Skin Protective Activity of LactoSporin-the Extracellular Metabolite from Bacillus Coagulans MTCC 5856
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Strains, Media, and Culture Conditions
2.3. Preparation of LactoSporin
2.4. DPPH Free Radical Scavenging Activity
2.5. Cell Viability Assay
2.6. Intracellular Reactive Oxygen Species (ROS) Scavenging Activity
2.7. Protective Effect on UV-Induced Cytotoxicity
2.8. Annexin V Apoptosis Detection Assay
2.9. Anti-Collagenase Assay
2.10. Anti-Elastase Assay
2.11. Anti-Glycation Assay
2.12. Anti-Hyaluronidase Assay
2.13. RNA Extraction and Quantitative RT-PCR
3. Results
3.1. Antioxidant Activity
3.2. UV Protection Effect
3.3. Apoptosis Assay
3.4. Anti-Collagenase Activity
3.5. Anti-Elastase Activity
3.6. Anti-Hyaluronidase Assay
3.7. Anti-Glycation Effect
3.8. Gene Expression Studies
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Patents
References
- Young, V.B. The role of the microbiome in human health and disease: An introduction for clinicians. BMJ 2017, 356, j831. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Paetzold, B.; Willis, J.R.; Pereira de Lima, J.; Knödlseder, N.; Brüggemann, H.; Quist, S.R.; Gabaldón, T.; Güell, M. Skin microbiome modulation induced by probiotic solutions. Microbiome 2019, 7, 95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cogen, A.L.; Nizet, V.; Gallo, R.L. Skin microbiota: A source of disease or defence? Br. J. Dermatol. 2008, 158, 442–455. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gallo, R.L.; Nakatsuji, T. Microbial symbiosis with the innate immune defense system of the skin. J. Investig. Dermatol. 2011, 131, 1974–1980. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Scharschmidt, T.C.; Vasquez, K.S.; Truong, H.-A.; Gearty, S.V.; Pauli, M.L.; Nosbaum, A.; Gratz, I.K.; Otto, M.; Moon, J.J.; Liese, J. A wave of regulatory T cells into neonatal skin mediates tolerance to commensal microbes. Immunity 2015, 43, 1011–1021. [Google Scholar]
- Patra, V.; Gallais Serezal, I.; Wolf, P. Potential of Skin Microbiome, Pro- and/or Pre-Biotics to Affect Local Cutaneous Responses to UV Exposure. Nutrients 2020, 12, 1795. [Google Scholar] [CrossRef] [Scilit]
- Dreno, B.; Araviiskaia, E.; Berardesca, E.; Gontijo, G.; Sanchez Viera, M.; Xiang, L.F.; Martin, R.; Bieber, T. Microbiome in healthy skin, update for dermatologists. J. Eur. Acad. Dermatol. Venereol. 2016, 30, 2038–2047. [Google Scholar] [CrossRef] [Scilit]
- Baviera, G.; Leoni, M.C.; Capra, L.; Cipriani, F.; Longo, G.; Maiello, N.; Ricci, G.; Galli, E. Microbiota in healthy skin and in atopic eczema. Biomed Res. Int. 2014, 2014, 436921. [Google Scholar] [CrossRef] [Scilit]
- Prescott, S.L.; Larcombe, D.L.; Logan, A.C.; West, C.; Burks, W.; Caraballo, L.; Levin, M.; Etten, E.V.; Horwitz, P.; Kozyrskyj, A.; et al. The skin microbiome: Impact of modern environments on skin ecology, barrier integrity, and systemic immune programming. World Allergy Organ. J. 2017, 10, 29. [Google Scholar] [CrossRef] [Scilit]
- Huang, Y.J.; Marsland, B.J.; Bunyavanich, S.; O’Mahony, L.; Leung, D.Y.; Muraro, A.; Fleisher, T.A. The microbiome in allergic disease: Current understanding and future opportunities-2017 PRACTALL document of the American Academy of Allergy, Asthma & Immunology and the European Academy of Allergy and Clinical Immunology. J. Allergy Clin. Immunol. 2017, 139, 1099–1110. [Google Scholar] [CrossRef] [Scilit]
- Floch, M.H. Probiotics and Prebiotics. Gastroenterol. Hepatol. 2014, 10, 680–681. [Google Scholar]
- Lew, L.C.; Liong, M.T. Bioactives from probiotics for dermal health: Functions and benefits. J. Appl. Microbiol. 2013, 114, 1241–1253. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baquerizo Nole, K.L.; Yim, E.; Keri, J.E. Probiotics and prebiotics in dermatology. J. Am. Acad. Dermatol. 2014, 71, 814–821. [Google Scholar] [CrossRef] [Scilit]
- Cicenia, A.; Scirocco, A.; Carabotti, M.; Pallotta, L.; Marignani, M.; Severi, C. Postbiotic activities of lactobacilli-derived factors. J. Clin. Gastroenterol. 2014, 48 (Suppl. 1), S18–S22. [Google Scholar] [CrossRef] [Scilit]
- Zolkiewicz, J.; Marzec, A.; Ruszczynski, M.; Feleszko, W. Postbiotics-A Step Beyond Pre- and Probiotics. Nutrients 2020, 12, 2189. [Google Scholar] [CrossRef] [Scilit]
- Kimoto-Nira, H.; Aoki, R.; Sasaki, K.; Suzuki, C.; Mizumachi, K. Oral intake of heat-killed cells of Lactococcus lactis strain H61 promotes skin health in women. J. Nutr. Sci. 2012, 1, e18. [Google Scholar] [CrossRef] [Scilit]
- Lee, D.E.; Huh, C.S.; Ra, J.; Choi, I.D.; Jeong, J.W.; Kim, S.H.; Ryu, J.H.; Seo, Y.K.; Koh, J.S.; Lee, J.H.; et al. Clinical Evidence of Effects of Lactobacillus plantarum HY7714 on Skin Aging: A Randomized, Double Blind, Placebo-Controlled Study. J. Microbiol. Biotechnol. 2015, 25, 2160–2168. [Google Scholar] [CrossRef] [Scilit]
- Di Marzio, L.; Cinque, B.; Cupelli, F.; De Simone, C.; Cifone, M.G.; Giuliani, M. Increase of skin-ceramide levels in aged subjects following a short-term topical application of bacterial sphingomyelinase from Streptococcus thermophilus. Int. J. Immunopathol. Pharm. 2008, 21, 137–143. [Google Scholar] [CrossRef] [Scilit]
- Kang, B.S.; Seo, J.G.; Lee, G.S.; Kim, J.H.; Kim, S.Y.; Han, Y.W.; Kang, H.; Kim, H.O.; Rhee, J.H.; Chung, M.J.; et al. Antimicrobial activity of enterocins from Enterococcus faecalis SL-5 against Propionibacterium acnes, the causative agent in acne vulgaris, and its therapeutic effect. J. Microbiol. 2009, 47, 101–109. [Google Scholar] [CrossRef] [Scilit]
- Muizzuddin, N.; Maher, W.; Sullivan, M.; Schnittger, S.; Mammone, T. Physiological effect of a probiotic on skin. J. Cosmet. Sci. 2012, 63, 385–395. [Google Scholar]
- Guéniche, A.; Bastien, P.; Ovigne, J.M.; Kermici, M.; Courchay, G.; Chevalier, V.; Breton, L.; Castiel-Higounenc, I. Bifidobacterium longum lysate, a new ingredient for reactive skin. Exp. Dermatol. 2010, 19, e1–e8. [Google Scholar] [CrossRef] [Scilit]
- Iordache, F.; Iordache, C.; Chifiriuc, M.C.; Bleotu, C.; Pavel, M.; Smarandache, D.; Sasarman, E.; Laza, V.; Bucu, M.; Dracea, O.; et al. Antimicrobial and immunomodulatory activity of some probiotic fractions with potential clinical application. Arch. Zootech. 2008, 11, 41–51. [Google Scholar]
- Majeed, M.; Nagabhushanam, K.; Natarajan, S.; Arumugam, S.; Pande, A.; Majeed, S.; Ali, F. A Double-Blind, Placebo-Controlled, Parallel Study Evaluating the Safety of Bacillus coagulans MTCC 5856 in Healthy Individuals. J. Clin. Toxicol. 2016, 6, 283. [Google Scholar] [CrossRef]
- Majeed, M.; Nagabhushanam, K.; Natarajan, S.; Sivakumar, A.; Eshuis-de Ruiter, T.; Booij-Veurink, J.; de Vries, Y.P.; Ali, F. Evaluation of genetic and phenotypic consistency of Bacillus coagulans MTCC 5856: A commercial probiotic strain. World J. Microbiol. Biotechnol. 2016, 32, 60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Majeed, M.; Nagabhushanam, K.; Arumugam, S.; Ali, F. Method of producing partially purified extracellular metabolite products from Bacillus coagulans and biological applications thereof. U.S. Patent No. 9,596,861, 2017. [Google Scholar]
- Majeed, M.; Majeed, S.; Nagabhushanam, K.; Mundkur, L.; Rajalakshmi, H.R.; Shah, K.; Beede, K. Novel Topical Application of a Postbiotic, LactoSporin®, in Mild to Moderate Acne: A Randomized, Comparative Clinical Study to Evaluate its Efficacy, Tolerability and Safety. Cosmetics 2020, 7, 70. [Google Scholar] [CrossRef] [Scilit]
- Herald, T.J.; Gadgil, P.; Tilley, M. High-throughput micro plate assays for screening flavonoid content and DPPH-scavenging activity in sorghum bran and flour. J. Sci Food Agric. 2012, 92, 2326–2331. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mosmann, T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J. Immunol. Methods 1983, 65, 55–63. [Google Scholar] [CrossRef] [Scilit]
- LeBel, C.P.; Ischiropoulos, H.; Bondy, S.C. Evaluation of the probe 2′,7′-dichlorofluorescin as an indicator of reactive oxygen species formation and oxidative stress. Chem. Res. Toxicol. 1992, 5, 227–231. [Google Scholar] [CrossRef] [Scilit]
- Repetto, G.; del Peso, A.; Zurita, J.L. Neutral red uptake assay for the estimation of cell viability/cytotoxicity. Nat. Protoc. 2008, 3, 1125–1131. [Google Scholar] [CrossRef] [Scilit]
- Hirano, H.; Tabuchi, Y.; Kondo, T.; Zhao, Q.L.; Ogawa, R.; Cui, Z.G.; Feril, L.B., Jr.; Kanayama, S. Analysis of gene expression in apoptosis of human lymphoma U937 cells induced by heat shock and the effects of alpha-phenyl N-tert-butylnitrone (PBN) and its derivatives. Apoptosis 2005, 10, 331–340. [Google Scholar] [CrossRef] [Scilit]
- Sero, L.; Sanguinet, L.; Blanchard, P.; Dang, B.T.; Morel, S.; Richomme, P.; Seraphin, D.; Derbre, S. Tuning a 96-well microtiter plate fluorescence-based assay to identify AGE inhibitors in crude plant extracts. Molecules 2013, 18, 14320–14339. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ferreira, A.; Proença, C.; Serralheiro, M.L.M.; Araújo, M.E.M. The in vitro screening for acetylcholinesterase inhibition and antioxidant activity of medicinal plants from Portugal. J. Ethnopharmacol. 2006, 108, 31–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ricciarelli, R.; Maroni, P.; Ozer, N.; Zingg, J.M.; Azzi, A. Age-dependent increase of collagenase expression can be reduced by alpha-tocopherol via protein kinase C inhibition. Free Radic. Biol. Med. 1999, 27, 729–737. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsuji, N.; Moriwaki, S.; Suzuki, Y.; Takema, Y.; Imokawa, G. The role of elastases secreted by fibroblasts in wrinkle formation: Implication through selective inhibition of elastase activity. Photochem. Photobiol. 2001, 74, 283–290. [Google Scholar] [CrossRef] [Scilit]
- Tu, P.T.; Tawata, S. Anti-Oxidant, Anti-Aging, and Anti-Melanogenic Properties of the Essential Oils from Two Varieties of Alpinia zerumbet. Molecules 2015, 20, 16723–16740. [Google Scholar] [CrossRef] [Scilit]
- Papakonstantinou, E.; Roth, M.; Karakiulakis, G. Hyaluronic acid: A key molecule in skin aging. Dermatoendocrinol 2012, 4, 253–258. [Google Scholar] [CrossRef] [Scilit]
- Chaudhuri, J.; Bains, Y.; Guha, S.; Kahn, A.; Hall, D.; Bose, N.; Gugliucci, A.; Kapahi, P. The Role of Advanced Glycation End Products in Aging and Metabolic Diseases: Bridging Association and Causality. Cell Metab. 2018, 28, 337–352. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.H.; Ozanne, S.E.; Hales, C.N. Methods of cellular senescence induction using oxidative stress. Methods Mol. Biol. (Cliftonn. J.) 2007, 371, 179–189. [Google Scholar] [CrossRef] [Scilit]
- Varma, S.R.; Sivaprakasam, T.O.; Mishra, A.; Kumar, L.M.; Prakash, N.S.; Prabhu, S.; Ramakrishnan, S. Protective Effects of Triphala on Dermal Fibroblasts and Human Keratinocytes. PLoS ONE 2016, 11, e0145921. [Google Scholar] [CrossRef] [Scilit]
- Pinu, F.R.; Villas-Boas, S.G. Extracellular Microbial Metabolomics: The State of the Art. Metabolites 2017, 7, 43. [Google Scholar]
- De Marco, S.; Sichetti, M.; Muradyan, D.; Piccioni, M.; Traina, G.; Pagiotti, R.; Pietrella, D. Probiotic Cell-Free Supernatants Exhibited Anti-Inflammatory and Antioxidant Activity on Human Gut Epithelial Cells and Macrophages Stimulated with LPS. Evid. Based Complementary Altern. Med. 2018, 2018, 1756308. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gupta, P.L.; Rajput, M.; Oza, T.; Trivedi, U.; Sanghvi, G. Eminence of Microbial Products in Cosmetic Industry. Nat. Prod. Bioprospect. 2019, 9, 267–278. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, J.; Luo, Y.; Zhu, Z.; Zhou, Y.; Sun, L.; Gao, J.; Sun, J.; Wang, G.; Yao, X.; Li, W. A tryptophan metabolite of the skin microbiota attenuates inflammation in patients with atopic dermatitis through the aryl hydrocarbon receptor. J. Allergy Clin. Immunol. 2019, 143, 2108–2119.e2112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bogdan Allemann, I.; Baumann, L. Antioxidants used in skin care formulations. Ski. Ther. Lett. 2008, 13, 5–9. [Google Scholar]
- Ribeiro, A.S.; Estanqueiro, M.; Oliveira, M.B.; Sousa Lobo, J.M. Main Benefits and Applicability of Plant Extracts in Skin Care Products. Cosmetics 2015, 2, 48–65. [Google Scholar] [CrossRef] [Scilit]
- Poljsak, B.; Dahmane, R. Free radicals and extrinsic skin aging. Dermatol. Res. Pr. 2012, 2012, 135206. [Google Scholar] [CrossRef] [Scilit]
- Sanches Silveira, J.E.; Myaki Pedroso, D.M. UV light and skin aging. Rev. Environ. Health 2014, 29, 243–254. [Google Scholar] [CrossRef] [Scilit]
- Calabrese, E.J.; Bachmann, K.A.; Bailer, A.J.; Bolger, P.M.; Borak, J.; Cai, L.; Cedergreen, N.; Cherian, M.G.; Chiueh, C.C.; Clarkson, T.W.; et al. Biological stress response terminology: Integrating the concepts of adaptive response and preconditioning stress within a hormetic dose-response framework. Toxicol. Appl. Pharmacol. 2007, 222, 122–128. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, I.A.; Mikail, M.A.; Zamakshshari, N.; Abdullah, A.-S.H. Natural anti-aging skincare: Role and potential. Biogerontology 2020, 21, 293–310. [Google Scholar] [CrossRef] [Scilit]
- Jariashvili, K.; Madhan, B.; Brodsky, B.; Kuchava, A.; Namicheishvili, L.; Metreveli, N. UV damage of collagen: Insights from model collagen peptides. Biopolymers 2012, 97, 189–198. [Google Scholar] [CrossRef] [Scilit]
- Pugliese, P.T. Physiology of the Skin II: An Expanded Scientific Guide for the Skin Care Professional; Allured Publishing Corporation: Carol Stream, IL, USA, 2001. [Google Scholar]
- Varani, J.; Spearman, D.; Perone, P.; Fligiel, S.E.; Datta, S.C.; Wang, Z.Q.; Shao, Y.; Kang, S.; Fisher, G.J.; Voorhees, J.J. Inhibition of type I procollagen synthesis by damaged collagen in photoaged skin and by collagenase-degraded collagen in vitro. Am. J. Pathol. 2001, 158, 931–942. [Google Scholar] [CrossRef] [Scilit]
- Shaheda, S.A.; Duraivel, S.; Niharika, R.; Anusha, P.; Qudusiya, S. A review on natural bioactive compounds as potential anti-wrinkle agents. World J. Pharm. Pharm. Sci. 2014, 3, 528–544. [Google Scholar]
- Aldag, C.; Nogueira Teixeira, D.; Leventhal, P.S. Skin rejuvenation using cosmetic products containing growth factors, cytokines, and matrikines: A review of the literature. Clin. Cosmet. Investig. Dermatol. 2016, 9, 411–419. [Google Scholar] [CrossRef] [Scilit]
- Shirzad, M.; Hamedi, J.; Motevaseli, E.; Modarressi, M.H. Anti-elastase and anti-collagenase potential of Lactobacilli exopolysaccharides on human fibroblast. Artif. Cells Nanomed. Biotechnol. 2018, 46, 1051–1061. [Google Scholar] [CrossRef] [Scilit]
- Farage, M.A.; Miller, K.W.; Elsner, P.; Maibach, H.I. Characteristics of the Aging Skin. Adv. Wound Care 2013, 2, 5–10. [Google Scholar] [CrossRef] [Scilit]
- Park, J.I.; Lee, J.E.; Shin, H.J.; Song, S.; Lee, W.K.; Hwang, J.S. Oral Administration of Glycine and Leucine Dipeptides Improves Skin Hydration and Elasticity in UVB-Irradiated Hairless Mice. Biomol. Ther. 2017, 25, 528–534. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Göllner, I.; Voss, W.; von Hehn, U.; Kammerer, S. Ingestion of an Oral Hyaluronan Solution Improves Skin Hydration, Wrinkle Reduction, Elasticity, and Skin Roughness: Results of a Clinical Study. J. Evid. Based Complementary Altern. Med. 2017, 22, 816–823. [Google Scholar] [CrossRef] [Scilit]
- Pavicic, T.; Gauglitz, G.G.; Lersch, P.; Schwach-Abdellaoui, K.; Malle, B.; Korting, H.C.; Farwick, M. Efficacy of cream-based novel formulations of hyaluronic acid of different molecular weights in anti-wrinkle treatment. J. Drugs Dermatol. 2011, 10, 990–1000. [Google Scholar] [PubMed]
- Averbeck, M.; Gebhardt, C.A.; Voigt, S.; Beilharz, S.; Anderegg, U.; Termeer, C.C.; Sleeman, J.P.; Simon, J.C. Differential regulation of hyaluronan metabolism in the epidermal and dermal compartments of human skin by UVB irradiation. J. Investig. Dermatol. 2007, 127, 687–697. [Google Scholar] [CrossRef] [Scilit]




| Name | Primer Details | Primer Sequence |
|---|---|---|
| h has 1 F | Human hyaluronan synthase 1 (HAS1) | TGTGACTCGGACACAAGGTTG |
| h has 1 R | GCCTAAGAAACTGCTGCAA | |
| h TGF-β F | Human transforming growth factor 1 (TGF-β1) | CCCAGCATCTGCAAAGCTC |
| h TGF-β R | GTCAATGTACAGCTGCCGCA | |
| hEGF F | Human Epidermal growth factor (EGF) | CTCAAGGAATCGGCTGGGGA |
| hEGF R | CAGTCAAAGATCCTGGAGCA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Majeed, M.; Majeed, S.; Nagabhushanam, K.; Lawrence, L.; Arumugam, S.; Mundkur, L. Skin Protective Activity of LactoSporin-the Extracellular Metabolite from Bacillus Coagulans MTCC 5856. Cosmetics 2020, 7, 76. https://doi.org/10.3390/cosmetics7040076
Majeed M, Majeed S, Nagabhushanam K, Lawrence L, Arumugam S, Mundkur L. Skin Protective Activity of LactoSporin-the Extracellular Metabolite from Bacillus Coagulans MTCC 5856. Cosmetics. 2020; 7(4):76. https://doi.org/10.3390/cosmetics7040076
Chicago/Turabian StyleMajeed, Muhammed, Shaheen Majeed, Kalyanam Nagabhushanam, Lincy Lawrence, Sivakumar Arumugam, and Lakshmi Mundkur. 2020. "Skin Protective Activity of LactoSporin-the Extracellular Metabolite from Bacillus Coagulans MTCC 5856" Cosmetics 7, no. 4: 76. https://doi.org/10.3390/cosmetics7040076
APA StyleMajeed, M., Majeed, S., Nagabhushanam, K., Lawrence, L., Arumugam, S., & Mundkur, L. (2020). Skin Protective Activity of LactoSporin-the Extracellular Metabolite from Bacillus Coagulans MTCC 5856. Cosmetics, 7(4), 76. https://doi.org/10.3390/cosmetics7040076

