significant changes in gene expression occur when host infection events take place. In this investigation, we used data from the GEO database (GSE139612) [25] to investigate the alterations in gene expression brought on by S. aureus infection with bMECs. DEGs in the dataset were identified using GEO2R [26], and GO and KEGG analyses were used for enrichment analysis (Figure 1). Numerous pathways, including NF-κB and MAPK, were linked to these DEGs.

3.2. Network Pharmacology of Lut

Lut possesses 179 potential targets and high medicinal properties, as seen in Figure 2. The targets were discovered to be enriched in inflammatory, immunological, and other characteristics after GO and KEGG enrichment analysis. NF-κB and MAPK were the signaling pathways in which both DEGs in GSE139612 and Lut targets were involved, according to an enrichment analysis. Thus, we would continue to investigate the MAPK and NF-κB signaling pathways to elucidate their roles in the biological processes related to Lut’s functions.

3.3. HPLC and CCK 8 Analysis

The purpose of the HPLC analysis was to guarantee the quality and purity of Lut, which was essential for the dependability of ensuing studies examining its impact on MAC-T cells. The extract was found to be highly pure (Figure 3b). CCK-8 was used to assess the cytotoxicity of Lut. The CCK-8 assay results (Figure 3c) showed that Lut did not negatively impact MAC-T cells at concentrations lower than 7.5 μg/mL.

3.4. Lut Reduced Pro-Inflammatory Cytokine Secretion from MAC-T Cells During S. aureus Infection

Cytokine expression levels were measured using RT-qPCR and ELISA. The results showed that pro-inflammatory cytokine mRNA expression levels were significantly higher in MAC-T cells infected with S. aureus and significantly lower when Lut was added as an intervention. Compared with other Lut dosages, the lowest mRNA expression levels were obtained at a Lut dosage of 7.5 μg/mL compared with other Lut dosages (Figure 4a–c). For TNF-α, IL-1β, and IL-6 levels, the RT-qPCR trend matched the ELISA results (Figure 4d–f). Lut (7.5 μg/mL) and DEX had comparable impacts on the levels of cytokine expression.

3.5. Lut Reduced TLR2 Expression in S. aureus-Infected MAC-T Cells

TLR2 initiates the chain reaction of inflammatory signals after detecting S. aureus [27]. We found that TLR2 expression was greater in the S. aureus group than in the control group. When Lut was added, it was found that TLR2 expression was lower than that in S.A.G. The relative expression levels of TLR2 in various groups are displayed in Figure 5a. The mRNA expression of IRAK4, IRAK1, and TRAF6 significantly increased in S. aureus-induced MAC-T cells; however, Lut abolished these effects. Variations of mRNA expression of MyD88, IRAK4, IRAK1, and TRAF6 under various circumstances are displayed in Figure 5b. In conclusion, Lut has been shown to down-regulate the TLR2 signaling pathway in MAC-T cells for the first time.

3.6. Lut Inhibited the Activation of NF-κB Pathway in S. aureus-Infected MAC-T Cells

Compared to the control group, the S. aureus stimulation group exhibited significantly elevated phosphorylation levels of IκBα and p65. Following the addition of Lut, immunofluorescence results indicated that Lut effectively reduced the nuclear translocation of phosphorylated p65 (p-p65) induced by S. aureus (Figure 6a). Concurrently, the phosphorylation levels of both IκBα and p65 were markedly diminished, and that of the reduction was more pronounced at higher Lut dosages (Figure 6b).

3.7. Lut Inhibited the Activation of MAPK Pathway in S. aureus-Infected MAC-T Cells

Compared to the control group, MAC-T cells infected with S. aureus exhibited noticeably greater phosphorylation levels of ERK, JNK, and p38 (Figure 7). Furthermore, ERK, JNK, and p38 phosphorylation levels significantly decreased as the dose of Lut rose.

4. Discussion

Bovine mastitis significantly impacts milk production and composition, representing one of the most costly diseases in the agricultural sector [28]. S. aureus is the predominant pathogen responsible for bovine mastitis, and it is capable of inducing both clinical and subclinical forms of the disease [29]. Through a detailed analysis of the GEO dataset (GSE139612), we identified that S. aureus infection gives rise to multiple DEGs that are enriched in inflammation-related pathways. Lut, a natural flavonoid compound derived from flowers, vegetables, and other herbs, possesses antioxidant and anti-inflammatory properties [30,31]. The cytotoxicity of Lut was evaluated in MAC-T cells, revealing that cell viability remained unaffected at concentrations below 7.5 μg/mL. Following target enrichment analysis of Lut, it was discovered that these targets were strongly enriched in the signaling pathways of MAPK, TNF-α, NF-κB, IL-17, TLRs, and so on. The pathways of enrichment of Lut targets were consistent with those in other investigations [32,33]. We discovered that the targets of Lut were involved in the same NF-κB and MAPK signaling pathways, which were the same as those of DEGs-enriched signaling pathways in GSE139612. Therefore, the purpose of this investigation is to determine whether Lut can use TLR2-NF-κB/MAPK to suppress the expression of inflammatory cytokines in MAC-T cells induced by S. aureus.
One of the most crucial TLRs in the immunological response triggered by S. aureus is TLR2 [34]. According to earlier research conducted in our lab, TLR2 effectively mediates S. aureus infections [35]. In the meantime, IRAK in the TLR2 signaling pathway is activated by the adaptor protein MyD88 [36]. Based on the results of previous bioinformatics work, we wanted to examine TLR2 activation and protein phosphorylation in NF-κB and MAPK signaling pathways in order to gain a deeper understanding of Lut’s role in S. aureus-induced MAC-T cells. TLR2 expression was measured using Western Blotting. After IRAK activation, the other adaptor protein, TRAF6, becomes phosphorylated and is attracted to IRAK in the S. aureus group [37,38]. Pathological conditions cause altered expression levels of pro-inflammatory cytokines, such as TNF-α, which is produced early in the inflammatory response, IL-1β, which is crucial for both adaptive and innate immunity [39], and IL-6, which is thought to be one of the main biomarkers of bovine mastitis [40]. While the appropriate proinflammatory cytokines are essential for boosting host immunity, overproduction of these cytokines can harm cells and tissue; therefore, their release in response to inflammatory stimuli must be tightly monitored [41]. Our findings showed that when S. aureus stimulated MAC-T cells, TLR2 expression and the pro-inflammatory cytokines IL-1β, IL-6, and TNF-α were significantly increased. These findings suggested that S. aureus activated MAC-T cells to produce severe inflammatory responses. Lut may reduce the inflammation of MAC-T cells by blocking the release of TNF-α, IL-1β, and IL-6, as evidenced by the sharp decline in pro-inflammatory cytokine and TLR2 after the addition of Lut.
By identifying pathogens and interacting with cells, TLR2 generates inflammatory cytokines that activate immune responses by activating downstream signaling pathways, such as NF-κB and MAPK [42]. Downstream of TLRs, IκBα and p65 activate important inflammatory signaling pathways and control the production and expression of inflammatory mediators [43]. Inflammatory events induce the IκBα protein to become quickly phosphorylated, which promotes the entry of p65 into the nucleus. Normally, IκBα and p65 are connected. The NF-κB signaling system is activated and numerous genes, including those that generate pro-inflammatory cytokines, are regulated. Consequently, the nuclear translocation of p65 nuclear translocation functions as a signal for NF-κB pathway activation via the previously mentioned method [44]. TLR2-mediated S. aureus inflammation has been shown to be influenced by the MAPK signaling pathway [45]. Our findings indicate that Lut suppresses protein phosphorylation in the NF-κB and MAPK signaling pathways, thereby reducing the inflammatory response in MAC-T cells induced by S. aureus.

5. Conclusions

According to this investigation, Lut prevented S. aureus from inducing an inflammatory response in MAC-T cells. This effect was partially attributed to the TLR2 signaling pathway’s attenuation. In particular, Lut inhibits the phosphorylation of p38, ERK, and JNK in the MAPK pathway and lowers the phosphorylation levels of IκBα and p65 in the NF-κB pathway, which in turn limited the synthesis of pro-inflammatory cytokines. These results collectively imply that Lut shows significant promise as an adjuvant treatment for S. aureus-induced mammary gland mastitis. Animal trials conducted in vivo can be used in future research to confirm this possibility.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/vetsci12020096/s1, Figure S1: the original image of Figure 5a in the article. Figure S2: the original image of Figure 6b in the article. Figure S3: the original image of Figure 7 in the article.

Author Contributions

Y.G., X.W. and G.D. contributed to the conception and design of the study; methodology, J.Z. and C.Y.; software, T.Y.; validation, Y.G., Q.Z. and A.S.; formal analysis, C.Y.; investigation, A.S.; resources, X.W. and G.D.; data curation, J.Z.; writing—original draft preparation, Y.G.; writing—review and editing, T.Y.; supervision, Q.Z. and A.S.; project administration, Y.G.; funding acquisition, G.D. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by a grant from the National Natural Science Foundation of China (No. 31972744) and supported by the Science and Technology Research Program of Chongqing Municipal Education Commission (Grant No. KJQN202303517).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article and Supplementary Materials.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Narayana, S.G.; Schenkel, F.; Miglior, F.; Chud, T.; Abdalla, E.A.; Naqvi, S.A.; Malchiodi, F.; Barkema, H.W. Genetic analysis of pathogen-specific intramammary infections in dairy cows. J. Dairy Sci. 2021, 104, 1982–1992. [Google Scholar] [CrossRef] [Scilit]
  2. She, Y.; Liu, J.; Su, M.; Li, Y.; Guo, Y.; Liu, G.; Deng, M.; Qin, H.; Sun, B.; Guo, J.; et al. A Study on Differential Biomarkers in the Milk of Holstein Cows with Different Somatic Cells Count Levels. Animals 2023, 13, 2446. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Akhtar, M.; Shaukat, A.; Zahoor, A.; Chen, Y.; Wang, Y.; Yang, M.; Umar, T.; Guo, M.; Deng, G. Hederacoside-C Inhibition of Staphylococcus aureus-Induced Mastitis via TLR2 & TLR4 and Their Downstream Signaling NF-κB and MAPKs Pathways In Vivo and In Vitro. Inflammation 2020, 43, 579–594. [Google Scholar] [CrossRef] [Scilit]
  4. Zhang, L.; Gu, J.; Wang, X.; Zhang, R.; Tuo, X.; Guo, A.; Qiu, L. Fate of antibiotic resistance genes and mobile genetic elements during anaerobic co-digestion of Chinese medicinal herbal residues and swine manure. Bioresour. Technol. 2018, 250, 799–805. [Google Scholar] [CrossRef] [Scilit]
  5. Günther, J.; Esch, K.; Poschadel, N.; Petzl, W.; Zerbe, H.; Mitterhuemer, S.; Blum, H.; Seyfert, H.M. Comparative kinetics of Escherichia coli- and Staphylococcus aureus-specific activation of key immune pathways in mammary epithelial cells demonstrates that S. aureus elicits a delayed response dominated by interleukin-6 (IL-6) but not by IL-1A or tumor necrosis factor alpha. Infect. Immun. 2011, 79, 695–707. [Google Scholar] [CrossRef] [Scilit]
  6. Chen, Q.; He, G.; Zhang, W.; Xu, T.; Qi, H.; Li, J.; Zhang, Y.; Gao, M.Q. Stromal fibroblasts derived from mammary gland of bovine with mastitis display inflammation-specific changes. Sci. Rep. Cetacean Res. 2016, 6, 27462. [Google Scholar] [CrossRef] [Scilit]
  7. Kornilov, F.D.; Shabalkina, A.V.; Lin, C.; Volynsky, P.E.; Kot, E.F.; Kayushin, A.L.; Lushpa, V.A.; Goncharuk, M.V.; Arseniev, A.S.; Goncharuk, S.A.; et al. The architecture of transmembrane and cytoplasmic juxtamembrane regions of Toll-like receptors. Nat. Commun. 2023, 14, 1503. [Google Scholar] [CrossRef] [Scilit]
  8. Jiang, X.; Yu, G.; Zhu, L.; Siddique, A.; Zhan, D.; Zhou, L.; Yue, M. Flanking N- and C-terminal domains of PrsA in Streptococcus suis type 2 are crucial for inducing cell death independent of TLR2 recognition. Virulence 2023, 14, 2249779. [Google Scholar] [CrossRef] [Scilit]
  9. Jiang, G.; Gong, M.; Song, H.; Sun, W.; Zhao, W.; Wang, L. Tob2 Inhibits TLR-Induced Inflammatory Responses by Association with TRAF6 and MyD88. J. Immunol. 2020, 205, 981–986. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Liu, B.; Li, Q.; Gong, Z.; Zhao, J.; Gu, B.; Feng, S. Staphylococcus aureus lipoproteins play crucial roles in inducing inflammatory responses and bacterial internalization into bovine mammary epithelial cells. Microb Pathog. 2022, 162, 105364. [Google Scholar] [CrossRef] [Scilit]
  11. Zhang, D.; Jin, G.; Liu, W.; Dou, M.; Wang, X.; Shi, W.; Bao, Y. Salvia miltiorrhiza polysaccharides ameliorates Staphylococcus aureus-induced mastitis in rats by inhibiting activation of the NF-κB and MAPK signaling pathways. BMC Vet. Res. 2022, 18, 201. [Google Scholar] [CrossRef] [Scilit]
  12. Li, H.M.; Kouye, O.; Yang, D.S.; Zhang, Y.Q.; Ruan, J.Y.; Han, L.F.; Zhang, Y.; Wang, T. Polyphenols from the Peels of Punica granatum L. and Their Bioactivity of Suppressing Lipopolysaccharide-Stimulated Inflammatory Cytokines and Mediators in RAW 264.7 Cells via Activating p38 MAPK and NF-κB Signaling Pathways. Molecules 2022, 27, 4622. [Google Scholar] [CrossRef] [Scilit]
  13. Prasher, P.; Sharma, M.; Singh, S.K.; Gulati, M.; Chellappan, D.K.; Zacconi, F.; De Rubis, G.; Gupta, G.; Sharifi-Rad, J.; Cho, W.C.; et al. Luteolin: A flavonoid with a multifaceted anticancer potential. Cancer Cell Int. 2022, 22, 386. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Li, Z.; Zhou, Y.; Zhang, N.; Tang, N.; Liu, B. Evaluation of the anti-inflammatory activity of luteolin in experimental animal models. Planta Med. 2007, 73, 221–226. [Google Scholar] [CrossRef] [Scilit]
  15. Azab, A.; Nassar, A.; Azab, A.N. Anti-Inflammatory Activity of Natural Products. Molecules 2016, 21, 1321. [Google Scholar] [CrossRef] [Scilit]
  16. Gao, S.; Gao, Y.; Cai, L.; Qin, R. Luteolin attenuates Staphylococcus aureus-induced endometritis through inhibiting ferroptosis and inflammation via activating the Nrf2/GPX4 signaling pathway. Microbiol. Spectr. 2024, 12, e0327923. [Google Scholar] [CrossRef] [Scilit]
  17. Huang, W.C.; Liou, C.J.; Shen, S.C.; Hu, S.; Hsiao, C.Y.; Wu, S.J. Luteolin Attenuates IL-1β-Induced THP-1 Adhesion to ARPE-19 Cells via Suppression of NF-κB and MAPK Pathways. Mediators Inflamm. 2020, 2020, 9421340. [Google Scholar] [CrossRef] [Scilit]
  18. Li, X.; He, X.; Chen, S.; Le, Y.; Bryant, M.S.; Guo, L.; Witt, K.L.; Mei, N. The genotoxicity potential of luteolin is enhanced by CYP1A1 and CYP1A2 in human lymphoblastoid TK6 cells. Toxicol. Lett. 2021, 344, 58–68. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Liu, C.W.; Lin, H.W.; Yang, D.J.; Chen, S.Y.; Tseng, J.K.; Chang, T.J.; Chang, Y.Y. Luteolin inhibits viral-induced inflammatory response in RAW264.7 cells via suppression of STAT1/3 dependent NF-κB and activation of HO-1. Free Radical. Biol. Med. 2016, 95, 180–189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Luoreng, Z.M.; Yang, J.; Wang, X.P.; Wei, D.W.; Zan, L.S. Expression Profiling of microRNA From Peripheral Blood of Dairy Cows in Response to Staphylococcus aureus-Infected Mastitis. Front. Vet. Sci. 2021, 8, 691196. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. Conti, P.; Caraffa, A.; Gallenga, C.E.; Ross, R.; Kritas, S.K.; Frydas, I.; Younes, A.; Di Emidio, P.; Ronconi, G.; Pandolfi, F. Powerful anti-inflammatory action of luteolin: Potential increase with IL-38. BioFactors 2021, 47, 165–169. [Google Scholar] [CrossRef] [Scilit]
  22. Ak, S.; Gürses, S.A.; Eser, B.E. [Effect of cigarette smoke extract on phagocytosis of Staphylococcus aureus by macrophages]. Mikrobiyol. Bul. 2016, 50, 205–214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Shaukat, A.; Shaukat, I.; Rajput, S.A.; Shukat, R.; Hanif, S.; Shaukat, I.; Zhang, X.; Chen, C.; Sun, X.; Ye, T.; et al. Ginsenoside Rb1 Mitigates Escherichia coli Lipopolysaccharide-Induced Endometritis through TLR4-Mediated NF-κB Pathway. Molecules 2021, 26, 7089. [Google Scholar] [CrossRef] [Scilit]
  24. Islam, M.A.; Takagi, M.; Fukuyama, K.; Komatsu, R.; Albarracin, L.; Nochi, T.; Suda, Y.; Ikeda-Ohtsubo, W.; Rutten, V.; Eden, W.V.; et al. Transcriptome Analysis of The Inflammatory Responses of Bovine Mammary Epithelial Cells: Exploring Immunomodulatory Target Genes for Bovine Mastitis. Pathogens 2020, 9, 200. [Google Scholar] [CrossRef] [Scilit]
  25. Barrett, T.; Wilhite, S.E.; Ledoux, P.; Evangelista, C.; Kim, I.F.; Tomashevsky, M.; Marshall, K.A.; Phillippy, K.H.; Sherman, P.M.; Holko, M.; et al. NCBI GEO: Archive for functional genomics data sets--update. Nucleic Acids Res. 2013, 41, D991–D995. [Google Scholar] [CrossRef] [Scilit]
  26. Gong, Z.; Zhang, J.; Zhang, S.; Cao, J.; Fu, Y.; Hu, X.; Zhao, J.; Gu, B.; Li, Q.; Zhang, K.; et al. TLR2, TLR4, and NLRP3 mediated the balance between host immune-driven resistance and tolerance in Staphylococcus aureus-infected mice. Microb. Pathog. 2022, 169, 105671. [Google Scholar] [CrossRef] [Scilit]
  27. Chen, Y.; Jing, H.; Chen, M.; Liang, W.; Yang, J.; Deng, G.; Guo, M. Transcriptional Profiling of Exosomes Derived from Staphylococcus aureus-Infected Bovine Mammary Epithelial Cell Line MAC-T by RNA-Seq Analysis. Oxid. Med. Cell. Longev. 2021, 2021, 8460355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Lai, J.L.; Liu, Y.H.; Liu, C.; Qi, M.P.; Liu, R.N.; Zhu, X.F.; Zhou, Q.G.; Chen, Y.Y.; Guo, A.Z.; Hu, C.M. Indirubin Inhibits LPS-Induced Inflammation via TLR4 Abrogation Mediated by the NF-kB and MAPK Signaling Pathways. Inflammation 2017, 40, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Sharma, N.; Maiti, S.K.; Sharma, K.K. Prevalence, Etiology and Antibiogram of Microorganisms Associated with Sub-clinical Mastitis in Buffaloes in Durg. CSIDC 2007, 2, 145–151. [Google Scholar] [CrossRef] [Scilit]
  30. Pratheeshkumar, P.; Son, Y.O.; Divya, S.P.; Roy, R.V.; Hitron, J.A.; Wang, L.; Kim, D.; Dai, J.; Asha, P.; Zhang, Z.; et al. Luteolin inhibits Cr(VI)-induced malignant cell transformation of human lung epithelial cells by targeting ROS mediated multiple cell signaling pathways. Toxicol. Appl. Pharmacol. 2014, 281, 230–241. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Wang, X.; Yan, C.; Wang, T.; Li, Y.; Zheng, Z. Mechanisms of Luteolin Against Gastro-Esophageal Reflux Disease Based on Network Pharmacology, Molecular Docking, and Molecular Dynamics Simulation. Cell Biochem. Biophys. 2024, 8, 24. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Tang, L.; Gao, J.; Li, X.; Cao, X.; Zhou, B. Molecular Mechanisms of Luteolin Against Atopic Dermatitis Based on Network Pharmacology and in vivo Experimental Validation. Drug Des. Devel. Ther. 2022, 16, 4205–4221. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Agrawal, T.; Bhengraj, A.R.; Vats, V.; Salhan, S.; Mittal, A. Expression of TLR 2, TLR 4 and iNOS in cervical monocytes of Chlamydia trachomatis-infected women and their role in host immune response. Am. J. Reprod. Immunol. Microbiol. 2011, 66, 534–543. [Google Scholar] [CrossRef] [Scilit]
  34. Shaukat, A.; Guo, Y.F.; Jiang, K.; Zhao, G.; Wu, H.; Zhang, T.; Yang, Y.; Guo, S.; Yang, C.; Zahoor, A.; et al. Ginsenoside Rb1 ameliorates Staphylococcus aureus-induced Acute Lung Injury through attenuating NF-κB and MAPK activation. Microb. Pathog. 2019, 132, 302–312. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Zahoor, A.; Yang, Y.; Yang, C.; Akhtar, M.; Guo, Y.; Shaukat, A.; Guo, M.Y.; Deng, G. Gas6 negatively regulates the Staphylococcus aureus-induced inflammatory response via TLR signaling in the mouse mammary gland. J. Cell. Physiol. 2020, 235, 7081–7093. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. He, S.; Wang, X.; Liu, Z.; Zhang, W.; Fang, J.; Xue, J.; Bao, H. Hydroxysafflor Yellow A Inhibits Staphylococcus aureus-Induced Mouse Endometrial Inflammation via TLR2-Mediated NF-kB and MAPK Pathway. Inflammation 2021, 44, 835–845. [Google Scholar] [CrossRef] [Scilit]
  37. Muñoz-Wolf, N.; Lavelle, E.C. A Guide to IL-1 family cytokines in adjuvanticity. FEBS J. 2018, 285, 2377–2401. [Google Scholar] [CrossRef] [Scilit]
  38. Bochniarz, M.; Zdzisińska, B.; Wawron, W.; Szczubiał, M.; Dąbrowski, R. Milk and serum IL-4, IL-6, IL-10, and amyloid A concentrations in cows with subclinical mastitis caused by coagulase-negative staphylococci. J. Dairy Sci. 2017, 100, 9674–9680. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Pang, Y.; Wu, L.; Tang, C.; Wang, H.; Wei, Y. Autophagy-Inflammation Interplay During Infection: Balancing Pathogen Clearance and Host Inflammation. Front. Pharmacol. 2022, 13, 832750. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Mcloughlin, R.M.; Lee, J.C.; Kasper, D.L.; Tzianabos, A.O. IFN-gamma regulated chemokine production determines the outcome of Staphylococcus aureus infection. J. Immunol. 2008, 181, 1323–1332. [Google Scholar] [CrossRef] [Scilit]
  41. Ge, B.J.; Zhao, P.; Li, H.T.; Sang, R.; Wang, M.; Zhou, H.Y.; Zhang, X.M. Taraxacum mongolicum protects against Staphylococcus aureus-infected mastitis by exerting anti-inflammatory role via TLR2-NF-κB/MAPKs pathways in mice. J. Ethnopharmacol. 2021, 268, 113595. [Google Scholar] [CrossRef] [Scilit]
  42. Yokosawa, T.; Miyagawa, S.; Suzuki, W.; Nada, Y.; Hirata, Y.; Noguchi, T.; Matsuzawa, A. The E3 Ubiquitin Protein Ligase LINCR Amplifies the TLR-Mediated Signals through Direct Degradation of MKP1. Cells 2024, 13, 687. [Google Scholar] [CrossRef] [Scilit]
  43. Guo, S.; Jiang, K.; Wu, H.; Yang, C.; Yang, Y.; Yang, J.; Zhao, G.; Deng, G. Magnoflorine Ameliorates Lipopolysaccharide-Induced Acute Lung Injury via Suppressing NF-κB and MAPK Activation. Front. Pharmacol. 2018, 9, 982. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Alva-Murillo, N.; Ochoa-Zarzosa, A.; López-Meza, J.E. Sodium Octanoate Modulates the Innate Immune Response of Bovine Mammary Epithelial Cells through the TLR2/P38/JNK/ERK1/2 Pathway: Implications during Staphylococcus aureus Internalization. Front. Cell. Infect. Microbiol. 2017, 7, 78. [Google Scholar] [CrossRef] [Scilit]
  45. Daneshi, M.; Caton, J.S.; Caixeta, L.S.; Eftekhari, Z.; Ward, A.K. Expression, Regulation, and Function of β-Defensins in the Bovine Mammary Glands: Current Knowledge and Future Perspectives. Animals 2023, 13, 3372. [Google Scholar] [CrossRef] [Scilit]
Figure 1. DEG analysis of the GEO database (GSE139612) for S. aureus-induced mastitis. (a) GO enrichment analysis; (b) KEGG enrichment analyses of DEGs.
Figure 1. DEG analysis of the GEO database (GSE139612) for S. aureus-induced mastitis. (a) GO enrichment analysis; (b) KEGG enrichment analyses of DEGs.
Vetsci 12 00096 g001
Figure 2. Analysis of Lut using network pharmacology. (a) The chemical structure of the Lut molecule; (b) the target classes of Lut; (c) the potential targets of Lut were identified using SwissTarget Prediction; (df) GO analysis of targets, encompassing molecular activities, biological processes, and cellular components; (g) KEGG analysis of targets.
Figure 2. Analysis of Lut using network pharmacology. (a) The chemical structure of the Lut molecule; (b) the target classes of Lut; (c) the potential targets of Lut were identified using SwissTarget Prediction; (df) GO analysis of targets, encompassing molecular activities, biological processes, and cellular components; (g) KEGG analysis of targets.
Vetsci 12 00096 g002
Figure 3. MAC-T cell activity was unaffected by purified Lut. (a) The chemical structure of Lut; (b) purity of Lut determined through HPLC; (c) the effect of Lut on MAC-T cell viability was assessed through CCK-8.
Figure 3. MAC-T cell activity was unaffected by purified Lut. (a) The chemical structure of Lut; (b) purity of Lut determined through HPLC; (c) the effect of Lut on MAC-T cell viability was assessed through CCK-8.
Vetsci 12 00096 g003
Figure 4. The MAC-T cells infected with S. aureus were prevented from releasing cytokines by Lut. (ac) Using GAPDH as the internal reference gene, RT-qPCR was utilized to assess the mRNA of IL-1β, IL-6, and TNF-α; (df) levels of IL-1β, IL-6, and TNF-α were measured through ELISA; the control group, the S. aureus stimulation group, and the combination group of S. aureus and dexamethasone were designated as C.G., S.A.G., and DEX, respectively. The findings were expressed using the means ± SEM of three separate studies. The markers of statistical significance were as follows: # p < 0.01, * p < 0.05, and ** p < 0.01 when compared to the control group, the S. aureus group, and the S. aureus group, respectively.
Figure 4. The MAC-T cells infected with S. aureus were prevented from releasing cytokines by Lut. (ac) Using GAPDH as the internal reference gene, RT-qPCR was utilized to assess the mRNA of IL-1β, IL-6, and TNF-α; (df) levels of IL-1β, IL-6, and TNF-α were measured through ELISA; the control group, the S. aureus stimulation group, and the combination group of S. aureus and dexamethasone were designated as C.G., S.A.G., and DEX, respectively. The findings were expressed using the means ± SEM of three separate studies. The markers of statistical significance were as follows: # p < 0.01, * p < 0.05, and ** p < 0.01 when compared to the control group, the S. aureus group, and the S. aureus group, respectively.
Vetsci 12 00096 g004
Figure 5. Western blotting was used to measure the levels of protein expression. (a) β-actin served as a control, and the grayscale value of TLR2 protein expression was computed using ImageJ (1.46r) software. (be) RT-qPCR was utilized to ascertain the mRNA expression of MyD88, IRAK4, IRAK1, and TRAF6 utilizing GAPDH as an internal reference gene. The control group, the S. aureus stimulation group, and the combination group of S. aureus and dexamethasone were designated as C.G., S.A.G., and DEX, respectively. The findings were expressed using the means ± SEM of three separate studies. The markers of statistical significance were as follows: # p < 0.01, and ** p < 0.01 when compared to the control group, the S. aureus group, and the S. aureus group, respectively.
Figure 5. Western blotting was used to measure the levels of protein expression. (a) β-actin served as a control, and the grayscale value of TLR2 protein expression was computed using ImageJ (1.46r) software. (be) RT-qPCR was utilized to ascertain the mRNA expression of MyD88, IRAK4, IRAK1, and TRAF6 utilizing GAPDH as an internal reference gene. The control group, the S. aureus stimulation group, and the combination group of S. aureus and dexamethasone were designated as C.G., S.A.G., and DEX, respectively. The findings were expressed using the means ± SEM of three separate studies. The markers of statistical significance were as follows: # p < 0.01, and ** p < 0.01 when compared to the control group, the S. aureus group, and the S. aureus group, respectively.
Vetsci 12 00096 g005
Figure 6. Lut inhibits proteins in the NF-κB signaling pathway from becoming phosphorylated. (a) The transit of the NF-κB p65 subunit from the cytoplasm to the nucleus was assessed using immuno-fluorescence microscopy. Blue fluorescence suggests nuclear staining, while red fluorescence indicates p-p65 staining. The proportion of cells that were p-p65 positive was computed using ImageJ software. (b) Protein expression levels of proteins implicated in the NF-κB pathway were measured through Western blotting analysis and densitometric measurements using ImageJ software, with β-actin serving as the loading control. The control group, the S. aureus stimulation group, and the combination group of S. aureus and dexamethasone were designated as C.G., S.A.G., and DEX, respectively. The findings were expressed using the means ± SEM of three separate studies. The markers of statistical significance were as follows: # p < 0.01, * p < 0.05, and ** p < 0.01 when compared to the control group, the S. aureus group, and the S. aureus group, respectively.
Figure 6. Lut inhibits proteins in the NF-κB signaling pathway from becoming phosphorylated. (a) The transit of the NF-κB p65 subunit from the cytoplasm to the nucleus was assessed using immuno-fluorescence microscopy. Blue fluorescence suggests nuclear staining, while red fluorescence indicates p-p65 staining. The proportion of cells that were p-p65 positive was computed using ImageJ software. (b) Protein expression levels of proteins implicated in the NF-κB pathway were measured through Western blotting analysis and densitometric measurements using ImageJ software, with β-actin serving as the loading control. The control group, the S. aureus stimulation group, and the combination group of S. aureus and dexamethasone were designated as C.G., S.A.G., and DEX, respectively. The findings were expressed using the means ± SEM of three separate studies. The markers of statistical significance were as follows: # p < 0.01, * p < 0.05, and ** p < 0.01 when compared to the control group, the S. aureus group, and the S. aureus group, respectively.
Vetsci 12 00096 g006
Figure 7. Lut prevented the phosphorylation of the MAPK pathway. Western blotting was used to measure the level of protein phosphorylation in the MAPK signaling pathway, and the protein bands’ grayscale values were examined to determine the levels of protein expression. The control group, the S. aureus stimulation group, and the combination group of S. aureus and dexamethasone were designated as C.G., S.A.G., and DEX, respectively. The findings were expressed using the means ± SEM of three separate studies. The markers of statistical significance were as follows: # p < 0.01, * p < 0.05, and ** p < 0.01 when compared to the control group, the S. aureus group, and the S. aureus group, respectively.
Figure 7. Lut prevented the phosphorylation of the MAPK pathway. Western blotting was used to measure the level of protein phosphorylation in the MAPK signaling pathway, and the protein bands’ grayscale values were examined to determine the levels of protein expression. The control group, the S. aureus stimulation group, and the combination group of S. aureus and dexamethasone were designated as C.G., S.A.G., and DEX, respectively. The findings were expressed using the means ± SEM of three separate studies. The markers of statistical significance were as follows: # p < 0.01, * p < 0.05, and ** p < 0.01 when compared to the control group, the S. aureus group, and the S. aureus group, respectively.
Vetsci 12 00096 g007
Table 1. Primers used for RT-qPCR.
Table 1. Primers used for RT-qPCR.
SpeciesGene NamePrimer Sequence (5′-3′)GenBank Accession Number
Bos taurusIL-1βSense: GGCAACCGTACCTGAACCCANM_174093.1
Antisense: CCACGATGACCGACACCACC
IL-6Sense: ATGCTTCCAATCTGGGTTCANM_173923.2
Antisense: GAGGATAATCTTTGCGTTCTTT
TNF-αSense: ACGGGCTTTACCTCATCTACTCANM_173966.3
Antisense: GGCTCTTGATGGCAGACAGG
MyD88Sense: AGCAGCATAACTCGGATAANM_001014382.2
Antisense: CAGACACGCACAACTTCA
IRAK4Sense: TGGCAAAGACAGGACATCTGNM_001075998.1
Antisense: CACAACTCCCAAACCCTCCTT
IRAK1Sense: GAGTTCCAACGTCCTTCTGGNM_001040555.1
Antisense: CTCCCGGTCTTCACGTACTG
TRAF6Sense: CGGTGACTCTCTCCAGGTGTNM_001034661.2
Antisense: TGGACATTTGTGACCTGCAT
GAPDHSense: TGCTGGTGCTGAGTATGTGGTGNM_001034034.2
Antisense: CAGTCTTCTGGGTGGCAGTGAT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Guo, Y.; Zhang, J.; Yuan, T.; Yang, C.; Zhou, Q.; Shaukat, A.; Deng, G.; Wang, X. Luteolin Alleviates Inflammation Induced by Staphylococcus aureus in Bovine Mammary Epithelial Cells by Attenuating NF-κB and MAPK Activation. Vet. Sci. 2025, 12, 96. https://doi.org/10.3390/vetsci12020096

AMA Style

Guo Y, Zhang J, Yuan T, Yang C, Zhou Q, Shaukat A, Deng G, Wang X. Luteolin Alleviates Inflammation Induced by Staphylococcus aureus in Bovine Mammary Epithelial Cells by Attenuating NF-κB and MAPK Activation. Veterinary Sciences. 2025; 12(2):96. https://doi.org/10.3390/vetsci12020096

Chicago/Turabian Style

Guo, Yingfang, Jinxin Zhang, Ting Yuan, Cheng Yang, Qingqing Zhou, Aftab Shaukat, Ganzhen Deng, and Xiaoyan Wang. 2025. "Luteolin Alleviates Inflammation Induced by Staphylococcus aureus in Bovine Mammary Epithelial Cells by Attenuating NF-κB and MAPK Activation" Veterinary Sciences 12, no. 2: 96. https://doi.org/10.3390/vetsci12020096

APA Style

Guo, Y., Zhang, J., Yuan, T., Yang, C., Zhou, Q., Shaukat, A., Deng, G., & Wang, X. (2025). Luteolin Alleviates Inflammation Induced by Staphylococcus aureus in Bovine Mammary Epithelial Cells by Attenuating NF-κB and MAPK Activation. Veterinary Sciences, 12(2), 96. https://doi.org/10.3390/vetsci12020096

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop