Bioactive Carbon Dots from Clove Residue: Synthesis, Characterization, and Osteogenic Properties
Abstract
1. Introduction
2. Materials and Methods
2.1. Synthesis of Clove-CDs
2.2. Antioxidant Capacity
2.2.1. ABTS Radical-Scavenging Activity
2.2.2. DPPH Radical-Scavenging Activity
2.3. Cell Culture and Treatment
2.4. Quantitative Real-Time PCR
2.5. Western Blot Analysis
2.6. Histological and Immunohistochemical Analysis
2.7. Animal Test
2.8. Micro-Computed Tomography Measurements
2.9. Statistical Analysis
3. Results
3.1. Characterization of C-CDs
3.2. Cellular Uptake of C-CDs
3.3. Antioxidant Properties of C-CDs
3.4. Morphological Changes in Human Bone Marrow-Derived MSCs Following C-CDs Treatment
3.5. Immunohistochemical Analysis for Osteogenesis
3.6. mRNA Expression Analysis of Osteogenic Differentiation
3.7. Ectopic Bone Formation
3.8. Molecular Pathway Analysis of C-CDs-Induced Bone Formation
3.9. Quantitative Analysis of Bone Regeneration via Micro-CT
3.10. Histological Analysis of Regenerated Bone
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Patel, D.; Wairkar, S. Bone regeneration in osteoporosis: Opportunities and challenges. Drug Deliv. Transl. Res. 2023, 13, 419–432. [Google Scholar] [CrossRef]
- Dimitriou, R.; Jones, E.; McGonagle, D.; Giannoudis, P.V. Bone regeneration: Current concepts and future directions. BMC Med. 2011, 9, 66. [Google Scholar] [CrossRef] [PubMed]
- Soldatos, N.K.; Stylianou, P.; Koidou, V.P.; Angelov, N.; Yukna, R.; Romanos, G.E. Limitations and options using resorbable versus nonresorbable membranes for successful guided bone regeneration. Quintessence Int. 2017, 48, 131–147. [Google Scholar] [CrossRef]
- Agrawal, V.; Sinha, M. A review on carrier systems for bone morphogenetic protein-2. J. Biomed. Mater. Res. B Appl. Biomater. 2017, 105, 904–925. [Google Scholar] [CrossRef] [PubMed]
- Bal, Z.; Korkusuz, F.; Ishiguro, H.; Okada, R.; Kushioka, J.; Chijimatsu, R.; Kodama, J.; Tateiwa, D.; Ukon, Y.; Nakagawa, S.; et al. A novel nano-hydroxyapatite/synthetic polymer/bone morphogenetic protein-2 composite for efficient bone regeneration. Spine J. 2021, 21, 865–873. [Google Scholar] [CrossRef] [PubMed]
- Walmsley, G.G.; McArdle, A.; Tevlin, R.; Momeni, A.; Atashroo, D.; Hu, M.S.; Feroze, A.H.; Wong, V.W.; Lorenz, P.H.; Longaker, M.T.; et al. Nanotechnology in bone tissue engineering. Nanomedicine 2015, 11, 1253–1263. [Google Scholar] [CrossRef]
- Lukin, I.; Erezuma, I.; Desimone, M.F.; Zhang, Y.S.; Dolatshahi-Pirouz, A.; Orive, G. Nanomaterial-based drug delivery of immunomodulatory factors for bone and cartilage tissue engineering. Biomater. Adv. 2023, 154, 213637. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Gong, X. The Emerging Development of Multicolor Carbon Dots. Small 2022, 18, e2205099. [Google Scholar] [CrossRef]
- Schroeder, K.L.; Goreham, R.V.; Nann, T. Graphene Quantum Dots for Theranostics and Bioimaging. Pharm. Res. 2016, 33, 2337–2357. [Google Scholar] [CrossRef] [PubMed]
- Miao, P.; Han, K.; Tang, Y.; Wang, B.; Lin, T.; Cheng, W. Recent advances in carbon nanodots: Synthesis, properties and biomedical applications. Nanoscale 2015, 7, 1586–1595. [Google Scholar] [CrossRef]
- Zhou, Y.; Sharma, S.K.; Peng, Z.; Leblanc, R.M. Polymers in Carbon Dots: A Review. Polymers 2017, 9, 67. [Google Scholar] [CrossRef] [PubMed]
- John, B.K.; Chacko, A.R.; Mohan, C.; Mathew, B. A Review on Carbon Quantum Dot Based Semiconductor Photocatalysts for the Abatement of Refractory Pollutants. Chemphyschem 2022, 23, e202100873. [Google Scholar] [CrossRef]
- Behi, M.; Gholami, L.; Naficy, S.; Palomba, S.; Dehghani, F. Carbon dots: A novel platform for biomedical applications. Nanoscale Adv. 2022, 4, 353–376. [Google Scholar] [CrossRef] [PubMed]
- Almeida, G.; van der Poll, L.; Evers, W.H.; Szoboszlai, E.; Vonk, S.J.W.; Rabouw, F.T.; Houtepen, A.J. Size-Dependent Optical Properties of InP Colloidal Quantum Dots. Nano Lett. 2023, 23, 8697–8703. [Google Scholar] [CrossRef] [PubMed]
- Singh, I.; Arora, R.; Dhiman, H.; Pahwa, R. Carbon Quantum Dots: Synthesis, Characterization and Biomedical Applications. Turk. J. Pharm. Sci. 2018, 15, 219–230. [Google Scholar] [CrossRef]
- Manikandan, V.; Lee, N.Y. Green synthesis of carbon quantum dots and their environmental applications. Environ. Res. 2022, 212, 113283. [Google Scholar] [CrossRef] [PubMed]
- Malavika, J.P.; Shobana, C.; Sundarraj, S.; Ganeshbabu, M.; Kumar, P.; Selvan, R.K. Green synthesis of multifunctional carbon quantum dots: An approach in cancer theranostics. Biomater. Adv. 2022, 136, 212756. [Google Scholar] [CrossRef] [PubMed]
- Thakur, S.; Bains, A.; Sridhar, K.; Kaushik, R.; Chawla, P.; Sharma, M. Valorization of food industrial waste: Green synthesis of carbon quantum dots and novel applications. Chemosphere 2024, 347, 140656. [Google Scholar] [CrossRef]
- Batiha, G.E.; Alkazmi, L.M.; Wasef, L.G.; Beshbishy, A.M.; Nadwa, E.H.; Rashwan, E.K. Syzygium aromaticum L. (Myrtaceae): Traditional Uses, Bioactive Chemical Constituents, Pharmacological and Toxicological Activities. Biomolecules 2020, 10, 202. [Google Scholar] [CrossRef]
- Ulanowska, M.; Olas, B. Biological Properties and Prospects for the Application of Eugenol-A Review. Int. J. Mol. Sci. 2021, 22, 3671. [Google Scholar] [CrossRef]
- Parham, S.; Kharazi, A.Z.; Bakhsheshi-Rad, H.R.; Nur, H.; Ismail, A.F.; Sharif, S.; RamaKrishna, S.; Berto, F. Antioxidant, Antimicrobial and Antiviral Properties of Herbal Materials. Antioxidants 2020, 9, 1309. [Google Scholar] [CrossRef]
- Pandey, V.K.; Srivastava, S.; Ashish; Dash, K.K.; Singh, R.; Dar, A.H.; Singh, T.; Farooqui, A.; Shaikh, A.M.; Kovacs, B. Bioactive properties of clove (Syzygium aromaticum) essential oil nanoemulsion: A comprehensive review. Heliyon 2024, 10, e22437. [Google Scholar] [CrossRef] [PubMed]
- Seo, Y.S.; Kang, J.W. Synthesis and characterization of clove residue-derived carbon quantum dots: Application in Pickering emulsion with enhanced antibacterial properties. Chem. Eng. J. 2025, 503, 158247. [Google Scholar] [CrossRef]
- Fu, C.; Qin, X.; Zhang, J.; Zhang, T.; Song, Y.; Yang, J.; Wu, G.; Luo, D.; Jiang, N.; Bikker, F.J. In vitro and in vivo toxicological evaluation of carbon quantum dots originating from Spinacia oleracea. Heliyon 2023, 9, e13422. [Google Scholar] [CrossRef]
- Torres, F.G.; Gonzales, K.N.; Troncoso, O.P.; Canedo, V.S. Carbon Quantum Dots Based on Marine Polysaccharides: Types, Synthesis, and Applications. Mar. Drugs 2023, 21, 338. [Google Scholar] [CrossRef]
- Tang, D.; Tare, R.S.; Yang, L.Y.; Williams, D.F.; Ou, K.L.; Oreffo, R.O. Biofabrication of bone tissue: Approaches, challenges and translation for bone regeneration. Biomaterials 2016, 83, 363–382. [Google Scholar] [CrossRef]
- Hajiali, H.; Ouyang, L.; Llopis-Hernandez, V.; Dobre, O.; Rose, F. Review of emerging nanotechnology in bone regeneration: Progress, challenges, and perspectives. Nanoscale 2021, 13, 10266–10280. [Google Scholar] [CrossRef]
- Liang, W.; Zhou, C.; Bai, J.; Zhang, H.; Long, H.; Jiang, B.; Liu, L.; Xia, L.; Jiang, C.; Zhang, H.; et al. Nanotechnology-based bone regeneration in orthopedics: A review of recent trends. Nanomedicine 2024, 19, 255–275. [Google Scholar] [CrossRef] [PubMed]
- Gu, W.; Wu, C.; Chen, J.; Xiao, Y. Nanotechnology in the targeted drug delivery for bone diseases and bone regeneration. Int. J. Nanomed. 2013, 8, 2305–2317. [Google Scholar] [CrossRef]
- Zhao, F.; Zhao, Y.; Liu, Y.; Chang, X.; Chen, C.; Zhao, Y. Cellular uptake, intracellular trafficking, and cytotoxicity of nanomaterials. Small 2011, 7, 1322–1337. [Google Scholar] [CrossRef]
- Albanese, A.; Tang, P.S.; Chan, W.C. The effect of nanoparticle size, shape, and surface chemistry on biological systems. Annu. Rev. Biomed. Eng. 2012, 14, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Lundqvist, M.; Stigler, J.; Elia, G.; Lynch, I.; Cedervall, T.; Dawson, K.A. Nanoparticle size and surface properties determine the protein corona with possible implications for biological impacts. Proc. Natl. Acad. Sci. USA 2008, 105, 14265–14270. [Google Scholar] [CrossRef] [PubMed]
- Burguera, E.F.; Xu, H.H.; Weir, M.D. Injectable and rapid-setting calcium phosphate bone cement with dicalcium phosphate dihydrate. J. Biomed. Mater. Res. B Appl. Biomater. 2006, 77, 126–134. [Google Scholar] [CrossRef]
- Fantner, G.E.; Hassenkam, T.; Kindt, J.H.; Weaver, J.C.; Birkedal, H.; Pechenik, L.; Cutroni, J.A.; Cidade, G.A.; Stucky, G.D.; Morse, D.E.; et al. Sacrificial bonds and hidden length dissipate energy as mineralized fibrils separate during bone fracture. Nat. Mater. 2005, 4, 612–616. [Google Scholar] [CrossRef]
- Ferreira, R.L.; Jr, W.M.; Souza, L.E.A.; Navarro, H.M.C.; de Mello, L.R.; Mastelaro, V.R.; Sales, T.O.; Barbosa, C.; Ribeiro, A.S.; da Silva, E.R.; et al. Harnessing Efficient ROS Generation in Carbon Dots Derived from Methyl Red for Antimicrobial Photodynamic Therapy. ACS Appl. Bio Mater. 2023, 6, 4345–4357. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Li, W.; Yin, L.; Liu, Y.; Guo, H.; Lai, J.; Han, Y.; Li, G.; Li, M.; Zhang, J.; et al. Full-color fluorescent carbon quantum dots. Sci. Adv. 2020, 6, eabb6772. [Google Scholar] [CrossRef]
- Smirnov, S.V.; Harbacheuski, R.; Lewis-Antes, A.; Zhu, H.; Rameshwar, P.; Kotenko, S.V. Bone-marrow-derived mesenchymal stem cells as a target for cytomegalovirus infection: Implications for hematopoiesis, self-renewal and differentiation potential. Virology 2007, 360, 6–16. [Google Scholar] [CrossRef] [PubMed]
- Raggatt, L.J.; Partridge, N.C. Cellular and molecular mechanisms of bone remodeling. J. Biol. Chem. 2010, 285, 25103–25108. [Google Scholar] [CrossRef] [PubMed]
- Nizet, A.; Cavalier, E.; Stenvinkel, P.; Haarhaus, M.; Magnusson, P. Bone alkaline phosphatase: An important biomarker in chronic kidney disease—Mineral and bone disorder. Clin. Chim. Acta 2020, 501, 198–206. [Google Scholar] [CrossRef]
- Makris, K.; Mousa, C.; Cavalier, E. Alkaline Phosphatases: Biochemistry, Functions, and Measurement. Calcif. Tissue Int. 2023, 112, 233–242. [Google Scholar] [CrossRef]
- Gargalionis, A.N.; Adamopoulos, C.; Vottis, C.T.; Papavassiliou, A.G.; Basdra, E.K. Runx2 and Polycystins in Bone Mechanotransduction: Challenges for Therapeutic Opportunities. Int. J. Mol. Sci. 2024, 25, 5291. [Google Scholar] [CrossRef]
- Jonason, J.H.; Xiao, G.; Zhang, M.; Xing, L.; Chen, D. Post-translational Regulation of Runx2 in Bone and Cartilage. J. Dent. Res. 2009, 88, 693–703. [Google Scholar] [CrossRef] [PubMed]
- Si, J.; Wang, C.; Zhang, D.; Wang, B.; Zhou, Y. Osteopontin in Bone Metabolism and Bone Diseases. Med. Sci. Monit. 2020, 26, e919159. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.; Gill, G.; Kaur, H.; Amhmed, M.; Jakhu, H. Role of osteopontin in bone remodeling and orthodontic tooth movement: A review. Prog. Orthod. 2018, 19, 18. [Google Scholar] [CrossRef]
- Selvaraj, V.; Sekaran, S.; Dhanasekaran, A.; Warrier, S. Type 1 collagen: Synthesis, structure and key functions in bone mineralization. Differentiation 2024, 136, 100757. [Google Scholar] [CrossRef] [PubMed]
- Meng, Y.; Yang, M.X.; Liu, X.C.; Yu, W.X.; Yang, B. Zn2+-Doped Carbon Dots, a Good Biocompatibility Nanomaterial Applied for Bio-Imaging and Inducing Osteoblastic Differentiation. Nano 2019, 14, 1950029. [Google Scholar] [CrossRef]
- Shao, D.; Lu, M.; Xu, D.; Zheng, X.; Pan, Y.; Song, Y.; Xu, J.; Li, M.; Zhang, M.; Li, J.; et al. Carbon dots for tracking and promoting the osteogenic differentiation of mesenchymal stem cells. Biomater. Sci. 2017, 5, 1820–1827. [Google Scholar] [CrossRef]
- Lu, Z.; Liu, S.; Le, Y.; Qin, Z.; He, M.; Xu, F.; Zhu, Y.; Zhao, J.; Mao, C.; Zheng, L. An injectable collagen-genipin-carbon dot hydrogel combined with photodynamic therapy to enhance chondrogenesis. Biomaterials 2019, 218, 119190. [Google Scholar] [CrossRef]
- Gogoi, S.; Maji, S.; Mishra, D.; Devi, K.S.; Maiti, T.K.; Karak, N. Nano-Bio Engineered Carbon Dot-Peptide Functionalized Water Dispersible Hyperbranched Polyurethane for Bone Tissue Regeneration. Macromol. Biosci. 2017, 17, 1600271. [Google Scholar] [CrossRef] [PubMed]
- Hayrapetyan, A.; Jansen, J.A.; van den Beucken, J.J. Signaling pathways involved in osteogenesis and their application for bone regenerative medicine. Tissue Eng. Part. B Rev. 2015, 21, 75–87. [Google Scholar] [CrossRef]
- Song, D.; He, G.; Shi, Y.; Ni, J.; Long, F. Functional interaction between Wnt and Bmp signaling in periosteal bone growth. Sci. Rep. 2021, 11, 10782. [Google Scholar] [CrossRef]
- Huang, J.; Guo, X.; Li, W.; Zhang, H. Activation of Wnt/beta-catenin signalling via GSK3 inhibitors direct differentiation of human adipose stem cells into functional hepatocytes. Sci. Rep. 2017, 7, 40716. [Google Scholar] [CrossRef]
- Law, S.M.; Zheng, J.J. Premise and peril of Wnt signaling activation through GSK-3beta inhibition. iScience 2022, 25, 104159. [Google Scholar] [CrossRef]
- Cortes-Vieyra, R.; Silva-Garcia, O.; Gomez-Garcia, A.; Gutierrez-Castellanos, S.; Alvarez-Aguilar, C.; Baizabal-Aguirre, V.M. Glycogen Synthase Kinase 3beta Modulates the Inflammatory Response Activated by Bacteria, Viruses, and Parasites. Front. Immunol. 2021, 12, 675751. [Google Scholar] [CrossRef]
- Newman, H.; Shih, Y.V.; Varghese, S. Resolution of inflammation in bone regeneration: From understandings to therapeutic applications. Biomaterials 2021, 277, 121114. [Google Scholar] [CrossRef]
- Salasznyk, R.M.; Klees, R.F.; Hughlock, M.K.; Plopper, G.E. ERK signaling pathways regulate the osteogenic differentiation of human mesenchymal stem cells on collagen I and vitronectin. Cell Commun. Adhes. 2004, 11, 137–153. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.M.; Yang, Y.S.; Park, K.H.; Oh, H.; Greenblatt, M.B.; Shim, J.H. The ERK MAPK Pathway Is Essential for Skeletal Development and Homeostasis. Int. J. Mol. Sci. 2019, 20, 1803. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, M.; Sato, Y.; Haniu, H.; Nomura, H.; Kobayashi, S.; Takanashi, S.; Okamoto, M.; Takizawa, T.; Aoki, K.; Usui, Y.; et al. A three-dimensional block structure consisting exclusively of carbon nanotubes serving as bone regeneration scaffold and as bone defect filler. PLoS ONE 2017, 12, e0172601. [Google Scholar] [CrossRef]
- Tanaka, M.; Sato, Y.; Zhang, M.; Haniu, H.; Okamoto, M.; Aoki, K.; Takizawa, T.; Yoshida, K.; Sobajima, A.; Kamanaka, T.; et al. In Vitro and In Vivo Evaluation of a Three-Dimensional Porous Multi-Walled Carbon Nanotube Scaffold for Bone Regeneration. Nanomaterials 2017, 7, 46. [Google Scholar] [CrossRef] [PubMed]
- Li, C.L.; Ou, C.M.; Huang, C.C.; Wu, W.C.; Chen, Y.P.; Lin, T.E.; Ho, L.C.; Wang, C.W.; Shih, C.C.; Zhou, H.C.; et al. Carbon dots prepared from ginger exhibiting efficient inhibition of human hepatocellular carcinoma cells. J. Mater. Chem. B 2014, 2, 4564–4571. [Google Scholar] [CrossRef]
- Architha, N.; Ragupathi, M.; Shobana, C.; Selvankumar, T.; Kumar, P.; Lee, Y.S.; Selvan, R.K. Microwave-assisted green synthesis of fluorescent carbon quantum dots from extract for Fe3+ detection and bio-imaging applications. Environ. Res. 2021, 199, 111263. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.J.; Xu, H.; Guo, Q.; Yang, D.B.; Pan, Y.F.; Xue, Z.H. Preparation of Wood-Based Carbon Quantum Dots and Promotion of Light Capture Applications. Coatings 2024, 14, 417. [Google Scholar] [CrossRef]
- Sharma, N.; Yun, K. Dual sensing of tetracycline and L-Lysine using green synthesized carbon dots from seeds. Dye. Pigment. 2020, 182, 108640. [Google Scholar] [CrossRef]












| Gene | Primer | Sequence 5′―3′ |
|---|---|---|
| GAPDH | Forward | GAGTCAACGGATTTGGTCGTATTG |
| Reverse | GCTGTAGCCAAATTCGTTGTC | |
| RUNX2 | Forward | CCACCGAGACCAACAGAGTC |
| Reverse | GTCACTGTGCTGAAGAGGCT | |
| BMP-2 | Forward | TCGAAATTCCCCGTGACCAG |
| Reverse | GAATCCATGGTTGGCGTGTC | |
| BSP-2 | Forward | AAGGGCACCTCGAAGACAAC |
| Reverse | CCCTCGTATTCAACGGTGGT | |
| OPG | Forward | CGCCTCCAAGCCCCTGAGGT |
| Reverse | CAAGGGGCGCACACGGTCTT | |
| COL1A1 | Forward | GTTTGGATGGTGCCAAGGGA |
| Reverse | CAGTAGCACCATCATTTCCACG | |
| ON | Forward | ATTGACGGGTACCTCTCCCA |
| Reverse | TCCAGGTCACAGGTCTCGAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hong, H.-S.; Park, H.-J.; Lee, J.-M.; Chen, Z.-Y.; Kim, T.-W.; Seo, Y.-S.; Kang, J.-W.; Seo, Y.-K. Bioactive Carbon Dots from Clove Residue: Synthesis, Characterization, and Osteogenic Properties. Biomedicines 2025, 13, 527. https://doi.org/10.3390/biomedicines13020527
Hong H-S, Park H-J, Lee J-M, Chen Z-Y, Kim T-W, Seo Y-S, Kang J-W, Seo Y-K. Bioactive Carbon Dots from Clove Residue: Synthesis, Characterization, and Osteogenic Properties. Biomedicines. 2025; 13(2):527. https://doi.org/10.3390/biomedicines13020527
Chicago/Turabian StyleHong, Hye-Sun, Hee-Jung Park, Ji-Min Lee, Zu-Yu Chen, Tae-Woo Kim, Yong-Seok Seo, Jun-Won Kang, and Young-Kwon Seo. 2025. "Bioactive Carbon Dots from Clove Residue: Synthesis, Characterization, and Osteogenic Properties" Biomedicines 13, no. 2: 527. https://doi.org/10.3390/biomedicines13020527
APA StyleHong, H.-S., Park, H.-J., Lee, J.-M., Chen, Z.-Y., Kim, T.-W., Seo, Y.-S., Kang, J.-W., & Seo, Y.-K. (2025). Bioactive Carbon Dots from Clove Residue: Synthesis, Characterization, and Osteogenic Properties. Biomedicines, 13(2), 527. https://doi.org/10.3390/biomedicines13020527

