Comparative Analysis of NanoLuc Luciferase and Alkaline Phosphatase Luminescence Reporter Systems for Phage-Based Detection of Bacteria
Abstract
1. Introduction
2. Materials and Methods
2.1. ALP* and NLuc Constructs
2.2. Expression and Purification of ALP* and Nluc
2.3. Enzyme Activity of Purified ALP* and NLuc
2.4. Construction of Reporter Phages ALP* and Nluc
2.5. Quantitation of Reporter Protein through the Phage Assay
2.6. Limit of Detection of Reporter Phage for E. coli
3. Results
3.1. Expression and Purification of ALP* and NLuc
3.2. Enzyme Activity of Purified ALP* and NLuc
3.3. Construction of Reporter Phages ALP* and NLuc
3.4. Quantitation of Reporter Protein through the Phage Assay
3.5. Limit of Detection of Reporter Phage for E. coli
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Appendix A

References
- Clokie, M.R.J.; Millard, A.D.; Letarov, A.V.; Heaphy, S. Phages in nature. Bacteriophage 2011, 1, 31–45. [Google Scholar] [CrossRef] [PubMed]
- Paczesny, J.; Richter, Ł.; Hołyst, R. Recent progress in the detection of bacteria using bacteriophages: A review. Viruses 2020, 12, 845. [Google Scholar] [CrossRef] [PubMed]
- Meile, S.; Sarbach, A.; Du, J.; Schuppler, M.; Saez, C.; Loessner, M.J.; Kilcher, S. Engineered reporter phages for rapid bioluminescence-based detection and differentiation of viable Listeria cells. Appl. Environ. Microbiol. 2020, 86, e00442-20. [Google Scholar] [CrossRef] [PubMed]
- Singh, S.; Hinkley, T.; Nugen, S.R.; Talbert, J.N. Colorimetric detection of Escherichia coli using engineered bacteriophage and an affinity reporter system. Anal. Bioanal. Chem. 2019, 411, 7273–7279. [Google Scholar] [CrossRef]
- Burnham, S.; Hu, J.; Anany, H.; Brovko, L.; Deiss, F.; Derda, R.; Griffiths, M.W. Towards rapid on-site phage-mediated detection of generic Escherichia coli in water using luminescent and visual readout. Anal. Bioanal. Chem. 2014, 406, 5685–5693. [Google Scholar] [CrossRef]
- Petrenko, V.A. Landscape phage: Evolution from phage display to nanobiotechnology. Viruses 2018, 10, 311. [Google Scholar] [CrossRef]
- Jackson, A.A.; Hinkley, T.C.; Talbert, J.N.; Nugen, S.R.; Sela, D.A. Genetic optimization of a bacteriophage-delivered alkaline phosphatase reporter to detect: Escherichia coli. Analyst 2016, 141, 5543–5548. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Hinkley, T.; Chen, J.; Talbert, J.N.; Nugen, S.R. Phage based electrochemical detection of: Escherichia coli in drinking water using affinity reporter probes. Analyst 2019, 144, 1345–1352. [Google Scholar] [CrossRef]
- Alcaine, S.D.; Law, K.; Ho, S.; Kinchla, A.J.; Sela, D.A.; Nugen, S.R. Bioengineering bacteriophages to enhance the sensitivity of phage amplification-based paper fluidic detection of bacteria. Biosens. Bioelectron. 2016, 82, 14–19. [Google Scholar] [CrossRef]
- Hinkley, T.C.; Singh, S.; Garing, S.; Le Ny, A.L.M.; Nichols, K.P.; Peters, J.E.; Talbert, J.N.; Nugen, S.R. A phage-based assay for the rapid, quantitative, and single CFU visualization of E. coli (ECOR #13) in drinking water. Sci. Rep. 2018, 8, 14630. [Google Scholar]
- Hoang, H.A.; Dien, L.T. Rapid and simple colorimetric detection of escherichia coli O157:H7 in apple juice using a novel recombinant bacteriophage-based method. Biocontrol Sci. 2015, 20, 99–103. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Laube, T.; Cortés, P.; Llagostera, M.; Alegret, S.; Pividori, M.I. Phagomagnetic immunoassay for the rapid detection of Salmonella. Appl. Microbiol. Biotechnol. 2014, 98, 1795–1805. [Google Scholar] [CrossRef] [PubMed]
- Vinay, M.; Franche, N.; Grégori, G.; Fantino, J.R.; Pouillot, F.; Ansaldi, M. Phage-Based Fluorescent Biosensor Prototypes to Specifically Detect Enteric Bacteria Such as E. coli and Salmonella enterica Typhimurium. PLoS ONE 2015, 10, e0131466. [Google Scholar] [CrossRef] [PubMed]
- Wisuthiphaet, N.; Yang, X.; Young, G.M.; Nitin, N. Rapid detection of Escherichia coli in beverages using genetically engineered bacteriophage T7. AMB Express 2019, 9, 55. [Google Scholar] [CrossRef]
- Lemon, D.J.; Kay, M.K.; Titus, J.K.; Ford, A.A.; Chen, W.; Hamlin, N.J.; Hwang, Y.Y. Construction of a genetically modified T7Select phage system to express the antimicrobial peptide 1018. J. Microbiol. 2019, 57, 532–538. [Google Scholar] [CrossRef]
- Alcaine, S.D.; Tilton, L.; Serrano, M.A.C.; Wang, M.; Vachet, R.W.; Nugen, S.R. Phage-protease-peptide: A novel trifecta enabling multiplex detection of viable bacterial pathogens. App. Microbiol. Biotechnol. 2015, 99, 8177–8185. [Google Scholar] [CrossRef]
- Kretzer, J.W.; Schmelcher, M.; Loessner, M.J. Ultrasensitive and fast diagnostics of viable Listeria cells by CBD magnetic separation combined with A511::luxAB detection. Viruses 2018, 10, 626. [Google Scholar] [CrossRef]
- Kim, J.; Kim, M.; Kim, S.; Ryu, S. Sensitive detection of viable Escherichia coli O157:H7 from foods using a luciferase-reporter phage phiV10lux. Int. J. Food Microbiol. 2017, 254, 11–17. [Google Scholar] [CrossRef]
- Pulkkinen, E.M.; Hinkley, T.C.; Nugen, S.R. Utilizing in vitro DNA assembly to engineer a synthetic T7 Nanoluc reporter phage for Escherichia coli detection. Integr. Biol. 2019, 11, 63–68. [Google Scholar] [CrossRef]
- Whitehead, T.P.; Kricka, L.J.; Carter, T.J.N.; Thorpe, G.H.G. Analytical luminescence: Its potential in the clinical laboratory. Clin. Chem. 1979, 25, 1531–1546. [Google Scholar] [CrossRef]
- Coleman, J.E. Structure and mechanism of alkaline phosphatase. Annu. Rev. Biophy. Biomol. Struct. 1992, 21, 441–483. [Google Scholar] [CrossRef] [PubMed]
- Agrawal, D.K.; Wanner, B.L. A phoA structural gene mutation that conditionally affects formation of the enzyme bacterial alkaline phosphatase. J. Bacteriol. 1990, 172, 3180–3190. [Google Scholar] [CrossRef] [PubMed]
- Hoffman, C.S.; Wright, A. Fusions of secreted proteins to alkaline phosphatase: An approach for studying protein secretion. Proc. Natl. Acad. Sci. USA 1985, 82, 5107–5111. [Google Scholar] [CrossRef] [PubMed]
- Inouye, H.; Barnes, W.; Beckwith, J. Signal sequence of alkaline phosphatase of Escherichia coli. J. Bacteriol. 1982, 149, 434–439. [Google Scholar] [CrossRef]
- Chen, J.; Zhou, Y.; Wang, D.; He, F.; Rotello, V.M.; Carter, K.R.; Watkins, J.J.; Nugen, S.R. UV-nanoimprint lithography as a tool to develop flexible microfluidic devices for electrochemical detection. Lab Chip 2015, 15, 3086–3094. [Google Scholar] [CrossRef]
- Muller, B.H.; Lamoure, C.; Le Du, M.H.; Cattolico, L.; Lajeunesse, E.; Lemaître, F.; Pearson, A.; Ducancel, F.; Ménez, A.; Boulain, J.C. Improving Escherichia coli alkaline phosphatase efficacy by additional mutations inside and outside the catalytic pocket. ChemBioChem 2001, 2, 517–523. [Google Scholar] [CrossRef]
- Singh, S.; Hinkley, T.; Nugen, S.R.; Talbert, J.N. Fusion of carbohydrate binding module to mutant alkaline phosphatase for immobilization on cellulose. Biocatal. Agric. Biotechnol. 2018, 13, 265–271. [Google Scholar] [CrossRef]
- Hall, M.P.; Unch, J.; Binkowski, B.F.; Valley, M.P.; Butler, B.L.; Wood, M.G.; Otto, P.; Zimmerman, K.; Vidugiris, G.; MacHleidt, T.; et al. Engineered luciferase reporter from a deep sea shrimp utilizing a novel imidazopyrazinone substrate. ACS Chem. Biol. 2012, 7, 1848–1857. [Google Scholar] [CrossRef]
- Oyama, H.; Kiguchi, Y.; Morita, I.; Miyashita, T.; Ichimura, A.; Miyaoka, H.; Izumi, A.; Terasawa, S.; Osumi, N.; Tanaka, H.; et al. NanoLuc luciferase as a suitable fusion partner of recombinant antibody fragments for developing sensitive luminescent immunoassays. Anal. Chim. Acta 2021, 1161, 238180. [Google Scholar] [CrossRef]
- Berlec, A.; Janež, N.; Sterniša, M.; Klančnik, A.; Sabotič, J. Expression of NanoLuc Luciferase in Listeria innocua for Development of Biofilm Assay. Front. Microbiol. 2021, 12, 636421. [Google Scholar] [CrossRef]
- Duong, M.M.; Carmody, C.M.; Nugen, S.R. Phage-based biosensors:: In vivo analysis of native T4 phage promoters to enhance reporter enzyme expression. Analyst 2020, 145, 6291–6297. [Google Scholar] [CrossRef] [PubMed]
- T7Select® 415-1 Cloning Kit|70015. Revised 2021. Available online: https://www.emdmillipore.com/US/en/product/T7Select-415-1-Cloning-Kit,EMD_BIO-70015#anchor_VMAP (accessed on 1 January 2022).
- He, J.; Sakaguchi, K.; Suzuki, T. Determination of the ribosome-binding sequence and spacer length between binding site and initiation codon for efficient protein expression in Bifidobacterium longum 105-A. J. Biosci. Bioeng. 2012, 113, 442–444. [Google Scholar] [CrossRef] [PubMed]
- Shine, J.; Dalgarno, L. Determinant of cistron specificity in bacterial ribosomes. Nature 1975, 254, 34–38. [Google Scholar] [CrossRef] [PubMed]
- Harron, D.W.G. The Textbook of Pharmaceutical Medicine, 7th ed.; BMJ Books: London, UK, 2013. [Google Scholar]
- Boulanger, R.; Kantrowitz, E. Characterization of a monomeric Escherichia coli alkaline phosphatase formed upon a single amino acid substitution. J. Biol. Chem. 2003, 278, 23497–23501. [Google Scholar] [CrossRef]
- Mie, M.; Niimi, T.; Mashimo, Y.; Kobatake, E. Construction of DNA-NanoLuc luciferase conjugates for DNA aptamer-based sandwich assay using Rep protein. Biotechnol. Lett. 2019, 41, 357–362. [Google Scholar] [CrossRef]
- Derman, A.I.; Beckwith, J. Escherichia coli alkaline phosphatase localized to the cytoplasm slowly acquires enzymatic activity in cells whose growth has been suspended: A caution for gene fusion studies. J. Bacteriol. 1995, 177, 3764. [Google Scholar] [CrossRef]
- Singh, P.; Sharma, L.; Kulothungan, S.R.; Adkar, B.V.; Prajapati, R.S.; Ali, P.S.S.; Krishnan, B.; Varadarajan, R. Effect of Signal Peptide on Stability and Folding of Escherichia coli Thioredoxin. PLoS ONE 2013, 8, 63442. [Google Scholar] [CrossRef]
- Mihali, A.; Rouh-Rong, J.; D’Eon, B.; Chiulli, A.; Agnew, B.; Gee, K.; Gee, M. Novel DynaLight™ Substrate with RapidGlow™ Enhancer: 1,2-Dioxetane Formulation for Application in Clinical Research Platforms; Public Communication; Life Technologies Corporation: Bedford, MA, USA, 2012. [Google Scholar]
- Calabretta, M.M.; Montali, L.; Lopreside, A.; Fragapane, F.; Iacoangeli, F.; Roda, A.; Bocci, V.; D’Elia, M.; Michelini, E. Ultrasensitive On-Field Luminescence Detection Using a Low-Cost Silicon Photomultiplier Device. Anal. Chem. 2021, 93, 7388–7393. [Google Scholar] [CrossRef]
- Warringer, J.; Blomberg, A. Evolutionary constraints on yeast protein size. BMC Evol. Biol. 2006, 6, 61. [Google Scholar]
- Hinkley, T.; Garing, S.; Singh, S.; Le Ny, A.; Nichols, K.; Peters, J.; Talbert, J.; Nugen, S. Reporter bacteriophage T7NLC utilizes a novel NanoLuc::CBM fusion for the ultrasensitive detection of Escherichia coli in water. Analyst 2018, 143, 4074. [Google Scholar] [CrossRef]
- Alonzo, F.; Hinkley, T.; Miller, A.; Calderon, R.; Garing, S.; Williford, J.; Clute-Reinig, N.; Spencer, E.; Friend, M.; Madan, D.; et al. A microfluidic device and instrument prototypes for the detection of Escherichia coli in water samples using a phage-based bioluminescence assay. Lab Chip 2022, 22, 2155. [Google Scholar] [CrossRef] [PubMed]
- Hinkley, T.; Garing, S.; Jain, P.; Williford, J.; Le Ny, A.-L.; Nichols, K.; Peters, J.; Talbert, J.; Nugen, S. A Syringe-Based Biosensor to Rapidly Detect Low Levels of Escherichia Coli (ECOR13) in Drinking Water Using Engineered Bacteriophages. Sensors 2020, 20, 1953. [Google Scholar] [CrossRef]
- Zurier, H.; Duong, M.; Goddard, J.; Nugen, S. Engineering Biorthogonal Phage-Based Nanobots for Ultrasensitive, in Situ Bacteria Detection. ACS Appl. Bio. Mater. 2020, 3, 5824. [Google Scholar] [CrossRef] [PubMed]
- Dow, P.; Kotz, K.; Gruszka, S.; Holder, J.; Fiering, J. Acousitic Seperation in Plastic Microfluidics for Rapid Detection of Bacteria in Blood Using Engineered Bacteriophage. Lab Chip 2018, 18, 923. [Google Scholar] [CrossRef] [PubMed]





| NLuc | Restriction Site | RBS | STOP | START | Primer |
|---|---|---|---|---|---|
| Forward Primer | EcoRI GAATTC | AGGAGG | TGATGA | ATG | 5′CGGGAATTCATGATGAGCGAGGAGGGCGATGATGGTCTTCACACTC 3′ |
| Reverse Primer | HindIII AAGCTT | TGA | 5′CGGAAGCTTCTAGTGGTGGTGGTGGTGGTGCGCCAG 3′ | ||
| ALP* | Restriction Site | RBS | STOP | START | Primer |
| Forward Primer | EcoRI GAATTC | AGGAGG | TGATGA | ATG | 5′CGGCGGAATTCATGATGAGCGAGGAGGCGCATGCGTACACCGGAAATGCCG 3′ |
| Reverse Primer | HindIII AAGCTT | TGA | 5′CGGAAGCTTTCAGTGGTGGTGGTGGTGGTGCTCGAGTTTCAG 3′ |
| Ref. | Type of Phage | E. coli Strain | Reporter Modification | Phage Available for Infection | Pre/Enrich-ment of E. coli | Incubation Time-Volume | Reporter Concentration | Reaction Volume | Detection Matrix | Detection Method | Definition of the Detection Limit- Total Assay Time |
|---|---|---|---|---|---|---|---|---|---|---|---|
| [4] | T7_ALP* | BL21 derivative | CBM(Cex) | 1:10 CFU:PFU | 4 h | 2 h- 100 mL | Magnetic cellulose particles | 60 µL | LB | Abs | 3LOQ: <10 CFU/100 mL-8 h |
| [7] | T7_ALP* | BL21 | His-tag | 107 PFU/mL | - | 16 h- | - | 50 µL | LB | Abs | 7LOD: ∼1 × 105 CFU/mL |
| [10] | T7_NLuc | BL21 | CBM2a/pelB | 2 × 109 PFU | 8–12 h | 1.5 h- 2 mL | Cellulose filter | ~300 µL | Drinking water | Abs/LU | Matched EPA results |
| [19] | T7_NLuc | BL21 | CBM/pelB | 106 PFU | 1 h | 2 h- 1 mL | - | 200 µL | LB | LU | 6Detectable signal: 5 × 102 CFU/mL-2 h |
| [43] | T7_NLuc | BL21 | CBM/pelB | 109 PFU | 1 h (pre-) | 1.5 h-126 mL | Micro-crystalline cellulose | 100 µL | Drinking water | LU | 4LOD: <10 CFU/mL-3 h |
| [44] | T7_NLuc | BL21 | CBM | 1.25 × 108 PFU | - | 3 h- 0.25 mL | Nitro-cellulose membrane | 75 µL | Drinking water | LU | 1LOD: 4.1 CFU-5.5 h |
| [45] | T7_NLuc | ECOR13 | CBM | 107 PFU/mL | 3 h (pre-) | 1.5 h- | Cellulose filter | - | Drinking water | LU | 2LOD: <20 CFU-5 h |
| [46] | T4_NLuc | ECOR13 | CBM | 107-6 PFU | 3 h (pre-) | 3 h- 0.5 mL | Cellulose filter | 50 µL | Drinking water | LU | 5LOD: <10 CFU/100 mL-7 h |
| [47] | K1E_NLuc | K1 | - | 106 PFU | - | 1 h- 0.1 mL | - | - | LB | LU | 8LLOD: 8 CFU/well-1 h |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wijeratne, S.; Bakshi, A.; Talbert, J. Comparative Analysis of NanoLuc Luciferase and Alkaline Phosphatase Luminescence Reporter Systems for Phage-Based Detection of Bacteria. Bioengineering 2022, 9, 479. https://doi.org/10.3390/bioengineering9090479
Wijeratne S, Bakshi A, Talbert J. Comparative Analysis of NanoLuc Luciferase and Alkaline Phosphatase Luminescence Reporter Systems for Phage-Based Detection of Bacteria. Bioengineering. 2022; 9(9):479. https://doi.org/10.3390/bioengineering9090479
Chicago/Turabian StyleWijeratne, Shalini, Arindam Bakshi, and Joey Talbert. 2022. "Comparative Analysis of NanoLuc Luciferase and Alkaline Phosphatase Luminescence Reporter Systems for Phage-Based Detection of Bacteria" Bioengineering 9, no. 9: 479. https://doi.org/10.3390/bioengineering9090479
APA StyleWijeratne, S., Bakshi, A., & Talbert, J. (2022). Comparative Analysis of NanoLuc Luciferase and Alkaline Phosphatase Luminescence Reporter Systems for Phage-Based Detection of Bacteria. Bioengineering, 9(9), 479. https://doi.org/10.3390/bioengineering9090479

