Glucocorticoid Receptor Alpha Targets SLC2A4 to Regulate Protein Synthesis and Breakdown in Porcine Skeletal Muscle Cells
Abstract
1. Introduction
2. Results
2.1. Effects of Glucocorticoid and Its Antagonist on Protein Deposition in Pig Skeletal Muscle Cells
2.2. Effect of Glucocorticoid Receptor GRα on Protein Deposition
2.3. Effect of GRα on SLC2A4 Expression and Activity Analysis of SLC2A4 Promoter
2.4. Effect of SLC2A4 on Protein Deposition
3. Discussion
4. Materials and Methods
4.1. Animals and Samples
4.2. Total RNA Preparation and cDNA Synthesis
4.3. Quantitative Real-Time PCR
4.4. BCA Method for Detecting Protein Concentration
4.5. Plasmid Construction, siRNA Synthesis, and Cell Transfection
4.6. Western Blot Analysis
4.7. SUnSET Non-Radioactive Method for Detecting Protein Synthesis Rate
4.8. Luciferase Reporter Assays
4.9. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Buckingham, J.C. Glucocorticoids: Exemplars of multi-tasking. Br. J. Pharmacol. 2006, 147 (Suppl. 1), S258–S268. [Google Scholar] [CrossRef]
- Burgering, B.M.; Kops, G.J. Cell cycle and death control: Long live Forkheads. Trends Biochem. Sci. 2002, 27, 352–360. [Google Scholar] [CrossRef]
- Cen, X.; Liu, S.; Cheng, K. The role of toll-like receptor in inflammation and tumor immunity. Front. Pharmacol. 2018, 9, 878. [Google Scholar] [CrossRef]
- Correa-Giannella, M.L.; Machado, U.F. SLC2A4gene: A promising target for pharmacogenomics of insulin resistance. Pharmacogenomics 2013, 14, 847–850. [Google Scholar] [CrossRef]
- Feldman, S.; Weidenfeld, J. Electrical stimulation of the dorsal hippocampus caused a long lasting inhibition of ACTH and adrenocortical responses to photic stimuli in freely moving rats. Brain. Res. 2001, 911, 22–26. [Google Scholar] [CrossRef]
- Fleming, J.E.; Bensch, K.G. Oxidative stress as a causal factor in differentiation and aging: A unifying hypothesis. Exp. Gerontol. 1991, 26, 511–517. [Google Scholar] [CrossRef]
- Gao, L.; Wang, G.; Liu, W.N.; Kinser, H.; Franco, H.L.; Mendelson, C.R. Reciprocal feedback between miR-181a and E2/ERalpha in myometrium enhances inflammation leading to labor. J. Clin. Endocrinol. Metab. 2016, 101, 3646–3656. [Google Scholar] [CrossRef] [PubMed]
- Goldberg, A.L.; Tischler, M.; DeMartino, G.; Griffin, G. Hormonal regulation of protein degradation and synthesis in skeletal muscle. Fed. Proc. 1980, 39, 31–36. [Google Scholar] [PubMed]
- Goodman, C.A.; Mabrey, D.M.; Frey, J.W.; Miu, M.H.; Schmidt, E.K.; Pierre, P.; Hornberger, T.A. Novel insights into the regulation of skeletal muscle protein synthesis as revealed by a new nonradioactive in vivo technique. FASEB J. 2011, 25, 1028–1039. [Google Scholar] [CrossRef]
- Hancock, E.J.; Ang, J.; Papachristodoulou, A.; Stan, G.B. The interplay between feedback and buffering in cellular homeostasis. Cell Syst. 2017, 5, 498–508.e423. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Huang, H.; Regan, K.M.; Lou, Z.; Chen, J.; Tindall, D.J. CDK2-dependent phosphorylation of FOXO1 as an apoptotic response to DNA damage. Science 2006, 314, 294–297. [Google Scholar] [CrossRef]
- Jin, B.; Li, Y.P. Curcumin prevents lipopolysaccharide-induced atrogin-1/MAFbx upregulation and muscle mass loss. J. Cell Biochem. 2007, 100, 960–969. [Google Scholar] [CrossRef] [PubMed]
- Kadmiel, M.; Cidlowski, J.A. Glucocorticoid receptor signaling in health and disease. Trends Pharmacol. Sci. 2013, 34, 518–530. [Google Scholar] [CrossRef] [PubMed]
- Kamei, Y.; Miura, S.; Suzuki, M.; Kai, Y.; Mizukami, J.; Taniguchi, T.; Mochida, K.; Hata, T.; Matsuda, J.; Aburatani, H.; et al. Skeletal muscle FOXO1 (FKHR) transgenic mice have less skeletal muscle mass, down-regulated Type I (slow twitch/red muscle) fiber genes, and impaired glycemic control. J. Biol. Chem. 2004, 279, 41114–41123. [Google Scholar] [CrossRef]
- Kino, T.; Manoli, I.; Kelkar, S.; Wang, Y.; Su, Y.A.; Chrousos, G.P. Glucocorticoid receptor (GR) beta has intrinsic, GRalpha-independent transcriptional activity. Biochem. Biophys. Res. Commun. 2009, 381, 671–675. [Google Scholar] [CrossRef]
- Klip, A.; McGraw, T.E.; James, D.E. Thirty sweet years of GLUT4. J. Biol. Chem. 2019, 294, 11369–11381. [Google Scholar] [CrossRef]
- Lattin, C.R.; Kelly, T.R. Glucocorticoid negative feedback as a potential mediator of trade-offs between reproduction and survival. Gen. Comp. Endocrinol. 2020, 286, 113301. [Google Scholar] [CrossRef] [PubMed]
- Lin, H.; Decuypere, E.; Buyse, J. Oxidative stress induced by corticosterone administration in broiler chickens (Gallus gallus domesticus) 2. Short-term effect. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2004, 139, 745–751. [Google Scholar] [CrossRef]
- Lofberg, E.; Gutierrez, A.; Wernerman, J.; Anderstam, B.; Mitch, W.E.; Price, S.R.; Bergstrom, J.; Alvestrand, A. Effects of high doses of glucocorticoids on free amino acids, ribosomes and protein turnover in human muscle. Eur. J. Clin. Investig. 2002, 32, 345–353. [Google Scholar] [CrossRef]
- Long, Y.C.; Zierath, J.R. AMP-activated protein kinase signaling in metabolic regulation. J. Clin. Investig. 2006, 116, 1776–1783. [Google Scholar] [CrossRef]
- Machado, U.F.; Shimizu, I.; Saito, M. Reduced content and preserved translocation of glucose transporter (GLUT 4) in white adipose tissue of obese mice. Physiol. Behav. 1994, 55, 621–625. [Google Scholar] [CrossRef]
- McCroskery, S.; Thomas, M.; Platt, L.; Hennebry, A.; Nishimura, T.; McLeay, L.; Sharma, M.; Kambadur, R. Improved muscle healing through enhanced regeneration and reduced fibrosis in myostatin-null mice. J. Cell Sci. 2005, 118 Pt 15, 3531–3541. [Google Scholar] [CrossRef]
- Motohashi, N.; Asakura, Y.; Asakura, A. Isolation, culture, and transplantation of muscle satellite cells. J. Vis. Exp. 2014, 86, 50846. [Google Scholar] [CrossRef]
- Newton, R. Molecular mechanisms of glucocorticoid action: What is important? Thorax 2000, 55, 603–613. [Google Scholar] [CrossRef]
- Oakley, R.H.; Webster, J.C.; Jewell, C.M.; Sar, M.; Cidlowski, J.A. Immunocytochemical analysis of the glucocorticoid receptor alpha isoform (GRalpha) using GRalpha-specific antibody. Steroids 1999, 64, 742–751. [Google Scholar] [CrossRef]
- Pariante, C.M.; Miller, A.H. Glucocorticoid receptors in major depression: Relevance to pathophysiology and treatment. Biol. Psychiatry 2001, 49, 391–404. [Google Scholar] [CrossRef]
- Qi, D.; Rodrigues, B. Glucocorticoids produce whole body insulin resistance with changes in cardiac metabolism. Am. J. Physiol. Endocrinol. Metab. 2007, 292, E654–E667. [Google Scholar] [CrossRef] [PubMed]
- Rafacho, A.; Ortsater, H.; Nadal, A.; Quesada, I. Glucocorticoid treatment and endocrine pancreas function: Implications for glucose homeostasis, insulin resistance and diabetes. J. Endocrinol. 2014, 223, R49–R62. [Google Scholar] [CrossRef] [PubMed]
- Reul, J.M.; de Kloet, E.R. Two receptor systems for corticosterone in rat brain: Microdistribution and differential occupation. Endocrinology 1985, 117, 2505–2511. [Google Scholar] [CrossRef]
- Richter, E.A.; Hargreaves, M. Exercise, GLUT4, and skeletal muscle glucose uptake. Physiol. Rev. 2013, 93, 993–1017. [Google Scholar] [CrossRef] [PubMed]
- Saltiel, A.R.; Kahn, C.R. Insulin signalling and the regulation of glucose and lipid metabolism. Nature 2001, 414, 799–806. [Google Scholar] [CrossRef]
- Saxton, R.A.; Sabatini, D.M. mTOR signaling in growth, metabolism, and disease. Cell 2017, 169, 361–371. [Google Scholar] [CrossRef] [PubMed]
- Shimizu, N.; Yoshikawa, N.; Ito, N.; Maruyama, T.; Suzuki, Y.; Takeda, S.; Nakae, J.; Tagata, Y.; Nishitani, S.; Takehana, K.; et al. Crosstalk between glucocorticoid receptor and nutritional sensor mTOR in skeletal muscle. Cell Metab. 2011, 13, 170–182. [Google Scholar] [CrossRef] [PubMed]
- Shuai, X.; Tao, K.; Mori, M.; Kanda, T. Bariatric surgery for metabolic syndrome in obesity. Metab. Syndr. Relat. Disord. 2015, 13, 149–160. [Google Scholar] [CrossRef]
- Stinckens, A.; Luyten, T.; Bijttebier, J.; Van den Maagdenberg, K.; Dieltiens, D.; Janssens, S.; De Smet, S.; Georges, M.; Buys, N. Characterization of the complete porcine MSTN gene and expression levels in pig breeds differing in muscularity. Anim. Genet. 2008, 39, 586–596. [Google Scholar] [CrossRef]
- Strack, A.M.; Sebastian, R.J.; Schwartz, M.W.; Dallman, M.F. Glucocorticoids and insulin: Reciprocal signals for energy balance. Am. J. Physiol. 1995, 268 Pt 2, R142–R149. [Google Scholar] [CrossRef]
- Vegiopoulos, A.; Herzig, S. Glucocorticoids, metabolism and metabolic diseases. Mol. Cell Endocrinol. 2007, 275, 43–61. [Google Scholar] [CrossRef]
- Wan, X.; Wang, D.; Xiong, Q.; Xiang, H.; Li, H.; Wang, H.; Liu, Z.; Niu, H.; Peng, J.; Jiang, S.; et al. Elucidating a molecular mechanism that the deterioration of porcine meat quality responds to increased cortisol based on transcriptome sequencing. Sci. Rep. 2016, 6, 36589. [Google Scholar] [CrossRef]
- Zhang, T.; Wang, F.; Xu, H.X.; Yi, L.; Qin, Y.; Chang, H.; Mi, M.T.; Zhang, Q.Y. Activation of nuclear factor erythroid 2-related factor 2 and PPARgamma plays a role in the genistein-mediated attenuation of oxidative stress-induced endothelial cell injury. Br. J. Nutr. 2013, 109, 223–235. [Google Scholar] [CrossRef]
- Zheng, X.; Bi, W.; Yang, G.; Zhao, J.; Wang, J.; Li, X.; Zhou, X. Hyperglycemia induced by chronic restraint stress in mice is associated with nucleus tractus solitarius injury and not just the direct effect of glucocorticoids. Front. Neurosci. 2018, 12, 983. [Google Scholar] [CrossRef]









| Gene | Sequence of Primer(5′-3′) | Amplicon Size (bp) |
|---|---|---|
| GRα | F:GCTTGCGGTGGACTTTC | 126 |
| R:AGGTCACTTCCCATCACTTTA | ||
| MSTN | F:TACCCTCACACTCATCTTGTGC | 160 |
| R:ACCCACAGCGATCTACTACCA | ||
| Atrogin-1 | F:CAAAGGCTAAGTGATGGCCG | 205 |
| R:GAGGGTAGCATCGCACAAGT | ||
| FOXO1 | F:AATCGAGTTACGGAGGCATGG | 165 |
| R:TAGGGCCCATCAGCACATTC | ||
| SLC2A4 | F:TCTCTGTGGGTGGCATGTTC | 181 |
| R:TAGGCACCAATGAGGAACCG | ||
| FKBP5 | F:GATGGAGTACGGCTTGTCAG | 166 |
| R:CAAGCCCTTCTCATTGGCAC | ||
| FHL3 | F:CTGTGCAAAATGCAGCGAGT | 167 |
| R:GGAAGTGGCGATCCTCGTAA | ||
| USP18 | F:TACCTCACCGTCTGGAACCT | 195 |
| R:CAGGGGCTTTGAGTCCATGT | ||
| IGF1 | F:CTCTCCTTCACCAGCTCTGC | 200 |
| R:TCCAGCCTCCTCAGATCACA | ||
| β-actin | F:CCAGGTCATCACCATCGG | 158 |
| R:CCGTGTTGGCGTAGAGGT |
| Gene | Sequence of Primer(5′-3′) |
|---|---|
| GRα-full length sequence | F: ATGGACCCCAAGGAATCGCTGACCC |
| R: TCACTTTTGATGAAACAGAAGTTTT | |
| SLC2A4- full length sequence | F: GGCTACACCTGTGGCATATG |
| R: CTTGTCTTAGGAGCTGGAGG | |
| SLC2A4-S1-1167bp fragment | F: CGGGGTACCGAGGCCCGTTTTCCCAGCCG |
| R: CCGCTCGAGCTTGTCTTAGGAGCTGGAGG | |
| SLC2A4-S2-827bp fragment | F: CGGGGTACCCTAGGAACGGAATTTCCTGT |
| R: CCGCTCGAGCTTGTCTTAGGAGCTGGAGG | |
| SLC2A4-S3-487bp fragment | F: CGGGGTACCGTGGGCGGAGTCTTCGCACT |
| R: CCGCTCGAGCTTGTCTTAGGAGCTGGAGG | |
| SLC2A4-S4-294bp fragment | F: CGGGGTACCCTTCTGGGGTGTGCGGGCT |
| R: CCGCTCGAGCTTGTCTTAGGAGCTGGAGG | |
| SLC2A4-S3-mut fragment | F: TCGCCCCTACTGACTTCTGCCCGCCAGGCT |
| R: GGGCAGAAGTCAGTAGGGGCGACGGGGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Du, X.-L.; Xu, W.-J.; Shi, J.-L.; Guo, K.; Guo, C.-T.; Zheng, R.; Jiang, S.-W.; Chai, J. Glucocorticoid Receptor Alpha Targets SLC2A4 to Regulate Protein Synthesis and Breakdown in Porcine Skeletal Muscle Cells. Biomolecules 2021, 11, 721. https://doi.org/10.3390/biom11050721
Du X-L, Xu W-J, Shi J-L, Guo K, Guo C-T, Zheng R, Jiang S-W, Chai J. Glucocorticoid Receptor Alpha Targets SLC2A4 to Regulate Protein Synthesis and Breakdown in Porcine Skeletal Muscle Cells. Biomolecules. 2021; 11(5):721. https://doi.org/10.3390/biom11050721
Chicago/Turabian StyleDu, Xiao-Li, Wei-Jing Xu, Jia-Li Shi, Kai Guo, Chang-Tong Guo, Rong Zheng, Si-Wen Jiang, and Jin Chai. 2021. "Glucocorticoid Receptor Alpha Targets SLC2A4 to Regulate Protein Synthesis and Breakdown in Porcine Skeletal Muscle Cells" Biomolecules 11, no. 5: 721. https://doi.org/10.3390/biom11050721
APA StyleDu, X.-L., Xu, W.-J., Shi, J.-L., Guo, K., Guo, C.-T., Zheng, R., Jiang, S.-W., & Chai, J. (2021). Glucocorticoid Receptor Alpha Targets SLC2A4 to Regulate Protein Synthesis and Breakdown in Porcine Skeletal Muscle Cells. Biomolecules, 11(5), 721. https://doi.org/10.3390/biom11050721
