An Analysis of Genetic Variability and Population Structure in Wheat Germplasm Using Microsatellite and Gene-Based Markers
Abstract
:1. Introduction
2. Materials and Methods
2.1. Genetic Materials and DNA Isolation
2.2. PCR Amplification and Genotyping Assays
2.3. Data Analysis
3. Results
3.1. Marker Polymorphism
3.2. Genetic Diversity Analysis
3.3. Genetic Distance and Grouping of Samples
3.4. Structure and Pattern of Classification
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Warschefsky, E.; Penmetsa, R.V.; Cook, D.R.; von Wettberg, E. Back to the wilds: Tapping evolutionary adaptations for resilient crops through systematic hybridization with crop wild relatives. Am. J. Bot. 2014, 101, 1791–1800. [Google Scholar] [CrossRef] [PubMed]
- Maxted, N.; Kell, S. CWR in crop improvement: To what extent are they used? Crop Wild Relative. Newsletter 2009, 7, 7–8. [Google Scholar]
- Bangohari, M.Z.; Niazi, A.; Moghaddam, A.A.; Deihimi, T.; Ebrahimie, E. Genome-wide analysis of key salinitytolerance transporter (HKT;5) in wheat and wild wheat relatives (A and D genomes). In Vitro Cell Dev. Biol. Plant 2013, 49, 97–106. [Google Scholar]
- Arabbeigi, M.; Arzani, A.; Majidi, M.M.; Kiani, R.; Tabatabaei, B.E.S.; Habibi, F. Salinity tolerance of Aegilops cylindrical genotypes collected from hyper-saline shores of Uremia Salt Lake using physiological traits and SSR markers. Acta Physiol. Plant. 2014, 36, 2243–2251. [Google Scholar] [CrossRef]
- Kiani, R.; Arzani, A.; Habibi, F. Physiology of salinity tolerance in Aegilops cylindrica. Acta Physiol. Plant. 2015, 37, 135–145. [Google Scholar] [CrossRef]
- Pour-Aboughadareh, A.; Omidi, M.; Naghavi, M.; Etminan, A.; Mehrabi, A.; Poczai, P. Wild Relatives of Wheat Respond Well to Water Deficit Stress: A Comparative Study of Antioxidant Enzyme Activities and Their Encoding Gene Expression. Agriculture 2020, 10, 415. [Google Scholar] [CrossRef]
- Pour-Aboughadareh, A.; Ahmadi, J.; Mehrabi, A.A.; Moghaddam, M.; Etminan, A. Evaluation of agro-morphological diversity in wild relatives of wheat collected in Iran. J. Agric. Sci. Technol. 2017, 19, 943–956. [Google Scholar]
- Hajjar, R.; Hodgking, T. The use of wild relatives in crop improvement: A survey of developments over the last 20 years. Euphytica 2007, 156, 1–13. [Google Scholar] [CrossRef]
- Pour-Aboughadareh, A.; Omidi, M.; Naghavi, M.R.; Etminan, A.; Mehrabi, A.A.; Poczai, P.; Bayat, H. Effect of Water Deficit Stress on Seedling Biomass and Physio-Chemical Characteristics in Different Species of Wheat Possessing the D Genome. Agronomy 2019, 9, 522. [Google Scholar] [CrossRef] [Green Version]
- Pour-Aboughadareh, A.; Kianersi, F.; Poczai, P.; Moradkhani, H. Potential of Wild Relatives of Wheat: Ideal Genetic Resources for Future Breeding Programs. Agronomy 2021, 11, 1656. [Google Scholar] [CrossRef]
- Moradkhani, H.; Pour-Aboughadareh, A.R.; Mehrabi, A.A.; Etminan, A. Evaluation of genetic relationships of Triticum-Aegilops species possessing D genome in different ploidy levels using microsatellites. Int. J. Agric. Crop Sci. 2012, 23, 1746–1751. [Google Scholar]
- Mohammadi, S.A.; Prasanna, B.M. Analysis of genetic diversity in crop plants—salient statistical tools and considerations. Crop Sci. 2003, 43, 1235–1248. [Google Scholar] [CrossRef] [Green Version]
- Pour-Aboughadareh, A.; Mahmoudi, M.; Ahmadi, J.; Moghaddam, M.; Mehrabi, A.A.; Alavikia, S.S. Agro-morphological and molecular variability in Triticum boeoticum accessions from Zagros Mountains, Iran. Genet. Resour. Crop Evol. 2017, 64, 545–556. [Google Scholar] [CrossRef]
- Mousavifard, S.S.; Saeidi, H.; Rahiminejad, M.R.; Shamsadini, M. Molecular analysis of diversity of diploid Triticum species in Iran using ISSR markers. Genet. Resour. Crop Evol. 2014, 62, 387–394. [Google Scholar] [CrossRef]
- Etminan, A.; Pour-Aboughadareh, A.; Mohammadi, R.; Ahmadi-Rad, A.; Noori, A.; Mahdavian, Z.; Moradi, Z. Applicability of start codon targeted (SCoT) and inter-simple sequence repeat (ISSR) markers for genetic diversity analysis in durum wheat genotypes. Biotechnol. Biotechnol. Equip. 2016, 30, 1075–1081. [Google Scholar] [CrossRef] [Green Version]
- Hamidi, H.; Talebi, R.; Keshavarz, F. Comparative efficiency of functional gene-based markers, start codon targeted polymorphism (SCoT) and conserved DNA-derived Polymorphism (CDDP) with ISSR markers for diagnostic fingerprinting in wheat (Triticum aestivum L.). Cereal Res. Commun. 2014, 42, 558–567. [Google Scholar] [CrossRef]
- Naghavi, M.R.; Hajikram, M.; Taleei, A.R.; Aghaei, M.J. Microsatellite analysis of genetic diversity and population genetic structure of Aegilops tauschii Coss. in northern Iran. Genet. Resour. Crop Evol. 2010, 57, 423–430. [Google Scholar] [CrossRef]
- Lagercrantz, U.; Ellegren, H.; Andersson, L. The abundance of various polymorphic microsatellite motifs differs between plants and vertebrates. Nucleic Acids Res. 1993, 21, 1111–1115. [Google Scholar] [CrossRef] [Green Version]
- Masoumi, S.M.; Kahrizi, D.; Rostami-Ahmadvandi, H.; Soorni, J.; Kiani, S.; Mostafaie, A.; Yari, K. Genetic diversity study of some medicinal plant accessions belong to Apiaceae family based on seed storage proteins patterns. Mol. Biol. Rep. 2012, 39, 10361–10365. [Google Scholar] [CrossRef]
- Fahima, T.; Roder, M.S.; Grama, A.; Nevo, E. Microsatellite DNA polymorphism divergence in Triticum dicoccoides accessions highly resistant to yellow rust. Theor. Appl. Genet. 1998, 96, 187–195. [Google Scholar] [CrossRef]
- Roder, M.S.; Korzun, V.; Wendehake, K.; Plaschke, J.; Tixier, M.-H.; Leroy, P.; Ganal, M.W. A microsatellite map of wheat. Genetic 1998, 149, 2007–2023. [Google Scholar] [CrossRef] [PubMed]
- Benoist, C.; O’Hare, K.; Breathnach, R.; Chambon, P. The ovalbumin gene-sequence of putative control regions. Nucleic Acids Res. 1980, 8, 127–142. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Singh, A.K.; Rana, M.K.; Singh, S.; Kumar, S.; Kumar, R.; Singh, R. CAAT box-derived polymorphism (CBDP): A novel promoter-targeted molecular marker for plants. J. Plant Biochem. Biotechnol. 2014, 23, 175–183. [Google Scholar] [CrossRef]
- Heikrujam, M.; Kumar, J.; Agrawal, V. Genetic diversity analysis among male and female Jojoba genotypes employing gene targeted molecular markers, start codon targeted (SCoT) polymorphism and CAAT box-derived polymorphism (CBDP) markers. Meta Gene 2015, 5, 90–97. [Google Scholar] [CrossRef]
- Etminan, A.; Pour-Aboughadareh, A.; Mohammadi, R.; Noori, A.; Ahmadi-Rad, A. Applicability of CAAT box-derived polymorphism (CBDP) markers for analysis of genetic diversity in durum wheat. Cereal Res. Commun. 2018, 46, 1–9. [Google Scholar] [CrossRef]
- Collard, B.C.Y.; Mackill, D.J. Start codon targeted (SCoT) polymorphism: A simple, novel DNA marker technique for generating gene-targeted markers in plants. Plant Mol. Biol. Rep. 2019, 27, 86–93. [Google Scholar] [CrossRef]
- Rajesh, M.K.; Sabana, A.A.; Rachana, K.E.; Rahman, S.; Jerard, B.A.; Karun, A. Genetic relationship and diversity among coconut (Cocos nucifera L.) accessions revealed through SCoT analysis. 3 Biotech 2015, 5, 999–1006. [Google Scholar] [CrossRef] [Green Version]
- Naghavi, M.R.; Maleki, M.; Alizadeh, H.; Pirseiedi, M.; Mardi, M. An assessment of genetic diversity in wild diploid wheat Triticum boeoticum from west of Iran using RAPD, AFLP and SSR markers. J. Agric. Sci. Technol. 2009, 11, 585–598. [Google Scholar]
- Heidari, P.; Etminan, A.; Azizinezhad, R.; Khosroshahli, M. Genomic variation studies in durum wheat (Triticum turgidum ssp. durum) using CBDP, SCoT and ISSR markers. Indian J. Genet. Plant Breed. 2017, 77, 379–386. [Google Scholar] [CrossRef]
- Qaderi, A.; Omidi, M.; Pour-Aboughadareh, A.; Poczai, P.; Shaghaghi, J.; Mehrafarin, A.; Nohooji, M.G.; Etminan, A. Molecular diversity and phytochemical variability in the Iranian poppy (Papaver bracteatum Lindl.): A baseline for conservation and utilization in future breeding programmes. Ind. Crops Prod. 2019, 130, 237–247. [Google Scholar] [CrossRef]
- Doyle, J.J.; Doyle, J.K. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 1987, 19, 11–15. [Google Scholar]
- Pour-Aboughadareh, A.; Ahmadi, J.; Mehrabi, A.A.; Etminan, A.; Moghaddam, M. Insight into the genetic variability analysis and relationships among some Aegilops and Triticum species, as genome progenitors of bread wheat using SCoT markers. Plant Biosyst. 2018, 152, 694–703. [Google Scholar] [CrossRef]
- Peakall, R.O.D.; Smouse, P.E. GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef]
- Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [Green Version]
- Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef]
- Earl, D.A.; von Holdt, B.M. Structure Harvester: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour. 2012, 4, 359–361. [Google Scholar] [CrossRef]
- Mantel, N. The detection of disease clustering and a generalized regression approach. Cancer Res. 1967, 27, 209–220. [Google Scholar]
- Ghobadi, G.; Etminan, A.; Mehrabi, A.M.; Shooshtari, L. Molecular diversity analysis in hexaploid wheat (Triticum aestivum L.) and two Aegilops species (Aegilops crassa and Aegilops cylindrica) using CBDP and SCoT markers. J. Genet. Eng. Biotechnol. 2021, 19, 1–11. [Google Scholar] [CrossRef]
- Etminan, A.; Pour-Aboughadareh, A.; Mehrabi, A.A.; Shooshtari, L.; Ahmadi-Rad, A.; Moradkhani, H. Molecular characterization of the wild relatives of wheat using CAAT-box derived polymorphism. Plant Biosyst. 2019, 153, 398–405. [Google Scholar] [CrossRef]
- Moradkhani, H.; Mehrabi, A.A.; Etminan, A.; Pour-Aboughadareh, A. Molecular diversity and phylogeny of Triticum-Aegilops species possessing D genome revealed by SSR and ISSR markers. Plant Breed. Seed Sci. 2015, 71, 82–95. [Google Scholar] [CrossRef]
- Pour-Aboughadareh, A.; Ahmadi, J.; Mehrabi, A.A.; Etminan, A.; Moghaddam, M.; Siddique, K.H.M. Physiological responses to drought stress in wild relatives of wheat: Implications for wheat improvement. Acta Physiol. Plant. 2017, 39, 106. [Google Scholar] [CrossRef]
- Ahmadi, J.; Pour-Aboughadareh, A.; Fabriki Ourang, S.; Khalili, P.; Poczai, P. Unraveling salinity stress responses in ancestral and neglected wheat species at early growth stage: A baseline for utilization in future wheat improvement programs. Physiol. Mol. Biol. Plants 2020, 26, 537–549. [Google Scholar] [CrossRef] [PubMed]
No. | Species | Genbank Code | Province | No. | Species | Genbank Code | Province |
---|---|---|---|---|---|---|---|
1 | AST | IUGB-00133 | Golestan | 51 | ACY | IUGB-00373 | Chaharmahal and Bakhtiari |
2 | AST | IUGB-00134 | Qazvin | 52 | ACY | IUGB-00189 | Lorestan |
3 | AST | IUGB-00485 | Urmiyeh | 53 | ACY | IUGB-00236 | Khuzestan |
4 | AST | IUGB-00516 | Khoozestan | 54 | ACY | IUGB-00267 | Gilan |
5 | AST | IUGB-00911 | Ilam | 55 | ACY | IUGB-00188 | East Azerbaijan |
6 | AST | IUGB-01569 | Lorestan | 56 | ACY | IUGB-00359 | Kurdistan |
7 | AST | IUGB-01696 | Kermanshah | 57 | ACY | IUGB-00403 | Kohgiluyeh and Boyer-Ahmad |
8 | AST | IUGB-00615 | Unknown | 58 | ACY | IUGB-00210 | Lorestan |
9 | AST | IUGB-00597 | Unknown | 59 | ACY | IUGB-00200 | Kermanshah |
10 | AST | IUGB-00604 | Unknown | 60 | ACY | IUGB-00150 | West Azerbaijan |
11 | AST | IUGB-00576 | Unknown | 61 | ACY | IUGB-00168 | Kermanshah |
12 | AST | IUGB-00618 | Unknown | 62 | ACY | IUGB-00034 | Kermanshah |
13 | AST | IUGB-01845 | Ilam | 63 | ACY | IUGB-00090 | Kermanshah |
14 | AST | IUGB-00518 | Kermanshah | 64 | ACY | IUGB-00258 | Ardabil |
15 | AST | IUGB-00540 | Lorestan | 65 | ACY | IUGB-01592 | Lorestan |
16 | AST | IUGB-00544 | Kurdestan | 66 | ACY | IUGB-00202 | East Azerbaijan |
17 | AST | IUGB-00547 | Khoozestan | 67 | ACY | IUGB-00229 | Lorestan |
18 | AST | IUGB-00548 | Hamadan | 68 | ACY | IUGB-00090 | Kermanshah |
19 | AST | IUGB-00602 | Unknown | 69 | ACY | IUGB-00270 | Gilan |
20 | AST | IUGB-00856 | Ilam | 70 | ACY | IUGB-00059 | Lorestan |
21 | AST | IUGB-00854 | Ilam | 71 | ACY | IUGB-00132 | Kermanshah |
22 | AST | IUGB-00515 | Khoozestan | 72 | ACY | IUGB-00095 | Kermanshah |
23 | AST | IUGB-00534 | Kurdestan | 73 | ACY | IUGB-00062 | Kermanshah |
24 | AST | IUGB-00613 | Unknown | 74 | ACY | IUGB-00065 | Kurdestan |
25 | AST | IUGB-00590 | Unknown | 75 | ACY | IUGB-00391 | Lorestan |
26 | AT | NPGBI-01-0836 | Unknown | 76 | ACR | IUGB-00379 | Kermanshah |
27 | AT | IUGB-00020 | Ardabil | 77 | ACR | IUGB-01564 | Lorestan |
28 | AT | IUGB-00107 | Gilan | 78 | ACR | IUGB-00881 | Ilam |
29 | AT | IUGB-00223 | Mazandaran | 79 | ACR | IUGB-00817 | Ilam |
30 | AT | IUGB-00224 | Gilan | 80 | ACR | IUGB-00170 | Fars |
31 | AT | IUGB-00245 | Alborz | 81 | ACR | IUGB-00408 | Kermanshah |
32 | AT | IUGB-00247 | Mazandaran | 82 | ACR | IUGB-00319 | Chaharmahal and Bakhtiari |
33 | AT | IUGB-00260 | Gilan | 83 | ACR | IUGB-00280 | East Azerbaijan |
34 | AT | IUGB-00325 | Alborz | 84 | ACR | IUGB-00149 | Fars |
35 | AT | IUGB-00365 | Mazandaran | 85 | ACR | IUGB-01564 | Lorestan |
36 | AT | IUGB-00366 | Mazandaran | 86 | ACR | IUGB-00830 | Ilam |
37 | AT | IUGB-00369 | Gilan | 87 | ACR | IUGB-01267 | Kermanshah |
38 | AT | IUGB-00402 | Gilan | 88 | ACR | IUGB-00334 | Ilam |
39 | AT | IUGB-00249 | Mazandaran | 89 | ACR | IUGB-00284 | Kermanshah |
40 | AT | IUGB-00367 | East Azerbaijan | 90 | ACR | NPGBI-28940 | Kermanshah |
41 | AT | IUGB-00273 | Ardabil | 91 | ACR | NPGBI-27828 | Hamadan |
42 | AT | IUGB-00274 | Alborz | 92 | ACR | NPGBI-28954 | Kermanshah |
43 | AT | IUGB-00374 | Gilan | 93 | ACR | NPGBI-28112 | Hamadan |
44 | AT | IUGB-00383 | Mazandaran | 94 | ACR | NPGBI-29131 | Tehran |
45 | AT | IUGB-00386 | East Azerbaijan | 95 | ACR | NPGBI-28024 | Khorasan |
46 | AT | IUGB-00396 | Mazandaran | 96 | ACR | NPGBI-28126 | Zanjan |
47 | AT | IUGB-00400 | Mazandaran | 97 | ACR | NPGBI-28348 | Kermanshah |
48 | AT | IUGB-00401 | Mazandaran | 98 | ACR | NPGBI-28157 | Zanjan |
49 | AT | IUGB-00404 | Gilan | 99 | ACR | NPGBI-50067 | Khorasan |
50 | AT | IUGB-00405 | Alborz | 100 | ACR | NPGBI-28917 | West Azerbaijan |
Primer | Sequence (5–3) | Tm | NTB | NPB | PIC | Rp | MI |
---|---|---|---|---|---|---|---|
SCoT-2 | CAACAATGGCTACCACCC | 56 | 7 | 7 | 0.45 | 5.64 | 3.20 |
SCoT-3 | CAACAATGGCTACCACCG | 56 | 9 | 9 | 0.34 | 4.44 | 3.12 |
SCoT-5 | CAACAATGGCTACCACGA | 53.70 | 8 | 8 | 0.44 | 7.06 | 3.55 |
SCoT-12 | ACGACATGGCGACCAACG | 58.20 | 9 | 9 | 0.36 | 4.82 | 3.23 |
SCoT-17 | CATGGCTACCACCGGCCC | 53 | 11 | 11 | 0.42 | 7.76 | 4.60 |
SCoT-18 | ACCATGGCTACCACCGCG | 60.50 | 10 | 10 | 0.48 | 9.28 | 4.84 |
SCoT-19 | GCAACAATGGCTACCACC | 56 | 12 | 12 | 0.43 | 10.38 | 5.11 |
SCoT-21 | CACCATGGCTACCACCAT | 56 | 10 | 10 | 0.41 | 7.18 | 4.13 |
Mean | 9.50 | 9.50 | 0.42 | 7.07 | 3.97 | ||
CBDP-1 | TGAGCACGATCCAAT AGC | 56 | 10 | 10 | 0.48 | 9.98 | 4.80 |
CBDP-2 | TGAGCACGATCCAATAAT | 56 | 9 | 9 | 0.47 | 8.80 | 4.27 |
CBDP-3 | TGAGCACGATCCAAT ACC | 56 | 10 | 10 | 0.45 | 9.60 | 4.55 |
CBDP-4 | TGAGCACGATCCAAT AAG | 56 | 10 | 10 | 0.46 | 9.52 | 4.58 |
CBDP-5 | TGAGCACGATCCAAT CTA | 56 | 9 | 9 | 0.43 | 7.72 | 3.88 |
CBDP-6 | TGAGCACGATCCAAT CAG | 56 | 12 | 12 | 0.44 | 9.70 | 5.36 |
CBDP-7 | TGAGCACGATCCAAT CGA | 56 | 9 | 9 | 0.43 | 6.32 | 3.89 |
CBDP-8 | TGAGCACGATCCAAT CGG | 56 | 10 | 10 | 0.41 | 8.70 | 4.10 |
CBDP-9 | TGAGCACGATCCAAT GAT | 56 | 11 | 11 | 0.46 | 9.24 | 5.12 |
CBDP-10 | TGAGCACGATCCAAT GTT | 56 | 9 | 9 | 0.40 | 6.46 | 3.66 |
CBDP-11 | TGAGCACGATCCAAT TGC | 56 | 9 | 9 | 0.46 | 8.24 | 4.15 |
CBDP-12 | TGAGCACGATCCAATATA | 56 | 8 | 8 | 0.44 | 6.74 | 3.56 |
Mean | 9.67 | 9.67 | 0.45 | 8.42 | 4.33 |
Primer | Sequence (5–3) | Tm | NTB | NPB | PIC | Rp | MI | |
---|---|---|---|---|---|---|---|---|
Xgwm-16 | Forward | GCTTGGACTAGCTAGAGTATCATAC | 62.8 | 2 | 2 | 0.50 | 1.96 | 1.00 |
Reverse | CAATCTTCAATTCTGTCGCACGG | |||||||
Xgwm-44 | Forward | GTTGAGCTTTTCAGTTCGGC | 59.9 | 2 | 2 | 0.47 | 2.42 | 0.93 |
Reverse | ACTGGCATCCACTGAGCTG | |||||||
Xgwm-111 | Forward | TCTGTAGGCTCTCTCCGACTG | 59.5 | 2 | 2 | 0.24 | 3.32 | 0.47 |
Reverse | ACCTGATCAGATCCCACTCG | |||||||
Xgwm-121 | Forward | TCCTCTACAAACAAACACAC | 54.3 | 2 | 2 | 0.09 | 2.12 | 0.19 |
Reverse | CTCGCAACTAGAGGTGTATG | |||||||
Xgwm-271 | Forward | CAAGATCGTGGAGCCAGC | 58.5 | 2 | 2 | 0.36 | 2.74 | 0.73 |
Reverse | AGCTGCTAGCTTTTGGGACA | |||||||
Xgwm-272 | Forward | TGCTCTTTGGCGAATATATGG | 55.9 | 2 | 2 | 0.08 | 3.84 | 0.15 |
Reverse | GTTCAAAACAAATTAAAAGGCCC | |||||||
Xgwm-292 | Forward | TCACCGTGGTCACCGAC | 59.3 | 2 | 2 | 0.34 | 3.14 | 0.67 |
Reverse | CCACCGAGCCGATAATGTAC | |||||||
Xgwm-296 | Forward | AATTCAACCTACCAATCTCTG | 55.6 | 2 | 2 | 0.30 | 2.16 | 0.61 |
Reverse | GCCTAATAAACTGAAAACGAG | |||||||
Xgwm-301 | Forward | GAGGAGTAAGACACATGCCC | 59.5 | 2 | 2 | 0.40 | 1.86 | 0.79 |
Reverse | GTGGCTGGAGATTCAGGTTC | |||||||
Xgwm-325 | Forward | TTTCTTCTGTCGTTCTCTTCCC | 69.3 | 2 | 2 | 0.44 | 2.00 | 0.88 |
Reverse | TTTTTACGCGTCAACGACG | |||||||
Xgwm-349 | Forward | GGCTTCCAGAAAACAACAGG | 59.5 | 2 | 2 | 0.21 | 1.80 | 0.41 |
Reverse | ATCGGTGCGTACCATCCTAC | |||||||
Xgwm-382 | Forward | GTCAGATAACGCCGTCCAAT | 59.2 | 2 | 2 | 0.33 | 2.28 | 0.67 |
Reverse | CTACGTGCACCACCATTTTG | |||||||
Xgwm-455 | Forward | ATTCGGTTCGCTAGCTACCA | 56 | 2 | 2 | 0.36 | 2.46 | 0.73 |
Reverse | ACGGAGAGCAACCTGCC | |||||||
Xgwm-469 | Forward | CAACTCAGTGCTCACACAACG | 63.5 | 2 | 2 | 0.23 | 2.00 | 0.45 |
Reverse | CGATAACCACTCATCCACACC | |||||||
Xgwm-515 | Forward | AACACAATGGCAAATGCAGA | 60 | 2 | 2 | 0.32 | 3.06 | 0.64 |
Reverse | CCTTCCTAGTAAGTGTGCCTCA | |||||||
Xgwm-565 | Forward | GCGTCAGATATGCCTACCTAGG | 62.1 | 2 | 2 | 0.46 | 2.40 | 0.92 |
Reverse | AGTGAGTTAGCCCTGAGCCA | |||||||
Xgwm-583 | Forward | TTCACACCCAACCAATAGCA | 59.3 | 2 | 2 | 0.43 | 2.52 | 0.86 |
Reverse | TCTAGGCAGACACATGCCTG | |||||||
Xgwm-608 | Forward | ACATTGTGTGTGCGGCC | 60.4 | 2 | 2 | 0.18 | 2.46 | 0.35 |
Reverse | GATCCCTCTCCGCTAGAAGC | |||||||
Xgwm-624 | Forward | TTGATATTAAATCTCTCTATGTG | 51.3 | 2 | 2 | 0.48 | 2.36 | 0.97 |
Reverse | AATTTTATTTGAGCTATGCG | |||||||
Xgwm-157 | Forward | GTCGTCGCGGTAAGCTTG | 60 | 2 | 2 | 0.46 | 1.98 | 0.93 |
Reverse | GAGTGAACACACGAGGCTTG | |||||||
Xgwm-212 | Forward | AAGCAACATTTGCTGCAATG | 60 | 2 | 2 | 0.30 | 2.96 | 0.59 |
Reverse | TGCAGTTAACTTGTTGAAAGGA | |||||||
Xgwm-232 | Forward | ATCTCAACGGCAAGCCG | 55 | 2 | 2 | 0.21 | 3.50 | 0.43 |
Reverse | CTGATGCAAGCAATCCACC | |||||||
Xgwm-311 | Forward | TCACGTGGAAGACGCTCC | 60 | 2 | 2 | 0.21 | 2.52 | 0.41 |
Reverse | CTACGTGCACCACCATTTTG | |||||||
Xgwm-484 | Forward | ACATCGCTCTTCACAAACCC | 55 | 2 | 2 | 0.39 | 1.96 | 0.79 |
Reverse | AGTTCCGGTCATGGCTAGG | |||||||
Mean | 1.96 | 1.96 | 0.32 | 2.52 | 0.64 |
Marker | Species | Na | Ne | I | He | PPL (%) | Variation within Species | Variation among Species |
---|---|---|---|---|---|---|---|---|
SCoT | T. aestivum | 1.868 | 1.398 | 0.399 | 0.253 | 93.42 | 81% | 19% |
Ae. tauschii | 1.789 | 1.471 | 0.433 | 0.285 | 89.47 | |||
Ae. cylindrica | 1.882 | 1.514 | 0.480 | 0.306 | 96.05 | |||
Ae. crassa | 1.921 | 1.502 | 0.467 | 0.305 | 93.42 | |||
Mean | 1.865 | 1.471 | 0.441 | 0.287 | 93.09 | |||
CBDP | T. aestivum | 1.879 | 1.495 | 0.451 | 0.296 | 93.97 | 80% | 20% |
Ae. tauschii | 1.957 | 1.581 | 0.511 | 0.340 | 96.55 | |||
Ae. cylindrica | 1.948 | 1.656 | 0.555 | 0.377 | 97.41 | |||
Ae. crassa | 1.948 | 1.458 | 0.438 | 0.283 | 97.41 | |||
Mean | 1.933 | 1.547 | 0.489 | 0.324 | 96.34 | |||
SSR | T. aestivum | 1.510 | 1.382 | 0.320 | 0.217 | 61.22 | 58% | 42% |
Ae. tauschii | 1.735 | 1.524 | 0.448 | 0.303 | 79.59 | |||
Ae. cylindrica | 1.143 | 1.160 | 0.152 | 0.099 | 32.65 | |||
Ae. crassa | 1.388 | 1.306 | 0.267 | 0.179 | 51.02 | |||
Mean | 1.444 | 1.343 | 0.297 | 0.199 | 56.12 | |||
Combined data | T. aestivum | 1.801 | 1.441 | 0.408 | 0.266 | 87.14 | 58% | 42% |
Ae. tauschii | 1.859 | 1.534 | 0.473 | 0.315 | 90.87 | |||
Ae. cylindrica | 1.763 | 1.511 | 0.444 | 0.298 | 82.99 | |||
Ae. crassa | 1.826 | 1.441 | 0.412 | 0.269 | 87.55 | |||
Mean | 1.812 | 1.482 | 0.435 | 0.287 | 87.14 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pour-Aboughadareh, A.; Poczai, P.; Etminan, A.; Jadidi, O.; Kianersi, F.; Shooshtari, L. An Analysis of Genetic Variability and Population Structure in Wheat Germplasm Using Microsatellite and Gene-Based Markers. Plants 2022, 11, 1205. https://doi.org/10.3390/plants11091205
Pour-Aboughadareh A, Poczai P, Etminan A, Jadidi O, Kianersi F, Shooshtari L. An Analysis of Genetic Variability and Population Structure in Wheat Germplasm Using Microsatellite and Gene-Based Markers. Plants. 2022; 11(9):1205. https://doi.org/10.3390/plants11091205
Chicago/Turabian StylePour-Aboughadareh, Alireza, Peter Poczai, Alireza Etminan, Omid Jadidi, Farzad Kianersi, and Lia Shooshtari. 2022. "An Analysis of Genetic Variability and Population Structure in Wheat Germplasm Using Microsatellite and Gene-Based Markers" Plants 11, no. 9: 1205. https://doi.org/10.3390/plants11091205
APA StylePour-Aboughadareh, A., Poczai, P., Etminan, A., Jadidi, O., Kianersi, F., & Shooshtari, L. (2022). An Analysis of Genetic Variability and Population Structure in Wheat Germplasm Using Microsatellite and Gene-Based Markers. Plants, 11(9), 1205. https://doi.org/10.3390/plants11091205