Investigating the Association between Catechol-O-Methyltransferase Gene Activity and Pain Perception in South African Patients with Different Temporomandibular Disorders Diagnoses
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Participants
- -
- Maxillofacial trauma or surgery: A detailed clinical history, supplemented by appropriate clinical and radiographic examinations, was used to identify individuals with a history of trauma or surgery in the maxillofacial region. This exclusion aimed to isolate the effects of TMD on pain perception from the potential contributions of prior injuries or surgical procedures.
- -
- Rheumatic conditions: Participants with a confirmed diagnosis of fibromyalgia [18], systemic lupus erythematosus [19], rheumatoid arthritis [20,21], psoriatic arthritis [22], and ankylosing spondylitis [23] were excluded. These chronic inflammatory conditions can independently impact pain perception, potentially confounding the study’s investigation of the relationship between COMT gene activity and pain in TMD patients.
| Inclusion criteria: Volunteers of both sexes, 18 years and above. |
| (n = 196) |
| Exclusion criteria: History of trauma and/or surgery in the maxillo-facial region; diagnosis of fibromyalgia; systemic lupus erythematosus; rheumatoid arthritis or other forms of systemic joint disease. |
| Stage I: Clinical diagnosis of TMD - DC/TMD—Axis I will be applied, and nine groups formed: 0—the absence of TMD; 1—myalgia; 2—myofascial pain with referral; 3—arthralgia; 4—Disk Displacement with Reduction (DDwR); 5—Disk Displacement with Reduction with Intermittent Locking (DDwR-IL); 6—Disk Displacement without Reduction with Limited Opening (DDwoR-LO); 7—Disk Displacement without Reduction without Limited opening (DDwoR-nLO); 8—Degenerative Joint Disease (DJD); 9—subluxation - DC/TMD—Axis II: The graded chronic pain scale, jaw functional limitation scale, patient health questionnaire, general anxiety disorder questionnaire, oral behavior checklist, and patient health questionnaire. |
| Stage II: Genotyping Genomic DNA were obtained from saliva samples from all participants. |
| COMT (Catechol-O-Methyltransferase) rs165774, rs6269, rs9332377, rs4646310, rs165656, rs4680. |
2.2. Ethics
2.3. Saliva Collection Technique
2.4. DNA Isolation from Saliva
2.5. Genotyping
2.6. Statistical Analysis
3. Results and Discussion
3.1. TaqMan Genotyping Assay
| Assay ID | dbSNP | Context Sequence [Allele 1 (VIC)/Allele 2 (FAM)] |
|---|---|---|
| C___2255325_10 | rs165774 | AAACTGGACACTGCTGTTAGCAGCC[A/G]GACTAGGAGCACGAGGGGCACAGCC |
| C___2538746_1_ | rs6269 | GCATTTCTGAACCTTGCCCCTCTGC[G/A]AACACAAGGGGGCGATGGTGGCACT |
| C__11804672_10 | rs4646310 | TTCTTCAGGGGCTCCAGGAGGACGA[A/G]TGTGTATCCTCCCATTGCTCTGTGC |
| C__29614343_10 | rs9332377 | AACCCCTCTCCTTGGGTGCCTCTCC[C/T]TCATAGGCCTGAGTTCCTGGCACTG |
| C___2539305_30 | rs165656 | CAGTGCCAGGGTGGGTACAGATTCC[G/C]GCCCGGTGCATGGGCACAGGTCTGC |
| C__25746809_50 | rs4680 | CCAGCGGATGGTGGATTTCGCTGGC[A/G]TGAAGGACAAGGTGTGCATGCCTGA |
3.2. Hardy–Weinberg Equilibrium Analysis
| HWE—COMT SNP | CASES | CONTROLS |
|---|---|---|
| Rs165656 | 0.054 | 0.366 |
| Rs9332377 | 0.638 | 0.432 |
| Rs4646310 | 0.271 | 0.008 |
| Rs6269 | 0.251 | 0.949 |
| Rs165774 | 0.000 | 0.440 |
| Rs4680 | 0.011 | 0.027 |
3.3. Demographic Factors: Age, Gender, Ethnicity
3.4. Axis I Diagnostic Groups
3.5. Distribution of COMT Genotype Frequencies between the TMD and the Control Groups
| SNP | TMD (%) | Control (%) | OR | CI | p-Value |
|---|---|---|---|---|---|
| rs165656 | |||||
| CC | 27 | 22 | 1.3717 | 0.7153 to 2.6304 | p = 0.3415 |
| CG | 38 | 44 | 0.8182 | 0.4619 to 1.4494 | p = 0.4915 |
| GG | 30 | 32 | Ref | Ref | Ref |
| rs9332377 | |||||
| CC | 66 | 66 | Ref | Ref | Ref |
| CT | 27 | 26 | 1.069 | 0.5673 to 2.0144 | p = 0.8365 |
| TT | 2 | 4 | 0.4946 | 0.08842 to 2.767 | p = 0.4229 |
| rs4646310 | |||||
| AA | 2 | 6 | Ref | Ref | Ref |
| AG | 20 | 17 | 1.2539 | 0.6113 to 2.5718 | p = 0.5371 |
| GG | 74 | 75 | 1.0806 | 0.5512 to 2.1184 | p = 0.8214 |
| rs6269 | |||||
| AA | 40 | 42 | 0.9694 | 0.5489 to 1.712 | p = 0.9147 |
| AG | 40 | 45 | 0.8571 | 0.4863 to 1.5107 | p = 0.5939 |
| GG | 16 | 12 | Ref | Ref | Ref |
| rs165774 | |||||
| AA | 16 | 10 | Ref | Ref | Ref |
| AG | 25 | 37 | 0.489 | 0.2644 to 0.9042 | p = 0.0225 |
| GG | 60 | 45 | 1.5285 | 0.8644 to 2.7025 | p = 0.1446 |
| rs4680 | |||||
| AA | 28 | 26 | Ref | Ref | Ref |
| AG | 35 | 37 | 0.9302 | 0.518 to 1.6704 | p = 0.8085 |
| GG | 32 | 33 | 1.9091 | 1.0005 to 3.6428 | p = 0.0498 |
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Cadden, S. Orofacial Pain. Guidelines for Assessment, Diagnosis, and Management, 4th Edition (2008). Eur. J. Orthod. 2009, 31, 216–217. [Google Scholar] [CrossRef]
- Maniaci, A.; Lavalle, S.; Anzalone, R.; Lo Giudice, A.; Cocuzza, S.; Parisi, F.M.; Torrisi, F.; Iannella, G.; Sireci, F.; Fadda, G.; et al. Oral Health Implications of Obstructive Sleep Apnea: A Literature Review. Biomedicines 2024, 12, 1382. [Google Scholar] [CrossRef]
- Magnusson, T.; Egermark, I.; Carlsson, G.E. A Longitudinal Epidemiologic Study of Signs and Symptoms of Temporomandibular Disorders from 15 to 35 Years of Age. J. Orofac. Pain 2000, 14, 310–319. [Google Scholar]
- Palmer, J.; Durham, J. Temporomandibular Disorders. BJA Educ. 2021, 21, 44–50. [Google Scholar] [CrossRef]
- Schiffman, E.; Ohrbach, R.; Truelove, E.; Look, J.; Anderson, G.; Goulet, J.-P.; List, T.; Svensson, P.; Gonzalez, Y.; Lobbezoo, F.; et al. Diagnostic Criteria for Temporomandibular Disorders (DC/TMD) for Clinical and Research Applications: Recommendations of the International RDC/TMD Consortium Network* and Orofacial Pain Special Interest Group†. J. Oral Facial Pain Headache 2014, 28, 6–27. [Google Scholar] [CrossRef]
- Nilsson, I.-M.; List, T.; Willman, A. Adolescents with Temporomandibular Disorder Pain-the Living with TMD Pain Phenomenon. J. Orofac. Pain 2011, 25, 107–116. [Google Scholar]
- Smith, S.B.; Maixner, D.W.; Greenspan, J.D.; Dubner, R.; Fillingim, R.B.; Ohrbach, R.; Knott, C.; Slade, G.D.; Bair, E.; Gibson, D.G.; et al. Potential Genetic Risk Factors for Chronic TMD: Genetic Associations from the OPPERA Case Control Study. J. Pain 2011, 12, T92–T101. [Google Scholar] [CrossRef]
- Smith, S.B.; Mir, E.; Bair, E.; Slade, G.D.; Dubner, R.; Fillingim, R.B.; Greenspan, J.D.; Ohrbach, R.; Knott, C.; Weir, B.; et al. Genetic Variants Associated with Development of TMD and Its Intermediate Phenotypes: The Genetic Architecture of TMD in the OPPERA Prospective Cohort Study. J. Pain 2013, 14, T91–T101. [Google Scholar] [CrossRef]
- Diatchenko, L.; Slade, G.D.; Nackley, A.G.; Bhalang, K.; Sigurdsson, A.; Belfer, I.; Goldman, D.; Xu, K.; Shabalina, S.A.; Shagin, D.; et al. Genetic Basis for Individual Variations in Pain Perception and the Development of a Chronic Pain Condition. Hum. Mol. Genet. 2005, 14, 135–143. [Google Scholar] [CrossRef]
- Diatchenko, L.; Nackley, A.G.; Slade, G.D.; Bhalang, K.; Belfer, I.; Max, M.B.; Goldman, D.; Maixner, W. Catechol-O-Methyltransferase Gene Polymorphisms Are Associated with Multiple Pain-Evoking Stimuli. Pain 2006, 125, 216–224. [Google Scholar] [CrossRef]
- Belfer, I.; Segall, S. COMT Genetic Variants and Pain. Drugs Today 2011, 47, 457–467. [Google Scholar] [CrossRef]
- Nackley, A.G.; Shabalina, S.A.; Tchivileva, I.E.; Satterfield, K.; Korchynskyi, O.; Makarov, S.S.; Maixner, W.; Diatchenko, L. Human Catechol-O-Methyltransferase Haplotypes Modulate Protein Expression by Altering MRNA Secondary Structure. Science 2006, 314, 1930–1933. [Google Scholar] [CrossRef]
- Zhang, Y.; Belfer, I.; Nouraie, M.; Zeng, Q.; Goel, R.; Chu, Y.; Krasiy, I.; Krishnamurti, L. Association of Genetic Variation in COMT Gene with Pain Related to Sickle Cell Disease in Patients from the Walk-PHaSST Study. J. Pain Res. 2018, 11, 537–543. [Google Scholar] [CrossRef]
- Mladenovic, I.; Supic, G.; Kozomara, R.; Dodic, S.; Ivkovic, N.; Milicevic, B.; Simic, I.; Magic, Z. Genetic Polymorphisms of Catechol-O-Methyltransferase: Association with Temporomandibular Disorders and Postoperative Pain. J. Oral Facial Pain Headache 2016, 30, 302–310. [Google Scholar] [CrossRef]
- Michelotti, A.; Liguori, R.; Toriello, M.; D’Antò, V.; Vitale, D.; Castaldo, G.; Sacchetti, L. Catechol-O-methyltransferase (COMT) gene polymorphisms as risk factor in temporomandibular disorders patients from Southern Italy. Clin. J. Pain 2014, 30, 129–133. [Google Scholar] [CrossRef]
- Skouen, J.S.; Smith, A.J.; Warrington, N.M.; O’ Sullivan, P.B.; McKenzie, L.; Pennell, C.E.; Straker, L.M. Genetic Variation in the Beta-2 Adrenergic Receptor Is Associated with Chronic Musculoskeletal Complaints in Adolescents. Eur. J. Pain 2012, 16, 1232–1242. [Google Scholar] [CrossRef]
- de Souza Tesch, R.; Ladeira Bonato, L.; Quinelato, V.; Ladeira Casado, P.; Rezende Vieira, A.; Granjeiro, J.M.; Góes, C. Evaluation of Genetic Risk Related to Catechol-O-Methyltransferase (COMT) and Β2-Adrenergic Receptor (ADRB2) Activity in Different Diagnostic Subgroups of Temporomandibular Disorder in Brazilian Patients. Int. J. Oral Maxillofac. Surg. 2020, 49, 237–243. [Google Scholar] [CrossRef]
- Salaffi, F.; Di Carlo, M.; Farah, S.; Atzeni, F.; Buskila, D.; Ablin, J.N.; Häuser, W.; Sarzi-Puttini, P. Diagnosis of Fibromyalgia: Comparison of the 2011/2016 ACR and AAPT Criteria and Validation of the Modified Fibromyalgia Assessment Status. Rheumatology 2020, 59, 3042–3049. [Google Scholar] [CrossRef]
- Yu, C.; Gershwin, M.E.; Chang, C. Diagnostic Criteria for Systemic Lupus Erythematosus: A Critical Review. J. Autoimmun. 2014, 48–49, 10–13. [Google Scholar] [CrossRef]
- Steiner, G.; Verschueren, P.; Van Hoovels, L.; Studenic, P.; Bossuyt, X. Classification of Rheumatoid Arthritis: Is It Time to Revise the Criteria? RMD Open 2024, 10, e003851. [Google Scholar] [CrossRef]
- Aletaha, D.; Neogi, T.; Silman, A.J.; Funovits, J.; Felson, D.T.; Bingham, C.O., 3rd; Birnbaum, N.S.; Burmester, G.R.; Bykerk, V.P.; Cohen, M.D.; et al. 2010 Rheumatoid Arthritis Classification Criteria: An American College of Rheumatology/European League Against Rheumatism Collaborative Initiative. Arthritis Rheum. 2010, 62, 2569–2581. [Google Scholar] [CrossRef]
- Taylor, W.; Gladman, D.; Helliwell, P.; Marchesoni, A.; Mease, P.; Mielants, H. Classification Criteria for Psoriatic Arthritis: Development of New Criteria from a Large International Study. Arthritis Rheum. 2006, 54, 2665–2673. [Google Scholar] [CrossRef]
- Raychaudhuri, S.P.; Deodhar, A. The Classification and Diagnostic Criteria of Ankylosing Spondylitis. J. Autoimmun. 2014, 48–49, 128–133. [Google Scholar] [CrossRef]
- Dia, M.; Wehner, T.C.; Arellano, C. RGxE: An R Program for Genotype x Environment Interaction Analysis. Am. J. Plant Sci. 2017, 08, 1672–1698. [Google Scholar] [CrossRef]
- Ghasemi, A.; Zahediasl, S. Normality Tests for Statistical Analysis: A Guide for Non-Statisticians. Int. J. Endocrinol. Metab. 2012, 10, 486–489. [Google Scholar] [CrossRef]
- Benjamini, Y.; Hochberg, Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. J. R. Stat. Soc. Ser. B 1995, 57, 289–300. [Google Scholar] [CrossRef]
- Fay, M.P.; Proschan, M.A. Wilcoxon-Mann-Whitney or t-Test? On Assumptions for Hypothesis Tests and Multiple Interpretations of Decision Rules. Stat. Surv. 2010, 4, 1–39. [Google Scholar] [CrossRef]
- Wang, X.; Wang, J.; Xia, X.; Xu, X.; Li, L.; Cao, S.; Hao, Y.; Zhang, L. Effect of Genotyping Errors on Linkage Map Construction Based on Repeated Chip Analysis of Two Recombinant Inbred Line Populations in Wheat (Triticum aestivum L.). BMC Plant Biol. 2024, 24, 306. [Google Scholar] [CrossRef]
- Wishart, H.A.; Roth, R.M.; Saykin, A.J.; Rhodes, C.H.; Tsongalis, G.J.; Pattin, K.A.; Moore, J.H.; McAllister, T.W. COMT Val158Met Genotype and Individual Differences in Executive Function in Healthy Adults. J. Int. Neuropsychol. Soc. 2011, 17, 174–180. [Google Scholar] [CrossRef]
- Zawiślak, A.; Woźniak, K.; Tartaglia, G.; Kawala, B.; Gupta, S.; Znamirowska-Bajowska, A.; Grocholewicz, K.; Lubiński, J.; Jakubowska, A. Testing Reported Associations of Gene Variants with Non-Syndromic Orofacial Clefts in the Polish Population. Biomedicines 2024, 12, 1700. [Google Scholar] [CrossRef]
- Alshahrani, A.A.; Saini, R.S.; Okshah, A.; Alshadidi, A.A.F.; Kanji, M.A.; Vyas, R.; Binduhayyim, R.I.H.; Ahmed, N.; Mosaddad, S.A.; Heboyan, A. The Association between Genetic Factors and Temporomandibular Disorders: A Systematic Literature Review. Arch. Oral Biol. 2024, 166, 106032. [Google Scholar] [CrossRef]
- Palada, V.; Kaunisto, M.A.; Kalso, E. Genetics and Genomics in Postoperative Pain and Analgesia. Curr. Opin. Anaesthesiol. 2018, 31, 569–574. [Google Scholar] [CrossRef]
- Mamoun Abdelmageid, S.; Mousa Alamir, F.; Yousif Abdelrahman, H.; Mohamed Abushama, H. Association of COMT Val158Met Polymorphism with Fibromyalgia in Khartoum State, Sudan. Pain Res. Manag. 2023, 2023, 7313578. [Google Scholar] [CrossRef] [PubMed]
- Douglas, J.A.; Boehnke, M.; Lange, K. A Multipoint Method for Detecting Genotyping Errors and Mutations in Sibling-Pair Linkage Data. Am. J. Hum. Genet. 2000, 66, 1287–1297. [Google Scholar] [CrossRef]
- Ehm, M.G.; Kimmel, M.; Cottingham, R.W.J. Error Detection for Genetic Data, Using Likelihood Methods. Am. J. Hum. Genet. 1996, 58, 225–234. [Google Scholar]
- Toleno, D.M.; Morrell, P.L.; Clegg, M.T. Error Detection in SNP Data by Considering the Likelihood of Recombinational History Implied by Three-Site Combinations. Bioinformatics 2007, 23, 1807–1814. [Google Scholar] [CrossRef][Green Version]
- Ewen, K.R.; Bahlo, M.; Treloar, S.A.; Levinson, D.F.; Mowry, B.; Barlow, J.W.; Foote, S.J. Identification and Analysis of Error Types in High-Throughput Genotyping. Am. J. Hum. Genet. 2000, 67, 727–736. [Google Scholar] [CrossRef]
- Okutan, G.; Ruiz Casares, E.; Perucho Alcalde, T.; Sánchez Niño, G.M.; Penadés, B.F.; Terrén Lora, A.; Torrente Estríngana, L.; López Oliva, S.; San Mauro Martín, I. Prevalence of Genetic Diamine Oxidase (DAO) Deficiency in Female Patients with Fibromyalgia in Spain. Biomedicines 2023, 11, 660. [Google Scholar] [CrossRef]
- Cruz, D.; Monteiro, F.; Paço, M.; Vaz-Silva, M.; Lemos, C.; Alves-Ferreira, M.; Pinho, T. Genetic Overlap between Temporomandibular Disorders and Primary Headaches: A Systematic Review. Jpn. Dent. Sci. Rev. 2022, 58, 69–88. [Google Scholar] [CrossRef]
- Tammimäki, A.; Männistö, P.T. Catechol-O-Methyltransferase Gene Polymorphism and Chronic Human Pain: A Systematic Review and Meta-Analysis. Pharmacogenet. Genom. 2012, 22, 673–691. [Google Scholar] [CrossRef]
- Nascimento, T.D.; Yang, N.; Salman, D.; Jassar, H.; Kaciroti, N.; Bellile, E.; Danciu, T.; Koeppe, R.; Stohler, C.; Zubieta, J.K.; et al. Μ-Opioid Activity in Chronic TMD Pain Is Associated with COMT Polymorphism. J. Dent. Res. 2019, 98, 1324–1331. [Google Scholar] [CrossRef]
| TMD | CONTROL | Adj. P | ||||
|---|---|---|---|---|---|---|
| Age | 0.8803 | |||||
| n | 97 | 99 | ||||
| % | 49.49 | 50.51 | ||||
| Mean | 36.39 | 37.14 | ||||
| SD | 14.72 | 15.12 | ||||
| N | % | N | % | |||
| Race | 0.8487 | |||||
| NonWhite | 40 | 41.24 | 46 | 46.46 | ||
| White | 57 | 58.76 | 53 | 53.54 | ||
| Gender | 0.8487 | |||||
| Male | 19 | 19.59 | 25 | 25.25 | ||
| Female | 78 | 80.41 | 74 | 74.75 | ||
| TMD | CONTROL | Adj. P | ||||
|---|---|---|---|---|---|---|
| Myalgia (Group 1) | N | % | n | % | <0.0001 | |
| No | 68 | 61.86 | 99 | 100 | ||
| Yes | 29 | 29.90 | 0 | 0.00 | ||
| MFP with Referral (Group 2) | <0.0001 | |||||
| No | 60 | 61.86 | 99 | 100 | ||
| Yes | 37 | 37.14 | 0 | 0.00 | ||
| Arthralgia (Group 3) | <0.0001 | |||||
| No | 76 | 78.35 | 99 | 100 | ||
| Yes | 21 | 21.65 | 0 | 0.00 | ||
| DDwR (Group 4) | <0.0001 | |||||
| No | 70 | 72.16 | 99 | 100 | ||
| Yes | 27 | 27.84 | 0 | 0.00 | ||
| DDwR-IL (Group 5) | 0.0041 | |||||
| No | 84 | 86.60 | 99 | 100 | ||
| Yes | 13 | 13.40 | 0 | 0.00 | ||
| DDwR-LO (Group 6) | <0.0001 | |||||
| No | 58 | 59.79 | 99 | 100 | ||
| Yes | 39 | 40.21 | 0 | 0.00 | ||
| DDwoR-nLO (Group 7) | 0.0053 | |||||
| No | 87 | 89.69 | 99 | 100 | ||
| Yes | 10 | 10.31 | 0 | 0.00 | ||
| DJD (Group 8) | <0.0001 | |||||
| No | 56 | 57.73 | 99 | 100 | ||
| Yes | 41 | 42.27 | 0 | 0.00 | ||
| Subluxation (Group 9) | 0.2853 | |||||
| No | 93 | 95.88 | 99 | 100 | ||
| Yes | 4 | 4.12 | 0 | 0.00 | ||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Meyer, M.K.; Ismail, E.; Chetty, M. Investigating the Association between Catechol-O-Methyltransferase Gene Activity and Pain Perception in South African Patients with Different Temporomandibular Disorders Diagnoses. Biomedicines 2024, 12, 2331. https://doi.org/10.3390/biomedicines12102331
Meyer MK, Ismail E, Chetty M. Investigating the Association between Catechol-O-Methyltransferase Gene Activity and Pain Perception in South African Patients with Different Temporomandibular Disorders Diagnoses. Biomedicines. 2024; 12(10):2331. https://doi.org/10.3390/biomedicines12102331
Chicago/Turabian StyleMeyer, Mark Keith, Enas Ismail, and Manogari Chetty. 2024. "Investigating the Association between Catechol-O-Methyltransferase Gene Activity and Pain Perception in South African Patients with Different Temporomandibular Disorders Diagnoses" Biomedicines 12, no. 10: 2331. https://doi.org/10.3390/biomedicines12102331
APA StyleMeyer, M. K., Ismail, E., & Chetty, M. (2024). Investigating the Association between Catechol-O-Methyltransferase Gene Activity and Pain Perception in South African Patients with Different Temporomandibular Disorders Diagnoses. Biomedicines, 12(10), 2331. https://doi.org/10.3390/biomedicines12102331
