Identification of the BZR Family in Garlic (Allium sativum L.) and Verification of the AsBZR11 under Salt Stress
Abstract
1. Introduction
2. Results
2.1. AsBZR Family Members and Nomenclature
2.2. Evolutionary Relationships of the AsBZR Gene Family Members
2.3. Characterization of BZR Expression in Garlic
2.3.1. Expression Pattern of AsBZR Genes under Salt Stress
2.3.2. Tissue-Specific Expression Patterns of AsBZR Genes
2.4. AsBZR11 Protein Was Located in the Nucleus
2.5. Identification of AsBZR11-OE Lines
2.6. Seed Germination and Seedling Phenotyping of AsBZR11 Transgenic Arabidopsis under Salt Stress
3. Discussion
4. Materials and Methods
4.1. Identification and Cloning of AsBZR Genes
4.2. Plant Growth Conditions and Salt Stress Treatment
4.3. Garlic RNA Extraction and qRT-PCR
4.4. Subcellular Localization of AsBZR11 Protein
4.5. Overexpression Vector Construction and Plant Transformation
4.6. Transgenic Plants Salt Stress Treatment and Physiological Indexes Determination
4.7. Data Analysis
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Ried, K.; Frank, O.R.; Stocks, N.P. Aged garlic extract reduces blood pressure in hypertensives: A dose-response trial. Eur. J. Clin. Nutr. 2013, 67, 64–70. [Google Scholar] [CrossRef] [PubMed]
- Zhao, C.; Zhang, H.; Song, C.; Zhu, J.-K.; Shabala, S. Mechanisms of Plant Responses and Adaptation to Soil Salinity. Innovation 2020, 1, 100017. [Google Scholar] [CrossRef] [PubMed]
- Kong, Q.; Mostafa, H.; Yang, W.; Wang, J.; Nuerawuti, M.; Wang, Y.; Song, J.; Zhang, X.; Ma, L.; Wang, H.; et al. Comparative transcriptome profiling reveals that brassinosteroid-mediated lignification plays an important role in garlic adaption to salt stress. Plant Physiol. Bioch 2021, 158, 34–42. [Google Scholar] [CrossRef] [PubMed]
- Nolan, T.; Chen, J.; Yin, Y. Cross-talk of Brassinosteroid signaling in controlling growth and stress responses. Biochem. J. 2017, 474, 2641–2661. [Google Scholar] [CrossRef] [PubMed]
- Bajguz, A.; Hayat, S. Effects of brassinosteroids on the plant responses to environmental stresses. Plant Physiol. Bioch 2009, 47, 1–8. [Google Scholar] [CrossRef]
- Kumari, S.; Thakur, A.; Singh, N.; Chandel, J.; Rana, N. Influence of drought stress and brassinosteroid on growth and Physio-biochemical characteristics of apple plants. Indian J. Hortic. 2020, 77, 88. [Google Scholar] [CrossRef]
- Çoban, Ö.; Göktürk Baydar, N. Brassinosteroid effects on some physical and biochemical properties and secondary metabolite accumulation in peppermint (Mentha piperita L.) under salt stress. Ind. Crop Prod. 2016, 86, 251–258. [Google Scholar] [CrossRef]
- Clouse, S.D. Brassinosteroid signal transduction: From receptor kinase activation to transcriptional networks regulating plant development. Plant Cell 2011, 23, 1219–1230. [Google Scholar] [CrossRef]
- Yu, X.; Li, L.; Zola, J.; Aluru, M.; Ye, H.; Foudree, A.; Guo, H.; Anderson, S.; Aluru, S.; Liu, P.; et al. A brassinosteroid transcriptional network revealed by genome-wide identification of BESI target genes in Arabidopsis thaliana. Plant J. 2011, 65, 634–646. [Google Scholar] [CrossRef]
- Sun, Y.; Fan, X.Y.; Cao, D.M.; Tang, W.; He, K.; Zhu, J.-Y.; He, J.-X.; Bai, M.-Y.; Zhu, S.; Oh, E.; et al. Integration of brassinosteroid signal transduction with the transcription network for plant growth regulation in Arabidopsis. Dev. Cell 2010, 19, 765–777. [Google Scholar] [CrossRef]
- Xu, C.; Chunyang, S.; Fulei, M.; Rui, L.; Xinmao, L.; Zhitao, D.; Aoxue, W. Identification of BZR gene family in tomato and expression patterns analysis under abiotic stress. J. Northeast. Agric. Univ. 2021, 52, 9–17. [Google Scholar]
- Ye, H.; Liu, S.; Tang, B.; Chen, J.; Xie, Z.; Nolan, T.M.; Jiang, H.; Guo, H.; Lin, H.Y.; Li, L.; et al. RD26 mediates crosstalk between drought and brassinosteroid signalling pathways. Nat. Commun. 2017, 8, 14573. [Google Scholar] [CrossRef]
- Bai, M.Y.; Zhang, L.Y.; Gampala, S.S.; Zhu, S.-W.; Song, W.-Y.; Chong, K.; Wang, Z.-Y. Functions of OsBZR1 and 14-3-3 proteins in brassinosteroid signaling in rice. P. Natl. Acad. Sci. USA 2007, 104, 13839–13844. [Google Scholar] [CrossRef]
- Jin, J.F.; Wang, Z.Q.; He, Q.Y.; Wang, J.Y.; Li, P.F.; Xu, J.M.; Zheng, S.J.; Fan, W.; Yang, J.L. Genome-wide identification and expression analysis of the NAC transcription factor family in tomato (Solanum lycopersicum) during aluminum stress. BMC Genom. 2020, 21, 288. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.Y.; Nakano, T.; Gendron, J.; He, J.; Chen, M.; Vafeados, D.; Yang, Y.; Fujioka, S.; Yoshida, S.; Asami, T.; et al. Nuclear-localized BZR1 mediates brassinosteroid-induced growth and feedback suppression of brassinosteroid biosynthesis. Dev. Cell 2002, 2, 505–513. [Google Scholar] [CrossRef]
- Li, Y.; He, L.; Li, J.; Chen, J.; Liu, C. Genome-Wide Identification, Characterization, and Expression Profiling of the Legume BZR Transcription Factor Gene Family. Front. Plant Sci. 2018, 9, 1332. [Google Scholar] [CrossRef]
- Cui, X.Y.; Gao, Y.; Guo, J.; Yu, T.-F.; Zheng, W.-J.; Liu, Y.-W.; Chen, J.; Xu, Z.-S.; Ma, Y.-Z. BES/BZR Transcription Factor TaBZR2 Positively Regulates Drought Responses by Activation of TaGST1. Plant Physiol. 2019, 180, 605–620. [Google Scholar] [CrossRef] [PubMed]
- Ullah, U.; Shalmani, A.; Ilyas, M.; Raza, A.; Ahmad, S.; Shah, A.Z.; Buttar, Z.A. BZR proteins: Identification, evolutionary and expression analysis under various exogenous growth regulators in plants. Mol. Biol. Rep. 2022, 49, 12039–12053. [Google Scholar] [CrossRef]
- Wang, B.; Zhu, X.; Wei, X. Genome-wide identification, structural analysis, and expression profiles of the BZR gene family in tomato. J. Plant Biochem. Biot. 2022, 31, 739–750. [Google Scholar] [CrossRef]
- Zhang, H.; Zhao, Y.; Zhu, J.K. Thriving under Stress: How Plants Balance Growth and the Stress Response. Dev. Cell 2020, 55, 529–543. [Google Scholar] [CrossRef]
- Zhou, P.; Jiang, H.; Li, J.; Jin, Q.; Wang, Y.; Xu, Y. Genome-Wide Identification Reveals That BZR1 Family Transcription Factors Involved in Hormones and Abiotic Stresses Response of Lotus (Nelumbo). Horticulturae 2023, 9, 882. [Google Scholar] [CrossRef]
- Tomar, V.; Saini, S.S.; Juneja, K.; Agrawal, P.K.; Sircar, D. Transgenic Technologies and Their Potential Applications in Horticultural Crop Improvement. In Advances in Plant Transgenics: Methods and Applications; Springer: Berlin/Heidelberg, Germany, 2019; pp. 189–212. [Google Scholar]
- Jia, C.; Zhao, S.; Bao, T.; Zhao, P.; Peng, K.; Guo, Q.; Qin, J. Tomato BZR/BES transcription factor SlBZR1 positively regulates BR signaling and salt stress tolerance in tomato and Arabidopsis. Plant Sci. 2021, 302, 110719. [Google Scholar] [CrossRef]
- Matsushita, K.; Azuma, Y.; Kosaka, T.; Yakushi, T.; Hoshida, H.; Akada, R.; Yamada, M. Genomic analyses of thermotolerant microorganisms used for high-temperature fermentations. Biosci. Biotech. Bioch 2016, 80, 655–668. [Google Scholar] [CrossRef]
- Zhang, S.; Fu, W.; Li, N.; Zhang, F.; Liu, T.X. Antioxidant responses of Propylaea japonica (Coleoptera: Coccinellidae) exposed to high temperature stress. J. Insect Physiol. 2015, 73, 47–52. [Google Scholar] [CrossRef] [PubMed]
- Zhuo, C.; Wang, T.; Guo, Z.; Lu, S. Overexpression of MfPIP2-7 from Medicago falcata promotes cold tolerance and growth under NO3 (-) deficiency in transgenic tobacco plants. BMC Plant Biol. 2016, 16, 138. [Google Scholar] [CrossRef]
- Xu, Y.; Hu, W.; Liu, J.; Zhang, J.; Jia, C.; Miao, H.; Xu, B.; Jin, Z. A banana aquaporin gene, MaPIP1;1, is involved in tolerance to drought and salt stresses. Bmc Plant Biol. 2014, 14, 59. [Google Scholar] [CrossRef]
- Stewart, R.R.; Bewley, J.D. Lipid peroxidation associated with accelerated aging of soybean axes. Plant Physiol. 1980, 65, 245–248. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Zhou, J.; Xiong, Y.; Liu, C.; Wang, J.; Wang, G.; Cai, Y. Overexpression of a maize plasma membrane intrinsic protein ZmPIP1;1 confers drought and salt tolerance in Arabidopsis. PLoS ONE 2018, 13, e218234. [Google Scholar] [CrossRef]
- Yamada, M.; Morishita, H.; Urano, K.; Shiozaki, N.; Yamaguchi-Shinozaki, K.; Shinozaki, K.; Yoshiba, Y. Effects of free proline accumulation in petunias under drought stress. J. Exp. Bot. 2005, 56, 1975–1981. [Google Scholar] [CrossRef]
- Sun, X.; Zhu, S.; Li, N.; Cheng, Y.; Zhao, J.; Qiao, X.; Lu, L.; Liu, S.; Wang, Y.; Liu, C.; et al. A Chromosome-Level Genome Assembly of Garlic (Allium sativum) Provides Insights into Genome Evolution and Allicin Biosynthesis. Mol. Plant 2020, 13, 1328–1339. [Google Scholar] [CrossRef]
- Chakrabarty, D.; Datta, S.K. Micropropagation of gerbera: Lipid peroxidation and antioxidant enzyme activities during acclimatization process. Acta Physiol. Plant 2008, 30, 325–331. [Google Scholar] [CrossRef]
- Ke, D.; Sun, G.; Wang, Z. Effects of superoxide radicals on ACC synthase activity in chilling-stressed etiolated mungbean seedlings. Plant Growth Regul. 2007, 51, 83–91. [Google Scholar] [CrossRef]
- Muñoz-Muñoz, J.L.; García-Molina, F.; García-Ruiz, P.; Arribas, E.; Tudela, J.; García-Cánovas, F.; Rodríguez-López, J. Enzymatic and chemical oxidation of trihydroxylated phenols. Food Chem. 2009, 113, 435–444. [Google Scholar] [CrossRef]
- Aebi, H. Catalase in vitro. Method. Enzymol. 1984, 105, 121–126. [Google Scholar]
- Nakano, Y.; Asada, K. Hydrogen-peroxide is scavenged by ascorbate-specific peroxidase in spinach-chloroplasts. Plant Cell Physiol. 1981, 22, 867–880. [Google Scholar]
- Beauchamp, C.; Fridovich, I. Superoxide dismutase: Improved assays and an assay applicable to acrylamide gels. Anal. Biochemistry 1971, 44, 276–287. [Google Scholar] [CrossRef]
- Kong, M.; Chen, X.G.; Liu, C.S.; Meng, X.H.; Yu, L.J. Antibacterial mechanism of chitosan microspheres in a solid dispersing system against E. coli. Colloids and Surfaces B Biointerfaces 2008, 65, 197–202. [Google Scholar] [CrossRef] [PubMed]
- Kumar, G.; Knowles, N.R. Changes in Lipid Peroxidation and Lipolytic and Free-Radical Scavenging Enzyme Activities during Aging and Sprouting of Potato (Solanum tuberosum) Seed-Tubers. Plant Physiol. 1993, 102, 115–124. [Google Scholar] [CrossRef]
- Truzzi, C.; Annibaldi, A.; Illuminati, S.; Finale, C.; Scarponi, G. Determination of proline in honey: Comparison between official methods, optimization and validation of the analytical methodology. Food Chem. 2014, 150, 477–481. [Google Scholar] [CrossRef]
Gene Name | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
AsBZR1 | GCCTGAGAGCCTACGGGTAACTATAC | ACCCAACCTGCCTCCATACAAAG |
AsBZR2 | CAGGCTGGGATTGTTGAAGAAGATGG | ACTCGGATATGCGGGAGGACATTG |
AsBZR3 | GCGATGGCTATGCTTCAGTTGC | TGGCGACTCTCTTGCTGTTGACTC |
AsBZR4 | TGATCGAAAGCAAGAAAGACACTGGG | TCTCTCATCCGGGGTCATTGAATGG |
AsBZR5 | CACCGTCTCCATCAGTCATCCAG | GCGAGAGCAGCAAGAACATCATTC |
AsBZR6 | TTGTGCGACGAGGCTGGGATG | GACCTTGGACTTGCTGATGTTGATG |
AsBZR7 | TACCTACCACGGGTTTCATTATGCC | CTCATGCTCAATGTCTTCGTCTTCG |
AsBZR8 | ACAAGACCACTCCACTCACCAAC | TGACTCAAGTTAGCGACGACGAC |
AsBZR9 | CGACGAGGCTGGTTGGAGTG | CGACGAGGCTGGTTGGAGTG |
AsBZR10 | GAGAGAGCCGTAGAAGGAGAATCAC | CCATCCAGCCTCTTCGCACAG |
AsBZR11 | CCATCCAGCCTCTTCGCACAG | GTTTAGCCTGAGGTAAGTGAAAGCG |
AsACTIN | TCCTAACCGAGCGAGGCTACAT | GGAAAAGCACTTCTGGGGCACC |
Primer Name | Primer Sequence (5′-3′) |
---|---|
AsBZR11-PR101-GFP-F | tcttcactgttgatacatatgGTTTTGAATACTGCATGGGGATGTAG |
AsBZR11-PR101-GFP-R | gcccttgctcaccatggatccCATGCATTTTTTGACAAATCGC |
PR101-GFP-F | GACGCACAATCCCACTATCC |
PR101-GFP-R | CGTCGCCGTCCAGCTCGACCAG |
Primer Name | Primer Sequence |
---|---|
AsBZR11-pBI121-F | gagaacacgggggactctagaGTTTTGAATACTGCATGGGGATGTAG |
AsBZR11-pBI121-R | ataagggactgaccacccgggCATGCATTTTTTGACAAATCGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Peng, X.; Ruan, J.; Jiang, F.; Zhou, R.; Wu, Z. Identification of the BZR Family in Garlic (Allium sativum L.) and Verification of the AsBZR11 under Salt Stress. Plants 2024, 13, 2749. https://doi.org/10.3390/plants13192749
Peng X, Ruan J, Jiang F, Zhou R, Wu Z. Identification of the BZR Family in Garlic (Allium sativum L.) and Verification of the AsBZR11 under Salt Stress. Plants. 2024; 13(19):2749. https://doi.org/10.3390/plants13192749
Chicago/Turabian StylePeng, Xianghan, Jiaojiao Ruan, Fangling Jiang, Rong Zhou, and Zhen Wu. 2024. "Identification of the BZR Family in Garlic (Allium sativum L.) and Verification of the AsBZR11 under Salt Stress" Plants 13, no. 19: 2749. https://doi.org/10.3390/plants13192749
APA StylePeng, X., Ruan, J., Jiang, F., Zhou, R., & Wu, Z. (2024). Identification of the BZR Family in Garlic (Allium sativum L.) and Verification of the AsBZR11 under Salt Stress. Plants, 13(19), 2749. https://doi.org/10.3390/plants13192749