The Use of Aptamers and Molecularly Imprinted Polymers in Biosensors for Environmental Monitoring: A Tale of Two Receptors
Abstract
:1. Introduction
1.1. The Development of Aptamers and MIPs
1.2. Interfacing Aptamers and MIPs to the Sensor Surface
2. Aptamers and MIPs in the Detection of Small Molecule Contaminants
2.1. Antibiotics
2.2. Pesticides
2.3. Heavy Metals
2.3.1. Cadmium Sensing
2.3.2. Lead Sensing
2.3.3. Mercury Sensing
2.4. MIPs and Aptamers in the Detection of Large Pathogen Contaminants
2.4.1. Bacteria Detection
2.4.2. Virus Detection
3. Conclusions and Future Directions
Author Contributions
Funding
Conflicts of Interest
References
- Rebek, J. Introduction to the Molecular Recognition and Self-Assembly Special Feature. Proc. Natl. Acad. Sci. USA 2009, 106, 10423–10424. [Google Scholar] [CrossRef] [Green Version]
- Vater, A.; Klussmann, S. Turning mirror-image oligonucleotides into drugs: The evolution of Spiegelmer® therapeutics. Drug Discov. Today 2015, 20, 147–155. [Google Scholar] [CrossRef] [Green Version]
- Gawande, B.N.; Rohloff, J.C.; Carter, J.D.; Von Carlowitz, I.; Zhang, C.; Schneider, D.J.; Janjic, N. Selection of DNA aptamers with two modified bases. Proc. Natl. Acad. Sci. USA 2017, 114, 2898–2903. [Google Scholar] [CrossRef] [Green Version]
- Ni, S.; Yao, H.; Wang, L.; Lu, J.; Jiang, F.; Lu, A.; Zhang, G. Chemical modifications of nucleic acid aptamers for therapeutic purposes. Int. J. Mol. Sci. 2017, 18, 1683. [Google Scholar] [CrossRef]
- Wang, R.E.; Wu, H.; Niu, Y.; Cai, J. Improving the Stability of Aptamers by Chemical Modification. Curr. Med. Chem. 2011, 18, 4126–4138. [Google Scholar] [CrossRef]
- Zulkefli, N.S.; Kim, K.H.; Hwang, S.J. Effects of microbial activity and environmental parameters on the degradation of extracellular environmental DNA from a eutrophic lake. Int. J. Environ. Res. Public Health 2019, 16, 3339. [Google Scholar] [CrossRef] [Green Version]
- Chen, L.; Wang, X.; Lu, W.; Wu, X.; Li, J. Molecular imprinting: Perspectives and applications. Chem. Soc. Rev. 2016, 45, 2137–2211. [Google Scholar] [CrossRef]
- Silvestri, D.; Barbani, N.; Cristallini, C.; Giusti, P.; Ciardelli, G. Molecularly imprinted membranes for an improved recognition of biomolecules in aqueous medium. J. Memb. Sci. 2006, 282, 284–295. [Google Scholar] [CrossRef]
- Wackerlig, J.; Schirhagl, R. Applications of Molecularly Imprinted Polymer Nanoparticles and Their Advances toward Industrial Use: A Review. Anal. Chem. 2016, 88, 250–261. [Google Scholar] [CrossRef]
- Poma, A.; Guerreiro, A.; Whitcombe, M.J.; Elena, V. Solid-Phase Synthesis of Molecularly Imprinted Polymer Nanoparticles with a Reusable Template—“Plastic Antibodies”. 2016, 23, 2821–2827. [Google Scholar] [CrossRef] [Green Version]
- Ellington, A.D.; Szostak, J.W. In Vitro selection of RNA molecules that bind specific ligands. Nature 1990, 346, 818–822. [Google Scholar] [CrossRef] [PubMed]
- Hashim, S.N.N.S.; Boysen, R.I.; Schwarz, L.J.; Danylec, B.; Hearn, M.T.W. A comparison of covalent and non-covalent imprinting strategies for the synthesis of stigmasterol imprinted polymers. J. Chromatogr. A 2014, 1359, 35–43. [Google Scholar] [CrossRef] [PubMed]
- Schmidt, R.H.; Haupt, K. Molecularly imprinted polymer films with binding properties enhanced by the reaction-induced phase separation of a sacrificial polymeric porogen. Chem. Mater. 2005, 17, 1007–1016. [Google Scholar] [CrossRef]
- Ashley, J.; Feng, X.; Halder, A.; Zhou, T.; Sun, Y. Dispersive solid-phase imprinting of proteins for the production of plastic antibodies. Chem. Commun. 2018, 54, 3355–3358. [Google Scholar] [CrossRef] [Green Version]
- Ashley, J.; Feng, X.T.; Sun, Y. A multifunctional molecularly imprinted polymer-based biosensor for direct detection of doxycycline in food samples. Talanta 2018, 182, 49–54. [Google Scholar] [CrossRef] [Green Version]
- Zhou, T.; Ashley, J.; Feng, X.; Sun, Y. Detection of hemoglobin using hybrid molecularly imprinted polymers/carbon quantum dots-based nanobiosensor prepared from surfactant-free Pickering emulsion. Talanta 2018, 190, 443–449. [Google Scholar] [CrossRef]
- Xia, Q.; Yun, Y.; Li, Q.; Huang, Z.; Liang, Z. Preparation and characterization of monodisperse molecularly imprinted polymer microspheres by precipitation polymerization for kaempferol. Des. Monomers Polym. 2017, 20, 201–209. [Google Scholar] [CrossRef] [Green Version]
- Canfarotta, F.; Poma, A.; Guerreiro, A.; Piletsky, S. Solid-phase synthesis of molecularly imprinted nanoparticles. Nat. Protoc. 2016, 11, 443–455. [Google Scholar] [CrossRef]
- Yang, K.; Li, S.; Liu, L.; Chen, Y.; Zhou, W.; Pei, J.; Liang, Z.; Zhang, L.; Zhang, Y. Epitope Imprinting Technology: Progress, Applications, and Perspectives toward Artificial Antibodies. Adv. Mater. 2019, 31, 1–17. [Google Scholar] [CrossRef]
- Altintas, Z.; Takiden, A.; Utesch, T.; Mroginski, M.A.; Schmid, B.; Scheller, F.W.; Süssmuth, R.D. Integrated Approaches Toward High-Affinity Artificial Protein Binders Obtained via Computationally Simulated Epitopes for Protein Recognition. Adv. Funct. Mater. 2019, 29, 1–11. [Google Scholar] [CrossRef]
- Ashley, J.; Shukor, Y.; Tothill, I.E. The use of differential scanning fluorimetry in the rational design of plastic antibodies for protein targets. Analyst 2016, 141, 6463–6470. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kalra, P.; Dhiman, A.; Cho, W.C.; Bruno, J.G.; Sharma, T.K. Simple Methods and Rational Design for Enhancing Aptamer Sensitivity and Specificity. Front. Mol. Biosci. 2018, 5, 41. [Google Scholar] [CrossRef] [PubMed]
- Ali, M.H.; Elsherbiny, M.E.; Emara, M. Updates on aptamer research. Int. J. Mol. Sci. 2019, 20, 2511. [Google Scholar] [CrossRef] [Green Version]
- Kaur, H.; Bruno, J.G.; Kumar, A.; Sharma, T.K. Aptamers in the therapeutics and diagnostics pipelines. Theranostics 2018, 8, 4016–4032. [Google Scholar] [CrossRef]
- Lu, W.; Xue, M.; Xu, Z.; Dong, X.; Xue, F.; Wang, F.; Wang, Q.; Meng, Z. Molecularly imprinted polymers for the sensing of explosives and chemical warfare agents. Curr. Org. Chem. 2015, 19, 62–71. [Google Scholar] [CrossRef]
- Whitcombe, M.J.; Chianella, I.; Larcombe, L.; Piletsky, S.A.; Noble, J.; Porter, R.; Horgan, A. The rational development of molecularly imprinted polymer-based sensors for protein detection. Chem. Soc. Rev. 2011, 40, 1547–1571. [Google Scholar] [CrossRef] [Green Version]
- Martin, J.A.; Smith, J.E.; Warren, M.; Chávez, J.L.; Hagen, J.A.; Kelley-Loughnane, N. A Method for Selecting Structure-switching Aptamers Applied to a Colorimetric Gold Nanoparticle Assay. J. Vis. Exp. 2015, 96, e52545. [Google Scholar] [CrossRef] [Green Version]
- McKeague, M.; Derosa, M.C. Challenges and opportunities for small molecule aptamer development. J. Nucleic Acids 2012, 2012, 20. [Google Scholar] [CrossRef]
- Rangel, A.E.; Chen, Z.; Ayele, T.M.; Heemstra, J.M. In Vitro selection of an XNA aptamer capable of small-molecule recognition. Nucleic Acids Res. 2018, 46, 8057–8068. [Google Scholar] [CrossRef]
- Thiel, W.H.; Bair, T.; Wyatt Thiel, K.; Dassie, J.P.; Rockey, W.M.; Howell, C.A.; Liu, X.Y.; Dupuy, A.J.; Huang, L.; Owczarzy, R.; et al. Nucleotide bias observed with a short SELEX RNA aptamer library. Nucleic Acid Ther. 2011, 21, 253–263. [Google Scholar] [CrossRef] [Green Version]
- Berezovski, M.; Musheev, M.; Drabovich, A.; Krylov, S.N. Non-SELEX Selection of Aptamers. J. Am. Chem. Soc. 2006, 128, 1410–1411. [Google Scholar] [CrossRef] [PubMed]
- Nishimura, K.; Haginaka, J. Preparation and evaluation of molecularly imprinted polymers for promazine and chlorpromazine by multi-step swelling and polymerization: The application for the determination of promazine in rat serum by column-switching LC. Anal. Sci. 2019, 35, 659–664. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Larpant, N.; Suwanwong, Y.; Boonpangrak, S.; Laiwattanapaisal, W. Exploring matrix effects on binding properties and characterization of cotinine molecularly imprinted polymer on paper-based scaffold. Polymers 2019, 11, 570. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Madikizela, L.M.; Tavengwa, N.T.; Tutu, H.; Chimuka, L. Green aspects in molecular imprinting technology: From design to environmental applications. Trends Environ. Anal. Chem. 2018, 17, 14–22. [Google Scholar] [CrossRef]
- El-Sharif, H.F.; Hawkins, D.M.; Stevenson, D.; Reddy, S.M. Determination of protein binding affinities within hydrogel-based molecularly imprinted polymers (HydroMIPs). Phys. Chem. Chem. Phys. 2014, 16, 15483–15489. [Google Scholar] [CrossRef] [Green Version]
- Rampey, A.M.; Umpleby, R.J.; Rushton, G.T.; Iseman, J.C.; Shah, R.N.; Shimizu, K.D. Characterization of the Imprint Effect and the Influence of Imprinting Conditions on Affinity, Capacity, and Heterogeneity in Molecularly Imprinted Polymers Using the Freundlich Isotherm-Affinity Distribution Analysis. Anal. Chem. 2004, 76, 1123–1133. [Google Scholar] [CrossRef]
- Jing, M.; Bowser, M.T. Methods for measuring aptamer-protein equilibria: A review. Anal. Chim. Acta 2011, 686, 9–18. [Google Scholar] [CrossRef] [Green Version]
- Gast, M.; Sobek, H.; Mizaikoff, B. Advances in imprinting strategies for selective virus recognition a review. TrAC Trends Anal. Chem. 2019, 114, 218–232. [Google Scholar] [CrossRef]
- Verheyen, E.; Schillemans, J.P.; Van Wijk, M.; Demeniex, M.A.; Hennink, W.E.; Van Nostrum, C.F. Challenges for the effective molecular imprinting of proteins. Biomaterials 2011, 32, 3008–3020. [Google Scholar] [CrossRef] [Green Version]
- Ohuchi, S. Cell-Selex technology. Biores. Open Access 2012, 1, 265–272. [Google Scholar] [CrossRef]
- Song, X.; Wang, J.; Zhu, J. Effect of porogenic solvent on selective performance of molecularly imprinted polymer for quercetin. Mater. Res. 2009, 12, 299–304. [Google Scholar] [CrossRef] [Green Version]
- Busato, M.; Distefano, R.; Bates, F.; Karim, K.; Bossi, A.M.; López Vilariño, J.M.; Piletsky, S.; Bombieri, N.; Giorgetti, A. MIRATE: MIps RATional dEsign Science Gateway. J. Integr. Bioinform. 2018, 15, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Ciardelli, G.; Silvestri, D.; Cristallini, C.; Barbani, N.; Giusti, P. The relevance of the transfer of molecular information between natural and synthetic materials in the realisation of biomedical devices with enhanced properties. J. Biomater. Sci. Polym. Ed. 2005, 16, 219–236. [Google Scholar] [CrossRef] [PubMed]
- Poma, A.; Brahmbhatt, H.; Pendergraff, H.M.; Watts, J.K.; Turner, N.W. Generation of novel hybrid aptamer-molecularly imprinted polymeric nanoparticles. Adv. Mater. 2015, 27, 750–758. [Google Scholar] [CrossRef]
- Odeh, F.; Nsairat, H.; Alshaer, W.; Ismail, M.A.; Esawi, E.; Qaqish, B.; Bawab, A.A.; Ismail, S.I. Aptamers chemistry: Chemical modifications and conjugation strategies. Molecules 2020, 25, 3. [Google Scholar] [CrossRef] [Green Version]
- Crapnell, R.D.; Hudson, A.; Foster, C.W.; Eersels, K.; van Grinsven, B.; Cleij, T.J.; Banks, C.E.; Peeters, M. Recent advances in electrosynthesized molecularly imprinted polymer sensing platforms for bioanalyte detection. Sensors 2019, 19, 1204. [Google Scholar] [CrossRef] [Green Version]
- Kamra, T.; Chaudhary, S.; Xu, C.; Johansson, N.; Montelius, L.; Schnadt, J.; Ye, L. Covalent immobilization of molecularly imprinted polymer nanoparticles using an epoxy silane. J. Colloid Interface Sci. 2015, 445, 277–284. [Google Scholar] [CrossRef] [Green Version]
- Smolinska-Kempisty, K.; Guerreiro, A.; Canfarotta, F.; Cáceres, C.; Whitcombe, M.J.; Piletsky, S. A comparison of the performance of molecularly imprinted polymer nanoparticles for small molecule targets and antibodies in the ELISA format. Sci. Rep. 2016, 6, 1–7. [Google Scholar] [CrossRef] [Green Version]
- Dong, J.; Li, H.; Yan, P.; Xu, L.; Zhang, J.; Qian, J.; Chen, J.; Li, H. A label-free photoelectrochemical aptasensor for tetracycline based on Au/BiOI composites. Inorg. Chem. Commun. 2019, 109, 107557. [Google Scholar] [CrossRef]
- Clarindo, J.E.S.; Viana, R.B.; Cervini, P.; Silva, A.B.F.; Cavalheiro, E.T.G. Determination of Tetracycline Using a Graphite-Polyurethane Composite Electrode Modified with a Molecularly Imprinted Polymer. Anal. Lett. 2020, 1–24. [Google Scholar] [CrossRef]
- Zhang, L.; Chen, L. Fluorescence Probe Based on Hybrid Mesoporous Silica/Quantum Dot/Molecularly Imprinted Polymer for Detection of Tetracycline. ACS Appl. Mater. Interfaces 2016, 8, 16248–16256. [Google Scholar] [CrossRef] [PubMed]
- Jalalian, S.H.; Taghdisi, S.M.; Danesh, N.M.; Bakhtiari, H.; Lavaee, P.; Ramezani, M.; Abnous, K. Sensitive and fast detection of tetracycline using an aptasensor. Anal. Methods 2015, 7, 2523–2528. [Google Scholar] [CrossRef]
- Jamieson, O.; Soares, T.C.C.; de Faria, B.A.; Hudson, A.; Mecozzi, F.; Rowley-Neale, S.J.; Banks, C.E.; Gruber, J.; Novakovic, K.; Peeters, M.; et al. Screen printed electrode based detection systems for the antibiotic amoxicillin in aqueous samples utilising molecularly imprinted polymers as synthetic receptors. Chemosensors 2020, 8, 5. [Google Scholar] [CrossRef] [Green Version]
- Youn, H.; Lee, K.; Her, J.; Jeon, J.; Mok, J.; So, J.I.; Shin, S.; Ban, C. Aptasensor for multiplex detection of antibiotics based on FRET strategy combined with aptamer/graphene oxide complex. Sci. Rep. 2019, 9, 1–9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Geng, Y.; Guo, M.; Tan, J.; Huang, S.; Tang, Y.; Tan, L.; Liang, Y. A fluorescent molecularly imprinted polymer using aptamer as a functional monomer for sensing of kanamycin. Sens. Actuators B Chem. 2018, 268, 47–54. [Google Scholar] [CrossRef]
- Székács, A.; Mörtl, M.; Darvas, B. Monitoring pesticide residues in surface and ground water in Hungary: Surveys in 1990-2015. J. Chem. 2015, 2015, 15. [Google Scholar] [CrossRef] [Green Version]
- Liu, M.; Khan, A.; Wang, Z.; Liu, Y.; Yang, G.; Deng, Y.; He, N. Aptasensors for pesticide detection. Biosens. Bioelectron. 2019, 130, 174–184. [Google Scholar] [CrossRef]
- Farooq, S.; Nie, J.; Cheng, Y.; Yan, Z.; Li, J.; Bacha, S.A.S.; Mushtaq, A.; Zhang, H. Molecularly imprinted polymers’ application in pesticide residue detection. Analyst 2018, 143, 3971–3989. [Google Scholar] [CrossRef]
- Weerathunge, P.; Behera, B.K.; Zihara, S.; Singh, M.; Prasad, S.N.; Hashmi, S.; Mariathomas, P.R.D.; Bansal, V.; Ramanathan, R. Dynamic interactions between peroxidase-mimic silver NanoZymes and chlorpyrifos-specific aptamers enable highly-specific pesticide sensing in river water. Anal. Chim. Acta 2019, 1083, 157–165. [Google Scholar] [CrossRef]
- Huang, W.; Zhou, X.; Luan, Y.; Cao, Y.; Wang, N.; Lu, Y.; Liu, T.; Xu, W. A sensitive electrochemical sensor modified with multi-walled carbon nanotubes doped molecularly imprinted silica nanospheres for detecting chlorpyrifos. J. Sep. Sci. 2020, 43, 954–961. [Google Scholar] [CrossRef]
- Us Epa, O. National primary drinking water regulations: Long Term 1 Enhanced Surface Water Treatment Rule. Final rule. Fed. Regist. 2002, 67, 1811–1844. [Google Scholar]
- Herschy, R.W. Water Quality for Drinking: WHO Guidelines; Springer: Berlin/Heidelberg, Germany, 2012; pp. 876–883. [Google Scholar]
- Huang, K.; Chen, Y.; Zhou, F.; Zhao, X.; Liu, J.; Mei, S.; Zhou, Y.; Jing, T. Integrated ion imprinted polymers-paper composites for selective and sensitive detection of Cd(II) ions. J. Hazard. Mater. 2017, 333, 137–143. [Google Scholar] [CrossRef] [PubMed]
- Zhou, B.; Yang, X.Y.; Wang, Y.S.; Yi, J.C.; Zeng, Z.; Zhang, H.; Chen, Y.T.; Hu, X.J.; Suo, Q.L. Label-free fluorescent aptasensor of Cd2+ detection based on the conformational switching of aptamer probe and SYBR green I. Microchem. J. 2019, 144, 377–382. [Google Scholar] [CrossRef]
- Liu, C.W.; Tsai, T.C.; Osawa, M.; Chang, H.C.; Yang, R.J. Aptamer-based sensor for quantitative detection of mercury (II) ions by attenuated total reflection surface enhanced infrared absorption spectroscopy. Anal. Chim. Acta 2018, 1033, 137–147. [Google Scholar] [CrossRef]
- Khoshbin, Z.; Housaindokht, M.R.; Izadyar, M.; Verdian, A.; Bozorgmehr, M.R. A simple paper-based aptasensor for ultrasensitive detection of lead (II)ion. Anal. Chim. Acta 2019, 1071, 70–77. [Google Scholar] [CrossRef]
- Xu, W.; Zhou, X.; Gao, J.; Xue, S.; Zhao, J. Label-free and enzyme-free strategy for sensitive electrochemical lead aptasensor by using metal-organic frameworks loaded with AgPt nanoparticles as signal probes and electrocatalytic enhancers. Electrochim. Acta 2017, 251, 25–31. [Google Scholar] [CrossRef]
- Diaz-Amaya, S.; Lin, L.K.; DiNino, R.E.; Ostos, C.; Stanciu, L.A. Inkjet printed electrochemical aptasensor for detection of Hg2+ in organic solvents. Electrochim. Acta 2019, 316, 33–42. [Google Scholar] [CrossRef]
- Wang, H.; Cheng, H.; Wang, J.; Xu, L.; Chen, H.; Pei, R. Selection and characterization of DNA aptamers for the development of light-up biosensor to detect Cd(II). Talanta 2016, 154, 498–503. [Google Scholar] [CrossRef]
- Zhang, B.; Wei, C. Highly sensitive and selective detection of Pb2+ using a turn-on fluorescent aptamer DNA silver nanoclusters sensor. Talanta 2018, 182, 125–130. [Google Scholar] [CrossRef]
- Pan, J.; Li, Q.; Zhou, D.; Chen, J. Ultrasensitive aptamer biosensor for arsenic (III) detection based on label-free triple-helix molecular switch and fluorescence sensing platform. Talanta 2018, 189, 370–376. [Google Scholar] [CrossRef]
- Gan, Y.; Liang, T.; Hu, Q.; Zhong, L.; Wang, X.; Wan, H.; Wang, P. In-situ detection of cadmium with aptamer functionalized gold nanoparticles based on smartphone-based colorimetric system. Talanta 2020, 208, 120231. [Google Scholar] [CrossRef]
- Liu, Y.; Cai, Z.; Sheng, L.; Ma, M.; Wang, X. A magnetic relaxation switching and visual dual-mode sensor for selective detection of Hg2+ based on aptamers modified Au@Fe3O4 nanoparticles. J. Hazard. Mater. 2019, 388, 121728. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Li, H.; Gao, T.; Zhang, T.; Xu, L.; Wang, B.; Wang, J.; Pei, R. Selection of DNA aptamers for the development of light-up biosensor to detect Pb(II). Sens. Actuators B Chem. 2018, 254, 214–221. [Google Scholar] [CrossRef]
- Sun, C.; Sun, R.; Chen, Y.; Tong, Y.; Zhu, J.; Bai, H.; Zhang, S.; Zheng, H.; Ye, H. Utilization of aptamer-functionalized magnetic beads for highly accurate fluorescent detection of mercury (II) in environment and food. Sens. Actuators B Chem. 2018, 255, 775–780. [Google Scholar] [CrossRef]
- Lu, Y.; Zhong, J.; Yao, G.; Huang, Q. A label-free SERS approach to quantitative and selective detection of mercury (II) based on DNA aptamer-modified SiO2@Au core/shell nanoparticles. Sens. Actuators B Chem. 2018, 258, 365–372. [Google Scholar] [CrossRef]
- Ouyang, H.; Ling, S.; Liang, A.; Jiang, Z. A facile aptamer-regulating gold nanoplasmonic SERS detection strategy for trace lead ions. Sens. Actuators B Chem. 2018, 258, 739–744. [Google Scholar] [CrossRef]
- Ma, L.H.; Wang, H.B.; Fang, B.Y.; Tan, F.; Cao, Y.C.; Zhao, Y. Di Visual detection of trace lead ion based on aptamer and silver staining nano-metal composite. Colloids Surf. B Biointerfaces 2018, 162, 415–419. [Google Scholar] [CrossRef]
- Gao, F.; Gao, C.; He, S.; Wang, Q.; Wu, A. Label-free electrochemical lead (II) aptasensor using thionine as the signaling molecule and graphene as signal-enhancing platform. Biosens. Bioelectron. 2016, 81, 15–22. [Google Scholar] [CrossRef]
- Zhang, C.; Lai, C.; Zeng, G.; Huang, D.; Tang, L.; Yang, C.; Zhou, Y.; Qin, L.; Cheng, M. Nanoporous Au-based chronocoulometric aptasensor for amplified detection of Pb2+ using DNAzyme modified with Au nanoparticles. Biosens. Bioelectron. 2016, 81, 61–67. [Google Scholar] [CrossRef]
- Wei, P.; Zhu, Z.; Song, R.; Li, Z.; Chen, C. An ion-imprinted sensor based on chitosan-graphene oxide composite polymer modified glassy carbon electrode for environmental sensing application. Electrochim. Acta 2019, 317, 93–101. [Google Scholar] [CrossRef]
- Khoddami, N.; Shemirani, F. A new magnetic ion-imprinted polymer as a highly selective sorbent for determination of cobalt in biological and environmental samples. Talanta 2016, 146, 244–252. [Google Scholar] [CrossRef] [PubMed]
- Ghanei-Motlagh, M.; Taher, M.A.; Heydari, A.; Ghanei-Motlagh, R.; Gupta, V.K. A novel voltammetric sensor for sensitive detection of mercury(II) ions using glassy carbon electrode modified with graphene-based ion imprinted polymer. Mater. Sci. Eng. C 2016, 63, 367–375. [Google Scholar] [CrossRef] [PubMed]
- Shirzadmehr, A.; Afkhami, A.; Madrakian, T. A new nano-composite potentiometric sensor containing an Hg2+-ion imprinted polymer for the trace determination of mercury ions in different matrices. J. Mol. Liq. 2015, 204, 227–235. [Google Scholar] [CrossRef]
- Torkashvand, M.; Gholivand, M.B.; Azizi, R. Synthesis, characterization and application of a novel ion-imprinted polymer based voltammetric sensor for selective extraction and trace determination of cobalt (II) ions. Sens. Actuators B Chem. 2017, 243, 283–291. [Google Scholar] [CrossRef]
- Hande, P.E.; Samui, A.B.; Kulkarni, P.S. Selective nanomolar detection of mercury using coumarin based fluorescent Hg(II)—Ion imprinted polymer. Sens. Actuators B Chem. 2017, 246, 597–605. [Google Scholar] [CrossRef]
- Qi, J.; Li, B.; Wang, X.; Zhang, Z.; Wang, Z.; Han, J.; Chen, L. Three-dimensional paper-based microfluidic chip device for multiplexed fluorescence detection of Cu2+ and Hg2+ ions based on ion imprinting technology. Sens. Actuators B Chem. 2017, 251, 224–233. [Google Scholar] [CrossRef]
- Dahaghin, Z.; Kilmartin, P.A.; Mousavi, H.Z. Novel ion imprinted polymer electrochemical sensor for the selective detection of lead(II). Food Chem. 2020, 303, 125374. [Google Scholar] [CrossRef]
- Lu, H.; Yu, C.; Xu, S. A dual reference ion-imprinted ratiometric fluorescence probe for simultaneous detection of silver (I) and lead (II). Sens. Actuators B Chem. 2019, 288, 691–698. [Google Scholar] [CrossRef]
- Johnson, F.M. The genetic effects of environmental lead. Mutat. Res. Rev. Mutat. Res. 1998, 410, 123–140. [Google Scholar] [CrossRef]
- Arugula, M.A.; Simonian, A. Novel trends in affinity biosensors: Current challenges and perspectives. Meas. Sci. Technol. 2014, 25, 032001. [Google Scholar] [CrossRef]
- Skottrup, P.D.; Nicolaisen, M.; Justesen, A.F. Towards on-site pathogen detection using antibody-based sensors. Biosens. Bioelectron. 2008, 24, 339–348. [Google Scholar] [CrossRef]
- Parra, E.; Segura, F.; Tijero, J.; Pons, I.; Nogueras, M.M. Development of a real-time PCR for Bartonella spp. detection, a current emerging microorganism. Mol. Cell. Probes 2017, 32, 55–59. [Google Scholar] [CrossRef] [PubMed]
- Cui, F.; Zhou, Z.; Zhou, H.S. Molecularly imprinted polymers and surface imprinted polymers based electrochemical biosensor for infectious diseases. Sensors 2020, 20, 996. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Srivastava, K.R.; Awasthi, S.; Mishra, P.K.; Srivastava, P.K. Biosensors/Molecular Tools for Detection of Waterborne Pathogens; Elsevier: Amsterdam, The Netherlands, 2020; ISBN 9780128187838. [Google Scholar]
- Yadav, G.S.; Kumar, V.; Aggarwal, N.K. (Eds.) Aptamers; Springer: Singapore, 2019; ISBN 978-981-13-8835-4. [Google Scholar]
- Bintsis, T. Foodborne pathogens. AIMS Microbiol. 2017, 3, 529–563. [Google Scholar] [CrossRef]
- Craun, M.F.; Craun, G.F.; Calderon, R.L.; Beach, M.J. Waterborne outbreaks reported in the United States. J. Water Health 2006, 4, 19–30. [Google Scholar] [CrossRef]
- Scallan, E.; Hoekstra, R.M.; Angulo, F.J.; Tauxe, R.V.; Widdowson, M.A.; Roy, S.L.; Jones, J.L.; Griffin, P.M. Foodborne illness acquired in the United States-Major pathogens. Emerg. Infect. Dis. 2011, 17, 7–15. [Google Scholar] [CrossRef]
- Gawlitza, K.; Wan, W.; Wagner, S.; Rurack, K. Fluorescent Molecularly Imprinted Polymers. Adv. Mol. Impr. Mater. 2016, 89–128. [Google Scholar]
- Spieker, E.; Lieberzeit, P.A. Molecular Imprinting Studies for Developing QCM-sensors for Bacillus Cereus. Procedia Eng. 2016, 168, 561–564. [Google Scholar] [CrossRef]
- Ikanovic, M.; Rudzinski, W.E.; Bruno, J.G.; Allman, A.; Carrillo, M.P.; Dwarakanath, S.; Bhahdigadi, S.; Rao, P.; Kiel, J.L.; Andrews, C.J. Fluorescence Assay Based on Aptamer-Quantum Dot Binding to Bacillus thuringiensis Spores. J. Fluoresc. 2007, 17, 193–199. [Google Scholar] [CrossRef]
- Poller, A.-M.; Spieker, E.; Lieberzeit, P.A.; Preininger, C. Surface Imprints: Advantageous Application of Ready2use Materials for Bacterial Quartz-Crystal Microbalance Sensors. ACS Appl. Mater. Interfaces 2017, 9, 1129–1135. [Google Scholar] [CrossRef]
- Li, H.; Ahmad, W.; Rong, Y.; Chen, Q.; Zuo, M.; Ouyang, Q.; Guo, Z. Designing an aptamer based magnetic and upconversion nanoparticles conjugated fluorescence sensor for screening Escherichia coli in food. Food Control 2020, 107, 106761. [Google Scholar] [CrossRef]
- Choi, J.R.; Yong, K.W.; Choi, J.Y.; Cowie, A.C. Progress in molecularly imprinted polymers for biomedical applications. Comb. Chem. High Throughput Screen. 2019, 22, 78–88. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Chen, X.; Zhang, L.; Gao, J.; Ma, Q. Electrochemiluminescence Detection of Escherichia coli O157:H7 Based on a Novel Polydopamine Surface Imprinted Polymer Biosensor. ACS Appl. Mater. Interfaces 2017, 9, 5430–5436. [Google Scholar] [CrossRef] [PubMed]
- Hua, R.; Hao, N.; Lu, J.; Qian, J.; Liu, Q.; Li, H.; Wang, K. A sensitive Potentiometric resolved ratiometric Photoelectrochemical aptasensor for Escherichia coli detection fabricated with non-metallic nanomaterials. Biosens. Bioelectron. 2018, 106, 57–63. [Google Scholar] [CrossRef]
- Piletsky, S.; Canfarotta, F.; Poma, A.; Bossi, A.M.; Piletsky, S. Molecularly Imprinted Polymers for Cell Recognition. Trends Biotechnol. 2020, 38, 368–387. [Google Scholar] [CrossRef]
- Saylan, Y.; Erdem, Ö.; Cihangir, N.; Denizli, A. Denizli Detecting Fingerprints of Waterborne Bacteria on a Sensor. Chemosensors 2019, 7, 33. [Google Scholar] [CrossRef] [Green Version]
- Gall, A.M.; Mariñas, B.J.; Lu, Y.; Shisler, J.L. Waterborne Viruses: A Barrier to Safe Drinking Water. PLoS Pathog. 2015, 11, 1–7. [Google Scholar] [CrossRef]
- Zou, X.; Wu, J.; Gu, J.; Shen, L.; Mao, L. Application of Aptamers in Virus Detection and Antiviral Therapy. Front. Microbiol. 2019, 10, 1462. [Google Scholar] [CrossRef] [Green Version]
- Glass, R.I.; Parashar, U.D.; Estes, M.K. Norovirus gastroenteritis. N. Engl. J. Med. 2009, 361, 1776–1785. [Google Scholar] [CrossRef] [Green Version]
- Altintas, Z.; Gittens, M.; Guerreiro, A.; Thompson, K.A.; Walker, J.; Piletsky, S.; Tothill, I.E. Detection of Waterborne Viruses Using High Affinity Molecularly Imprinted Polymers. Anal. Chem. 2015, 87, 6801–6807. [Google Scholar] [CrossRef]
- Zhang, F.; Luo, L.; Gong, H.; Chen, C.; Cai, C. A magnetic molecularly imprinted optical chemical sensor for specific recognition of trace quantities of virus. RSC Adv. 2018, 8, 32262–32268. [Google Scholar] [CrossRef] [Green Version]
- Giamberardino, A.; Labib, M.; Hassan, E.M.; Tetro, J.A.; Springthorpe, S.; Sattar, S.A.; Berezovski, M.V.; DeRosa, M.C. Ultrasensitive norovirus detection using DNA aptasensor technology. PLoS ONE 2013, 8, 1–9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Escudero-Abarca, B.I.; Suh, S.H.; Moore, M.D.; Dwivedi, H.P.; Jaykus, L.A. Selection, characterization and application of nucleic acid aptamers for the capture and detection of human norovirus strains. PLoS ONE 2014, 9, e106805. [Google Scholar]
- Kim, B.; Chung, K.W.; Lee, J.H. Non-stop aptasensor capable of rapidly monitoring norovirus in a sample. J. Pharm. Biomed. Anal. 2018, 152, 315–321. [Google Scholar] [CrossRef]
Antibodies | MIPs | Aptamers |
---|---|---|
Methods for Development | ||
Immune response in animal host:
| Molecular imprinting:
| SELEX:
|
Production | ||
Immune Response in Animals:
| Molecular Imprinting:
| Solid-phase synthesis:
|
Properties | ||
Binding Affinity:
| Binding Affinity:
| Binding Affinity:
|
Aptasensor | Analyte | Detection Method | Linear Range μg L−1 | LOD μg L−1 | Ref. |
---|---|---|---|---|---|
5′-GGGAGGGAACTGTTGTGGTATTATTTTTGGTTGTGCAGTAGGGCGGG-3′ | Cd2+ | Fluorescence | 0.112 × 101–0.224 × 103 | 0.34 | [65] |
5′-HS-(CH2)6-TTTCTTCTTTCTTCCCCCCTTGTTTGTTT-Methylene Blue-3′ | Hg2+ | ATR-SEIRAS | 0.1 × 102–0.5 × 105 * | 0.1 × 102 * | [66] |
5′-FAM-GGGTGGGTGGGTGGGT-3′ | Pb2+ | FRET | 0.5 × 10−2–0.2 × 102 * | 0.5 × 10−3 * | [67] |
5′-GGGTGGGTGGGTGGGT-(CH2)6-NH2-3′ | Pb2+ | DPV | 0.1 × 10−3–0.1 × 103 * | 0.32 × 10−4 * | [68] |
[5′ThioMC6-D/TT TCT TCT TTC TTC CCC CCT TGT TTG TTT 3′] | Hg2+ | PEIS | 0.5 × 101–0.1 × 106 (water) 0.5 × 101–0.1 × 103(DMSO) | 0.1 × 102 (water) 0.5 × 101 (DMSO) | [69] |
2is5′-FAM-CTCAGGACGACGGGTTCA-CAGTCCGTTGTC-3′ | Cd2+ | Fluorescence | - | 0.4 × 102 * | [70] |
C-PS2.M: CCCTTAATCCCCTTTGTGGGTAGGGCGGGTTGGAAACCCTTAATCCCC | Cd2+ | Fluorescence | 0.5 × 101–0.5 × 102 | 0.3 × 101 * | [71] |
HP1:5′-TCTCCGCCGAGAGAGAGATCCAATCACAACTCTCTCTCTCGCCGTCTCTC-3′ | As3+ | Fluorescence | 0.1 × 10−3–0.1 × 105 | 0.5 × 10-2 | [72] |
5’-ACCGACCGTGCTGGACTCTGGACTGTTGTGG | Cd2+ | Colorimetric | 0.2 × 101–0.2 × 102 | 0.112 × 101 | [63] |
5′-SH C6-CGGCTTTTGTTTT-3′ | Hg2+ | MRS | 0.1 × 102–0.5 × 104 * | 0.27 × 101 * | [73] |
5´-FAM-CTCAGTCGACGACGGCCAGTAGCTGACATCAGTGTACGATCTAG-TCGTCGA | Pb2+ | Fluorescence | 0.1 × 103–0.1 × 104 * | 0.607 × 102 * | [74] |
5´-Biotin-TTCTTTCTTCTTTC-3´ | Hg2+ | Fluorescence | 0.2 × 101–0.160 × 103 * | 0.2 * | [75] |
HS-(CH2)6-TTTTTTTTTTGGGGGGGGAAAAAAAA | Hg2+ | SERS | 0.1 × 102–0.1 × 107 * | - | [76] |
5´-GGTTGGTGTGGTGGTTGGT-GTTGG-3´ | Pb2+ | SERS | 0.13–0.5333 × 102 * | 0.07 * | [77] |
5´-NH2-C6-GTGGGTAGGGCGGGTTGG-3´ | Pb2+ | Optical | 0.5 × 103–0.1 × 105 * | - | [78] |
5′-GGGTGGGTGGGTGGGT-C6-SH-3′ | Pb2+ | DPV | 0.16 × 10−3–0.16 * | 0.32 × 10−4 * | [79] |
5′-SH-(CH2)6-TTTCATCTCTTCTCCGAGCCGGTCGAAATAGTGAGT-3′ | Pb2+ | Chronocoulometric | 0.5 × 10−1–0.1 × 103 * | 0.12 × 10−1 * | [80] |
Functional Monomer | Cross Linker | Analyte | Detection Method | Linear Range μg L−1 | LOD μg L−1 | Ref. |
---|---|---|---|---|---|---|
Chitosan | Epichlorohydrin | Cu2+ | DPASV | 0.5 × 103–0.1 × 106 * | 0.15 × 103 * | [81] |
3-(2-aminoethylamino) propyltrimethoxysilane | and tetra-ethylorthosilicate | Co2+ | FAAS | 0.1 × 101–0.13 × 103 | 0.15 | [82] |
methacrylic acid | ethylene glycol dimethacrylate | Hg2+ | SWASV | 0.7 × 10−1–0.8 × 102 | 0.2 × 10−1 | [83] |
methacrylic acid | ethylene glycol dimethacrylate | Hg2+ | Potentiometry | 0.4 × 101–0.13 × 107 * | 0.195 × 101 * | [84] |
polyethylenimine and methacrylic acid | ethylene glycol dimethacrylate | Cd2+ | Colorimetric | 0.1 × 101–0.1 × 103 | 0.4 | [63] |
acryl amide | N,N methylenebisacryl amide | Co2+ | CSDPV | 0.5–0.5 × 103 * | 0.1 * | [85] |
N-[4-(2-Oxo-2H-chromen-3-yl)-thiazol-2-yl]-acrylamide | ethylene glycol dimethacrylate | Hg2+ | Fluorescence | 0.5 × 10−1–0.12 × 101 | 0.2 × 10−1 | [86] |
3-Aminopropyltriethoxysilane | tetramethoxysilane | Cu2+ Hg2+ | Fluorescence | 0.11–0.58 × 102 (Cu2+)0.26–0.34 × 102 (Hg2+) | 0.35 × 10−1 (Cu2+)0.56 × 10−1 (Hg2+) | [87] |
4-vinyl pyridine | ethylene glycoldimethylacrylate | Pb2+ | DPV | 0.1–0.8 × 102 | 0.5 × 10−1 | [88] |
cetyltrimethylammonium bromide | tetraethylorthosilicate | Pb2+Ag+ | Fluorescence | 0.5 × 102- 0.9 × 103 * (Pb2+)0.2 × 103–0.125 × 105(Ag+) | 0.26 × 102 * (Pb2+)0.86 × 102 *(Ag+) | [89] |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Naseri, M.; Mohammadniaei, M.; Sun, Y.; Ashley, J. The Use of Aptamers and Molecularly Imprinted Polymers in Biosensors for Environmental Monitoring: A Tale of Two Receptors. Chemosensors 2020, 8, 32. https://doi.org/10.3390/chemosensors8020032
Naseri M, Mohammadniaei M, Sun Y, Ashley J. The Use of Aptamers and Molecularly Imprinted Polymers in Biosensors for Environmental Monitoring: A Tale of Two Receptors. Chemosensors. 2020; 8(2):32. https://doi.org/10.3390/chemosensors8020032
Chicago/Turabian StyleNaseri, Maryam, Mohsen Mohammadniaei, Yi Sun, and Jon Ashley. 2020. "The Use of Aptamers and Molecularly Imprinted Polymers in Biosensors for Environmental Monitoring: A Tale of Two Receptors" Chemosensors 8, no. 2: 32. https://doi.org/10.3390/chemosensors8020032
APA StyleNaseri, M., Mohammadniaei, M., Sun, Y., & Ashley, J. (2020). The Use of Aptamers and Molecularly Imprinted Polymers in Biosensors for Environmental Monitoring: A Tale of Two Receptors. Chemosensors, 8(2), 32. https://doi.org/10.3390/chemosensors8020032