Molecular Mapping of QTLs Conferring Fusarium Head Blight Resistance in Chinese Wheat Cultivar Jingzhou 66
Abstract
:1. Introduction
2. Results
2.1. FHB Phenotypic Variation and Traitcorrelations
2.2. Linkage Map Construction
2.3. QTL for FHB Resistance
2.4. Effects of QTL on FHB Response
2.5. QTL for Plant Height and Spike Compactness
2.6. Development of PCR-Based Single-Nucleotide Polymorphism (SNP) Markers
3. Discussion
3.1. FHB Assessment and Traitcorrelations
3.2. Novelty of Mapped QTL for FHB Resistance
3.3. Coincidence of QTL for FHB Response and Other Traits
3.4. Perspectives on Breeding for FHB Resistance
4. Materials and Methods
4.1. Plant Materials
4.2. Evaluation of FHB Reaction and Measurement of Agronomic Traits
4.3. Statistical Analysis
4.4. Genotyping
4.5. Genetic Map Construction
4.6. QTL Analysis
4.7. PCR-Based SNP Marker Development
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Bai, G.; Shaner, G. Management and resistance in wheat and barley to Fusarium head blight. Annu. Rev. Phytopathol. 2003, 42, 135–161. [Google Scholar] [CrossRef] [PubMed]
- Steiner, B.; Buerstmayr, H.; Michel, S.; Schweiger, W.; Lemmens, M. Breeding strategies and advances in line selection for Fusarium head blight resistance in wheat. Trop. Plant. Pathol. 2017, 42, 165–174. [Google Scholar] [CrossRef] [Green Version]
- Buerstmayr, H.; Ban, T.; Anderson, J.A. QTL mapping and marker-assisted selection forFusariumhead blight resistance in wheat: A review. Plant. Breed. 2009, 128, 1–26. [Google Scholar] [CrossRef]
- Ma, Z.; Xie, Q.; Li, G.; Jia, H.; Zhou, J.; Kong, Z.; Li, N.; Yuan, Y. Germplasms, genetics and genomics for better control of disastrous wheat Fusarium head blight. Theor. Appl. Genet. 2020, 133, 1541–1568. [Google Scholar] [CrossRef] [PubMed]
- Mcmullen, M.; Bergstrom, G.C.; De Wolf, E.D.; Dillmacky, R.; Hershman, D.E.; Shaner, G.; Van Sanford, D. A unified t effort to fight an enemy of wheat and barley: Fusarium head blight. Plant Dis. 2012, 96, 1712–1728. [Google Scholar] [CrossRef] [Green Version]
- Lin, F.; Kong, Z.X.; Zhu, H.L.; Xue, S.L.; Wu, J.Z.; Tian, D.G.; Wei, J.B.; Zhang, C.; Ma, Z.Q. Mapping QTL associated with resistance to Fusarium head blight in the Nanda 2419 x Wangshuibai population. I. Type II resistance. Theor. Appl. Genet. 2004, 109, 1504–1511. [Google Scholar] [CrossRef]
- Anderson, J.A.; Stack, R.W.; Liu, S.; Waldron, B.L.; Fjeld, A.D.; Coyne, C.; Moreno-Sevilla, B.; Fetch, J.M.; Song, Q.J.; Cregan, P.B.; et al. DNA markers for Fusarium head blight resistance QTLs in two wheat populations. Theor. Appl. Genet. 2001, 102, 1164–1168. [Google Scholar] [CrossRef]
- Yang, J.; Bai, G.; Shaner, G.E. Novel quantitative trait loci (QTL) for Fusarium head blight resistance in wheat cultivar Chokwang. Theor. Appl. Genet. 2005, 111, 1571–1579. [Google Scholar] [CrossRef]
- Liu, S.; Abate, Z.A.; Lu, H.; Musket, T.; Davis, G.L.; McKendry, A. QTL associated with Fusarium head blight resistance in the soft red winter wheat Ernie. Theor. Appl. Genet. 2007, 115, 417–427. [Google Scholar] [CrossRef]
- Steiner, B.; Lemmens, M.; Griesser, M.; Scholz, U.; Schondelmaier, J.; Buerstmayr, H. Molecular mapping of resistance to Fusarium head blight in the spring wheat cultivar Frontana. Theor. Appl. Genet. 2004, 109, 215–224. [Google Scholar] [CrossRef]
- Paillard, S.; Schnurbusch, T.; Tiwari, R.; Messmer, M.; Winzeler, M.; Keller, B.; Schachermayr, G. QTL analysis of resistance to Fusarium head blight in Swiss winter wheat (Triticum aestivum L.). Theor. Appl. Genet. 2004, 109, 323–332. [Google Scholar] [CrossRef] [PubMed]
- Buerstmayr, H. Breeding for resistance to head blight caused by Fusarium spp. in wheat. CAB Rev. Perspect. Agric. Veter. Sci. Nutr. Nat. Resour. 2014, 9. [Google Scholar] [CrossRef]
- Venske, E.; Dos Santos, R.S.; Farias, D.D.R.; Rother, V.; da Maia, L.C.; Pegoraro, C.; De Costa Oliveira, A. Meta-Analysis analysis of the QTLome of Fusarium head blight resistance in bread wheat: Refining the current puzzle. Front. Plant Sci. 2019, 10, 727. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jia, H.; Zhou, J.; Xue, S.; Li, G.; Yan, H.; Ran, C.; Zhang, Y.; Shi, J.; Jia, L.; Wang, X.; et al. A journey to understand wheat Fusarium head blight resistance in the Chinese wheat landrace Wangshuibai. Crop. J. 2018, 6, 48–59. [Google Scholar] [CrossRef]
- Miedaner, T.; Wilde, F.; Steiner, B.; Buerstmayr, H.; Korzun, V.; Ebmeyer, E. Stacking quantitative trait loci (QTL) for Fusarium head blight resistance from non-adapted sources in an European elite spring wheat background and assessing their effects on deoxynivalenol (DON) content and disease severity. Theor. Appl. Genet. 2005, 112, 562–569. [Google Scholar] [CrossRef]
- Pumphrey, M.; Bernardo, R.; Anderson, J.A. Validating the Fhb1 QTL for Fusarium head blight resistance in near-isogenic wheat lines developed from breeding populations. Crop. Sci. 2007, 47, 200–206. [Google Scholar] [CrossRef]
- Bernardo, A.; Bai, G.; Yu, J.; Kolb, F.; Bockus, W.; Dong, Y. Registration of near-isogenic winter wheat germplasm contrasting in Fhb1 for Fusarium head blight resistance. J. Plant. Regist. 2013, 8, 106–108. [Google Scholar] [CrossRef]
- Li, G.; Zhou, J.; Jia, H.; Gao, Z.; Fan, M.; Luo, Y.; Zhao, P.; Xue, S.; Li, N.; Yuan, Y.; et al. Mutation of a histidine-rich calcium-binding-protein gene in wheat confers resistance to Fusarium head blight. Nat. Genet. 2019, 51, 1106–1112. [Google Scholar] [CrossRef]
- Su, Z.; Bernardo, A.; Tian, B.; Chen, H.; Wang, S.; Ma, H.; Cai, S.; Liu, D.; Zhang, D.; Li, T.; et al. A deletion mutation in TaHRC confers Fhb1 resistance to Fusarium head blight in wheat. Nat. Genet. 2019, 51, 1099–1105. [Google Scholar] [CrossRef]
- Su, Z.; Jin, S.; Zhang, D.; Bai, G. Development and validation of diagnostic markers for Fhb1 region, a major QTL for Fusarium head blight resistance in wheat. Theor. Appl. Genet. 2018, 131, 2371–2380. [Google Scholar] [CrossRef]
- Brar, G.S.; Brûlé-Babel, A.L.; Ruan, Y.; Henriquez, M.A.; Pozniak, C.J.; Kutcher, H.R.; Hucl, P. Genetic factors affecting Fusarium head blight resistance improvement from introgression of exotic Sumai 3 alleles (including Fhb1, Fhb2, and Fhb5) in hard red spring wheat. BMC Plant. Biol. 2019, 19, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Z.W.; Xu, D.A.; Cheng, S.H.; Gao, C.B.; Xia, X.C.; Hao, Y.F.; He, Z.H. Characterization of Fusarium head blight resistance gene fhb1 and its putative ancestor in chinese wheat germplasm. Acta Agron. Sin. 2018, 44, 473–482. [Google Scholar] [CrossRef]
- Hu, X.; Rocheleau, H.; Mccartney, C.A.; Biselli, C.; Bagnaresi, P.; Balcerzak, M.; Ouellet, T. Identification and mapping of expressed genes associated with the 2DL QTL for fusarium Fusarium head blight resistance in the wheat line Wuhan. BMC Genet. 2019, 20, 1. [Google Scholar]
- Xu, D.H.; Juan, H.F.; Nohda, M.; Ban, T. QTLs mapping of Type I and Type II resistance to FHB in wheat. In Proceedings of the 2001 National Fusarium Head Blight Forum, Erlanger, KY, USA, 8–10 December 2001; p. 40. [Google Scholar]
- Shen, X.; Zhou, M.; Lu, W.; Ohm, H. Detection of Fusarium head blight resistance QTL in a wheat population using bulked segregant analysis. Theor. Appl. Genet. 2003, 106, 1041–1047. [Google Scholar] [CrossRef] [PubMed]
- Handa, H.; Namiki, N.; Xu, N.; Ban, T. Dissecting of the FHB resistance QTL on the short arm of wheat chromosome 2D using a comparative genomic approach: From QTL to candidate gene. Mol. Breed. 2008, 22, 71–84. [Google Scholar] [CrossRef]
- Cai, J.; Bai, G. Quantitative trait loci for Fusarium head blight resistance in Huangcandou × ‘Jagger’ wheat P population. Crop Sci. 2014, 54, 2520–2528. [Google Scholar] [CrossRef]
- Basnet, B.R.; Glover, K.D.; Ibrahim, A.M.; Yen, Y.; Chao, S. A QTL on chromosome 2DS of ‘Sumai 3′ increases susceptibility to Fusarium head blight in wheat. Euphytica 2012, 186, 91–101. [Google Scholar] [CrossRef]
- Bai, G.; Das, M.K.; Carver, B.F.; Xu, X.; Krenzer, E.G. Covariation for microsatellite marker alleles associated with Rht 8 and coleoptile length in winter wheat. Crop. Sci. 2004, 44, 1187–1194. [Google Scholar] [CrossRef]
- Korzun, V.; Röder, M.S.; Ganal, M.W.; Worland, A.J.; Law, C.N. Genetic analysis of the dwarfing gene (Rht8) in wheat. Part I. Molecular mapping of Rht8 on the short arm of chromosome 2D of bread wheat (Triticum aestivum L.). Theor. Appl. Genet. 1998, 96, 1104–1109. [Google Scholar] [CrossRef]
- Lv, C.; Song, Y.; Gao, L.; Yao, Q.; Zhou, R.; Xu, R.; Jia, J. Integration of QTL detection and marker assisted selection for improving resistance to Fusarium head blight and important agronomic traits in wheat. Crop. J. 2014, 2, 70–78. [Google Scholar] [CrossRef] [Green Version]
- Draeger, R.; Gosman, N.; Steed, A.; Chandler, E.; Thomsett, M.; Srinivasachary; Schondelmaier, J.; Buerstmayr, H.; Lemmens, M.; Schmolke, M.; et al. Identification of QTLs for resistance to Fusarium head blight, DON accumulation and associated traits in the winter wheat variety Arina. Theor. Appl. Genet. 2007, 115, 617–625. [Google Scholar] [CrossRef] [PubMed]
- Srinivasachary; Gosman, N.; Steed, A.; Simmonds, J.; Leverington-Waite, M.; Wang, Y.; Snape, J.W.; Nicholson, P. Susceptibility to Fusarium head blight is associated with the Rht-D1b semi-dwarfing allele in wheat. Theor. Appl. Genet. 2008, 116, 1145–1153. [Google Scholar] [CrossRef] [PubMed]
- Voss, H.H.; Holzapfel, J.; Hartl, L.; Korzun, V.; Rabenstein, F.; Ebmeyer, E.; Coester, H.; Kempf, H.; Miedaner, T. Effect of theRht-D1dwarfing locus onFusariumhead blight rating in three segregating populations of winter wheat. Plant. Breed. 2008, 127, 333–339. [Google Scholar] [CrossRef]
- Mardi, M.; Pazouki, L.; Delavar, H.; Kazemi, M.B.; Ghareyazie, B.; Steiner, B.; Nolz, R.; Lemmens, M.; Buerstmayr, H. QTL analysis of resistance to Fusarium head blight in wheat using a ’Frontana’-derived population. Plant. Breed. 2006, 125, 313–317. [Google Scholar] [CrossRef]
- Yu, J.B.; Bai, G.; Zhou, W.C.; Dong, Y.; Kolb, F.L. Quantitative trait loci for Fusarium head blight resistance in a recombinant inbred population of Wangshuibai/Wheaton. Phytopathology 2008, 98, 87–94. [Google Scholar] [CrossRef] [Green Version]
- Cativelli, M.; Lewis, S.; Appendino, M.L. A Fusarium head blight resistance quantitative trait locus on chromosome 7D of the spring wheat cultivar catbird. Crop. Sci. 2013, 53, 1464–1471. [Google Scholar] [CrossRef]
- Liu, S.; Griffey, C.A.; Hall, M.D.; McKendry, A.L.; Chen, J.; Brooks, W.S.; Brown-Guedira, G.; Van Sanford, D.; Schmale, D.G. Molecular characterization of field resistance to Fusarium head blight in two US soft red winter wheat cultivars. Theor. Appl. Genet. 2013, 126, 2485–2498. [Google Scholar] [CrossRef] [Green Version]
- Botwright, T.L.; Rebetzke, G.J.; Condon, A.G.; Richards, R.A. Influence of the Gibberellin-sensitive Rht8 dwarfing gene on Leaf leaf Epidermal epidermal cell dimensions and early vigour in wheat (Triticum aestivum L.). Ann. Bot. 2005, 95, 631–639. [Google Scholar] [CrossRef]
- Zhou, Y.; He, H.Z.; Zhang, G.S.; Xia, L.Q.; Chen, X.M.; Zhang, L.P.; Chen, F. Identification of dwarfing gene Rht8 in Chinese wheat cultivars using microsatellite markers. Acta Agron. Sin. 2003, 29, 810–814. [Google Scholar]
- Zhang, X.; Yang, S.; Zhou, Y.; He, Z.; Xia, X. Distribution of the Rht-B1b, Rht-D1b and Rht8 reduced height genes in autumn-sown Chinese wheats detected by molecular markers. Euphytica 2006, 152, 109–116. [Google Scholar] [CrossRef]
- Cheng, S.H.; Zhang, Y.; Zhang, B.Q.; Gao, D.R.; Wu, H.Y.; Lu, C.B.; Lyu, G.F.; Wang, C.S. Discussion of two ways of breeding scab resistance in wheat. J. Yangzhou Univ. (Agric. Life Sci. Edn.) 2003, 24, 59–62, (In Chinese with English Abstract). [Google Scholar]
- Ma, H.; Zhang, X.; Yao, J.; Cheng, S. Breeding for the resistance to Fusarium head blight of wheat in China. Front. Agric. Sci. Eng. 2019, 6, 251–264. [Google Scholar] [CrossRef] [Green Version]
- Jiang, P.; Zhang, X.; Wu, L.; He, Y.; Zhuang, W.; Cheng, X.; Ge, W.; Ma, H.; Kong, L. A novel QTL on chromosome 5AL of Yangmai 158 increases resistance to Fusarium head blight in wheat. Plant. Pathol. 2019, 69, 249–258. [Google Scholar] [CrossRef]
- Zhu, Z.; Chen, L.; Zhang, W.; Yang, L.; Zhu, W.; Li, J.; Liu, Y.; Tong, H.; Fu, L.; Liu, J.; et al. Genome-Wide association analysis of Fusarium head blight resistance in Chinese elite wheat lines. Front. Plant Sci. 2020, 11, 206. [Google Scholar] [CrossRef] [Green Version]
- Knapp, S.J.; Stroup, W.W.; Ross, W.M. Exact confidence intervals for heritability on a progeny mean basis. Crop Sci. 1985, 25, 192–194. [Google Scholar] [CrossRef]
- Liu, J.; Luo, W.; Qin, N.; Ding, P.; Zhang, H.; Yang, C.; Mu, Y.; Tang, H.; Liu, Y.; Li, W.; et al. A 55 K SNP array-based genetic map and its utilization in QTL mapping for productive tiller number in common wheat. Theor. Appl. Genet. 2018, 131, 2439–2450. [Google Scholar] [CrossRef]
- Meng, L.; Li, H.; Zhang, L.; Wang, J. QTL Ici Mapping—Integrated software for genetic linkage map construction and quantitative trait locus mapping in biparental populations. Crop J. 2015, 3, 269–283. [Google Scholar] [CrossRef] [Green Version]
- Ooijen Van, J.W. Joinmap®4, Software for the Calculation of Genetic Linkage Maps in Experimental Populations; Kyazma BV: Wageningen, The Netherlands, 2006. [Google Scholar]
- Li, H.; Ye, G.; Wang, J. A Modified algorithm for the improvement of composite interval mapping. Genetics 2006, 175, 361–374. [Google Scholar] [CrossRef] [Green Version]
- Voorrips, R.E. MapChart: Software for the graphical presentation of linkage maps and QTLs. J. Hered. 2002, 93, 77–78. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.K. Inclusive composite interval mapping of quantitative trait genes. Acta Agron. Sin. 2009, 35, 239–245. [Google Scholar] [CrossRef] [Green Version]
- Lu, J.; Hou, J.; Ouyang, Y.; Luo, H.; Zhao, J.; Mao, C.; Han, M.; Wang, L.; Xiao, J.; Yang, Y.; et al. A direct PCR–based SNP marker–assisted selection system (D-MAS) for different crops. Mol. Breed. 2020, 40, 1–10. [Google Scholar] [CrossRef]
Environment a | Parents | DH Population | |||||||
---|---|---|---|---|---|---|---|---|---|
JZ66 | AK58 | Max | Min | Mean | SD b | CV c | Skewness | Kurtosis | |
2019WH | 19.3 | 68.2 | 81.1 | 9.5 | 47.8 | 19.3 | 40.3 | −0.12 | −1.1 |
2019EZ | 4.9 | 23.6 | 54.3 | 5.4 | 21.1 | 10.3 | 48.7 | 0.7 | 0.1 |
2019JZ | 4.4 | 36.6 | 66.8 | 1.9 | 18.1 | 12.3 | 67.9 | 1.1 | 1.3 |
2018WH | 10.4 | 30.1 | 69.0 | 3.3 | 20.7 | 15.1 | 72.7 | 1.1 | 0.2 |
2018EZ | 3.4 | 21.7 | 55.2 | 0.3 | 8.8 | 10.2 | 116.8 | 1.9 | 3.7 |
Source of Variation | Df a | Mean Square | F Test | p Value | h2b |
---|---|---|---|---|---|
Environments | 4 | 92,764.23 | 799.83 | <0.001 | 0.78 |
Genotypes | 208 | 1328.22 | 11.45 | <0.001 | |
Genotype × Year | 832 | 297.92 | 2.57 | <0.001 | |
Error | 1043 | 115.98 |
Environments a | 2019WH | 2019EZ | 2019JZ | 2018WH | 2018EZ |
---|---|---|---|---|---|
2019WH | – | ||||
2019EZ | 0.65 ** | ||||
2019JZ | 0.62 ** | 0.64 ** | |||
2018WH | 0.45 ** | 0.46 ** | 0.29 ** | ||
2018EZ | 0.30 ** | 0.21 ** | 0.30 ** | 0.34 ** |
PH | DF | SC | |
---|---|---|---|
FHB index (%) | −0.62 ** | 0.11 | 0.49 ** |
QTL | Environment a | Position (Mb) | Marker Interval | LOD b | PVE c | ADD d | |
---|---|---|---|---|---|---|---|
QFhb.hbaas -2DS | 2019WH | 23.4–26.3 | AX-111561744 | AX-89728114 | 28.9 | 28.0 | 13.2 |
2019EZ | 23.4–26.3 | AX-111561744 | AX-89728114 | 22.9 | 30.5 | 8.0 | |
2019JZ | 23.4–26.3 | AX-111561744 | AX-89728114 | 18.3 | 24.2 | 7.1 | |
2018WH | 23.4–26.3 | AX-111561744 | AX-89728114 | 7.8 | 12.3 | 6.2 | |
Mean | 23.4–26.3 | AX-111561744 | AX-89728114 | 34.4 | 36.2 | 7.3 | |
QFhb.hbaas -3AS | 2019JZ | 54.8–67.6 | AX-110551014 | AX-111652951 | 2.6 | 2.9 | 2.4 |
Mean | 54.8–67.6 | AX-110551014 | AX-111652951 | 8.5 | 6.6 | 3.1 | |
QFhb.hbaas -3AL | 2019WH | 530.9–617.6 | AX-110591324 | AX-111465231 | 6.3 | 6.6 | 6.4 |
2019EZ | 530.9–617.6 | AX-110591324 | AX-111465231 | 5.2 | 8.0 | 4.1 | |
2018WH | 530.9–617.6 | AX-110591324 | AX-111465231 | 3.5 | 7.4 | 4.8 | |
QFhb.hbaas -3DL | 2018EZ | 536.0–566.1 | AX-94528475 | AX-111760688 | 3.4 | 6.4 | 2.6 |
Mean | 536.0–566.1 | AX-94528475 | AX-111760688 | 3.5 | 2.6 | 2.0 | |
QFhb.hbaas -4DS | 2019WH | 17.0–31.3 | AX-89398511 | AX-110565602 | 20.0 | 17.6 | 10.5 |
2019EZ | 15.2–17.0 | AX-111475478 | AX-89398511 | 4.6 | 5.1 | 3.3 | |
2019JZ | 15.2–17.0 | AX-111475478 | AX-89398511 | 5.8 | 6.8 | 3.8 | |
2018WH | 17.0–31.3 | AX-89398511 | AX-110565602 | 7.0 | 10.9 | 5.8 | |
Mean | 15.2–17.0 | AX-111475478 | AX-89398511 | 16.7 | 14.5 | 4.6 | |
QFhb.hbaas -5DL | 2019WH | 494.5–495.2 | AX-111212888 | AX-109381281 | 11.5 | 9.1 | 7.5 |
2019JZ | 447.9–489.3 | AX-109195695 | AX-111022479 | 5.1 | 7.0 | 3.8 | |
Mean | 494.5–495.2 | AX-111212888 | AX-109381281 | 3.7 | 2.7 | 2.0 |
Number of QTLs | QTL Combination | Mean FHB Index across Environments b | Reduction % a |
---|---|---|---|
None | - | 49.6a | - |
1 | 2D | 15.0d | 69.8 |
4D | 22.1c | 55.4 | |
3A | 25.9b | 47.8 | |
5D | 24b | 51.6 | |
2 | 2D/4D | 12.9e | 74.0 |
2D/3A | 16.8d | 66.1 | |
2D/5D | 16.3d | 67.1 | |
4D/3A | 18.7cd | 62.3 | |
4D/5D | 18.7cd | 62.3 | |
3A/5D | 22.8bc | 54.0 | |
3 | 2D/4D/3A | 10.2e | 79.4 |
2D/4D/5D | 12.7e | 74.4 | |
2D/3A/5D | 13.8de | 72.2 | |
4D/3A/5D | 17.3cd | 65.1 | |
4 | 2D/4D/3A/5D | 11.1e | 77.6 |
QTL | Physical Position (Mb) | Marker Interval | LOD a | PVE b | Additive | |
---|---|---|---|---|---|---|
Plant height | ||||||
QPH.hbaas-2BL | 765.3–769.1 | AX-111609703 | AX-108792274 | 4.94 | 2.48 | −2.27 |
QPH.hbaas-2DS | 23.4–26.3 | AX-111561744 | AX-89728114 | 22.90 | 13.73 | −5.33 |
QPH.hbaas-3DL | 518.3–536.0 | AX-111373283 | AX-94528475 | 2.74 | 1.44 | −1.59 |
QPH.hbaas-4DS | 17.1–31.4 | AX-89398511 | AX-110565602 | 66.70 | 50.36 | −10.75 |
QPH.hbaas-5AL | 525.2–535.1 | AX-111083486 | AX-109378942 | 28.21 | 12.63 | −5.39 |
QPH.hbaas-6BL | 439.2–565.7 | AX-111578782 | AX-108940703 | 8.60 | 3.52 | −2.50 |
QPH.hbaas-7AL | 701.2–701.3 | AX-110516258 | AX-111683497 | 4.66 | 2.25 | −2.17 |
QPH.hbaas-7DL | 665.4–718.1 | AX-111061288 | AX-108780423 | 5.02 | 1.10 | −1.71 |
Spike compactness | ||||||
QSC.hbaas.2DS | 23.4–26.3 | AX-111561744 | AX-89728114 | 45.51 | 43.61 | 0.24 |
QSC.hbaas.2DL | 523.6–526.2 | AX-109419238 | AX-111566799 | 5.05 | 2.96 | −0.06 |
QSC.hbaas.5AL | 525.2–535.1 | AX-111083486 | AX-109378942 | 11.05 | 10.10 | 0.12 |
QSC.hbaas.5BL | 546.1–548.7 | AX-110593685 | AX-111508809 | 5.37 | 3.22 | −0.06 |
QSC.hbaas.5DL | 494.6–495.2 | AX-111212888 | AX-109381281 | 2.55 | 2.01 | 0.06 |
QSC.hbaas.7AL | 671.4–673.8 | AX-111536514 | AX-110518554 | 4.78 | 2.90 | 0.06 |
QTL | Marker | Primer | Sequences |
---|---|---|---|
QFhb.hbaas-2DS | PARMS-AX-111561744 | A | GAAGGTGACCAAGTTCATGCTCTTTGAGGCAGTCCAGTCCC |
B | GAAGGTCGGAGTCAACGGATTCTTTGAGGCAGTCCAGTCCA | ||
common | CCTGAGCAACCTAATTCAATAGC | ||
QFhb.hbaas-4DS | PARMS-AX-89398511 | A | GAAGGTGACCAAGTTCATGCTCATTGATCATAGAAACTGCCTCAT |
B | GAAGGTCGGAGTCAACGGATTCATTGATCATAGAAACTGCCTCAC | ||
common | ACGGATTCATGTGGAGCTTG | ||
QFhb.hbaas-3AL | PARMS-AX-110591324 | A | GAAGGTGACCAAGTTCATGCTGGTCCAACACCTCTCTAAGCGT |
B | GAAGGTCGGAGTCAACGGATTGTCCAACACCTCTCTAAGCGC | ||
common | ATGAAGGCGAACCAGACGG | ||
QFhb.hbaas-5DL | PARMS-AX-109381281 | A | GAAGGTGACCAAGTTCATGCTGGCGAAGGTATGGTCCAGTC |
B | GAAGGTCGGAGTCAACGGATTGGCGAAGGTATGGTCCAGTT | ||
common | CTGACGTGGTGACGCCTTT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, Q.; Xu, F.; Qin, D.; Li, M.; Fedak, G.; Cao, W.; Yang, L.; Dong, J. Molecular Mapping of QTLs Conferring Fusarium Head Blight Resistance in Chinese Wheat Cultivar Jingzhou 66. Plants 2020, 9, 1021. https://doi.org/10.3390/plants9081021
Xu Q, Xu F, Qin D, Li M, Fedak G, Cao W, Yang L, Dong J. Molecular Mapping of QTLs Conferring Fusarium Head Blight Resistance in Chinese Wheat Cultivar Jingzhou 66. Plants. 2020; 9(8):1021. https://doi.org/10.3390/plants9081021
Chicago/Turabian StyleXu, Qing, Fuchao Xu, Dandan Qin, Meifang Li, George Fedak, Wenguang Cao, Lijun Yang, and Jing Dong. 2020. "Molecular Mapping of QTLs Conferring Fusarium Head Blight Resistance in Chinese Wheat Cultivar Jingzhou 66" Plants 9, no. 8: 1021. https://doi.org/10.3390/plants9081021
APA StyleXu, Q., Xu, F., Qin, D., Li, M., Fedak, G., Cao, W., Yang, L., & Dong, J. (2020). Molecular Mapping of QTLs Conferring Fusarium Head Blight Resistance in Chinese Wheat Cultivar Jingzhou 66. Plants, 9(8), 1021. https://doi.org/10.3390/plants9081021