Skin Care Function of Lactoferrin Was Characterized Using Recombinant Human Epidermal Model
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Cell Viability Assay
2.3. Construction of RHE Models and LF Topical Treatment
2.4. Quantitative Real-Time PCR Analysis
2.5. Immunohistofluorescence Assay
2.6. TSLP and IL-1a Using ELISA
2.7. Statistical Analyses
3. Results
3.1. Effect of LF on Cell Viability
3.2. Anti-Inflammatory Effect of LF on Inflammatory Factor Complex-Induced RHE Model
3.3. TEER and qPCR Analysis
3.4. Immunofluorescence Staining on RHE
4. Discussion
5. Conclusions
Author Contributions
Funding
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Van Veen, H.A.; Geerts, M.E.; Van Berkel, P.H.; Nuijens, J.H. The role of N-linked glycosylation in the protection of human and bovine lactoferrin against tryptic proteolysis. Eur. J. Biochem. 2004, 271, 678–684. [Google Scholar] [CrossRef] [PubMed]
- Baggiolini, M.; De Duve, C.; Masson, P.; Heremans, J. Association of lactoferrin with specific granules in rabbit heterophil leukocytes. J. Exp. Med. 1970, 131, 559. [Google Scholar] [CrossRef] [PubMed]
- Baker, E.N.; Baker, H.M. A structural framework for understanding the multifunctional character of lactoferrin. Biochimie 2009, 91, 3–10. [Google Scholar] [CrossRef] [PubMed]
- Moore, S.A.; Anderson, B.F.; Groom, C.R.; Haridas, M.; Baker, E.N. Three-dimensional structure of diferric bovine lactoferrin at 2.8 Å resolution. J. Mol. Biol. 1997, 274, 222–236. [Google Scholar] [CrossRef] [PubMed]
- Masson, P.; Heremans, J.; Prignot, J.; Wauters, G. Immunohistochemical localization and bacteriostatic properties of an iron-binding protein from bronchial mucus. Thorax 1966, 21, 538. [Google Scholar] [CrossRef] [PubMed]
- Mason, D.; Taylor, C. Distribution of transferrin, ferritin, and lactoferrin in human tissues. J. Clin. Pathol. 1978, 31, 316–327. [Google Scholar] [CrossRef] [PubMed]
- Park, J.H.; Park, G.T.; Cho, I.H.; Sim, S.M.; Yang, J.M.; Lee, D.Y. An antimicrobial protein, lactoferrin exists in the sweat: Proteomic analysis of sweat. Exp. Dermatol. 2011, 20, 369–371. [Google Scholar] [CrossRef] [PubMed]
- Steijns, J.M.; Van Hooijdonk, A. Occurrence, structure, biochemical properties and technological characteristics of lactoferrin. Br. J. Nutr. 2000, 84, 11–17. [Google Scholar] [CrossRef]
- Yan, X.; He, H.; Meng, J.; Zhang, C.; Hong, M.; Tang, X. Preparation of lipid aspirin sustained-release pellets by solvent-free extrusion/spheronization and an investigation of their stability. Drug Dev. Ind. Pharm. 2012, 38, 1221–1229. [Google Scholar] [CrossRef]
- Farnaud, S.; Evans, R.W. Lactoferrin—A multifunctional protein with antimicrobial properties. Mol. Immunol. 2003, 40, 395–405. [Google Scholar] [CrossRef]
- Tsuda, H.; Kozu, T.; Iinuma, G.; Ohashi, Y.; Saito, Y.; Saito, D.; Akasu, T.; Alexander, D.B.; Futakuchi, M.; Fukamachi, K. Cancer prevention by bovine lactoferrin: From animal studies to human trial. Biometals 2010, 23, 399–409. [Google Scholar] [CrossRef] [PubMed]
- Yang, N.; Strøm, M.B.; Mekonnen, S.M.; Svendsen, J.S.; Rekdal, Ø. The effects of shortening lactoferrin derived peptides against tumour cells, bacteria and normal human cells. J. Pept. Sci. 2004, 10, 37–46. [Google Scholar] [CrossRef] [PubMed]
- Beljaars, L.; van der Strate, B.W.; Bakker, H.I.; Reker-Smit, C.; Wiegmans, F.C.; Harmsen, M.C.; Molema, G.; Meijer, D.K. Inhibition of cytomegalovirus infection by lactoferrin in vitro and in vivo. Antivir. Res. 2004, 63, 197–208. [Google Scholar] [CrossRef] [PubMed]
- Cornish, J.; Palmano, K.; Callon, K.; Watson, M.; Lin, J.; Valenti, P.; Naot, D.; Grey, A.; Reid, I. Lactoferrin and bone; structure–activity relationships. Biochem. Cell Biol. 2006, 84, 297–302. [Google Scholar] [CrossRef] [PubMed]
- Duran, A.; Kahve, H.I. The use of lactoferrin in food industry. Acad. J. Sci. 2017, 7, 89–94. [Google Scholar]
- Elzoghby, A.O.; Abdelmoneem, M.A.; Hassanin, I.A.; Abd Elwakil, M.M.; Elnaggar, M.A.; Mokhtar, S.; Fang, J.-Y.; Elkhodairy, K.A. Lactoferrin, a multi-functional glycoprotein: Active therapeutic, drug nanocarrier & targeting ligand. Biomaterials 2020, 263, 120355. [Google Scholar]
- Wang, B.; Timilsena, Y.P.; Blanch, E.; Adhikari, B. Lactoferrin: Structure, function, denaturation and digestion. Crit. Rev. Food Sci. Nutr. 2019, 59, 580–596. [Google Scholar] [CrossRef] [PubMed]
- Weller, R.P.J.B.; Hunter, J.A.A.; Savin, J.A.; Dahl, M.V. The Function and Structure of the Skin. In Clinical Dermatology; McGraw-Hill Companies, Inc.: New York, NY, USA, 2008. [Google Scholar]
- Wickett, R.R. Basics of skin structure. J. Cosmet. Sci. 2004, 55, 132–133. [Google Scholar] [PubMed]
- Conneely, O.M. Antiinflammatory activities of lactoferrin. J. Am. Coll. Nutr. 2001, 20, 389S–395S. [Google Scholar] [CrossRef]
- Farid, A.S.; El Shemy, M.A.; Nafie, E.; Hegazy, A.M.; Abdelhiee, E.Y. Anti-inflammatory, anti-oxidant and hepatoprotective effects of lactoferrin in rats. Drug Chem. Toxicol. 2021, 44, 286–293. [Google Scholar] [CrossRef]
- Takayama, Y.; Aoki, R. Roles of lactoferrin on skin wound healing. Biochem. Cell Biol. 2011, 90, 497–503. [Google Scholar] [CrossRef] [PubMed]
- Engelmayer, J.; Blezinger, P.; Varadhachary, A. Talactoferrin stimulates wound healing with modulation of inflammation. J. Surg. Res. 2008, 149, 278–286. [Google Scholar] [CrossRef] [PubMed]
- Ushasree Pattamatta, U.P.; Willcox, M.; Stapleton, F.; Cole, N.; Garrett, Q. Bovine lactoferrin stimulates human corneal epithelial alkali wound healing in vitro. Investig. Ophthalmol. Vis. Sci. 2009, 50, 1636–1643. [Google Scholar] [CrossRef] [PubMed]
- Ponec, M.; Kempenaar, J. Use of human skin recombinants as an in vitro model for testing the irritation potential of cutaneous irritants. Skin Pharmacol. Physiol. 1995, 8, 49–59. [Google Scholar] [CrossRef] [PubMed]
- Jo, S.; Gong, E.-Y.; Yoo, W.; Choi, H.; Jung, D.; Noh, K.H.; Kim, S.; Kim, S.-H.; Lee, H.-K. Anti-Itching and Anti-Inflammatory Effects of Kushenol F via the Inhibition of TSLP Production. Pharmaceuticals 2022, 15, 1347. [Google Scholar] [CrossRef] [PubMed]
- Denda, M.; Fuziwara, S.; Inoue, K.; Denda, S.; Akamatsu, H.; Tomitaka, A.; Matsunaga, K. Immunoreactivity of VR1 on epidermal keratinocyte of human skin. Biochem. Biophys. Res. Commun. 2001, 285, 1250–1252. [Google Scholar] [CrossRef]
- Leyva-Castillo, J.M.; Hener, P.; Jiang, H.; Li, M. TSLP produced by keratinocytes promotes allergen sensitization through skin and thereby triggers atopic march in mice. J. Investig. Dermatol. 2013, 133, 154–163. [Google Scholar] [CrossRef] [PubMed]
- Qiao, W.; Xie, T.; Lu, J.; Jia, T.; Kaku, K. Identification of potential hub genes associated with atopic dermatitis-like recombinant human epidermal model using integrated transcriptomic and proteomic analysis. Biomol. Biomed. 2024, 24, 89–100. [Google Scholar] [CrossRef]
- Jia, T.; Qiao, W.; Yao, Q.; Wu, W.; Kaku, K. Treatment with docosahexaenoic acid improves epidermal keratinocyte differentiation and ameliorates inflammation in human keratinocytes and reconstructed human epidermis models. Molecules 2019, 24, 3156. [Google Scholar] [CrossRef]
- Itoh, A.; Tsujikawa, T.; Fujiyama, Y.; Bamba, T. Enhancement of aquaporin-3 by vasoactive intestinal polypeptide in a human colonic epithelial cell line. J. Gastroenterol. Hepatol. 2003, 18, 203–210. [Google Scholar] [CrossRef]
- Kezic, S.; Kemperman, P.M.; Koster, E.S.; de Jongh, C.M.; Thio, H.B.; Campbell, L.E.; Irvine, A.D.; McLean, W.I.; Puppels, G.J.; Caspers, P.J. Loss-of-function mutations in the filaggrin gene lead to reduced level of natural moisturizing factor in the stratum corneum. J. Investig. Dermatol. Symp. Proc. 2008, 128, 2117–2119. [Google Scholar] [CrossRef] [PubMed]
- Eberlin, S.; Silva, M.S.d.; Facchini, G.; Silva, G.H.d.; Pinheiro, A.L.T.A.; Eberlin, S.; Pinheiro, A.d.S. The ex vivo skin model as an alternative tool for the efficacy and safety evaluation of topical products. Altern. Lab. Anim. 2020, 48, 10–22. [Google Scholar] [CrossRef] [PubMed]
- Uchida, R.; Aoki, R.; Aoki-Yoshida, A.; Tajima, A.; Takayama, Y. Promoting effect of lactoferrin on barrier function and epithelial differentiation of human keratinocytes. Biochem. Cell Biol. 2017, 95, 64–68. [Google Scholar] [CrossRef] [PubMed]
Primer Sequences | Primer Name |
---|---|
GGGGAGATGCTCCACATCC | AQP3-F |
AAAGGCCAGGTTGATGGTGAG | AQP3-R |
TGAAGCCTATGACACCACTGA | FLG-F |
TCCCCTACGCTTTCTTGTCCT | FLG-R |
TCCTCCAGTCAATACCCATCAG | IVL-F |
CAGCAGTCATGTGCTTTTCCT | IVL-R |
CCTCCTGGGAGTGATAGCAAT | CLDN1-F |
GGCAACTAAAATAGCCAGACCT | CLDN1-R |
GAGCCTCTTCGCGTACCTG | HAS1-F |
CCTCCTGGTAGGCGGAGAT | HAS1-R |
GGAGCGAGATCCCTCCAAAAT | GAPDH-F |
GGCTGTTGTCATACTTCTCATGG | GAPDH-R |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xie, T.; Qiao, W.; Jia, T.; Kaku, K. Skin Care Function of Lactoferrin Was Characterized Using Recombinant Human Epidermal Model. Cosmetics 2024, 11, 98. https://doi.org/10.3390/cosmetics11030098
Xie T, Qiao W, Jia T, Kaku K. Skin Care Function of Lactoferrin Was Characterized Using Recombinant Human Epidermal Model. Cosmetics. 2024; 11(3):98. https://doi.org/10.3390/cosmetics11030098
Chicago/Turabian StyleXie, Tong, Wu Qiao, Tinghan Jia, and Ken Kaku. 2024. "Skin Care Function of Lactoferrin Was Characterized Using Recombinant Human Epidermal Model" Cosmetics 11, no. 3: 98. https://doi.org/10.3390/cosmetics11030098
APA StyleXie, T., Qiao, W., Jia, T., & Kaku, K. (2024). Skin Care Function of Lactoferrin Was Characterized Using Recombinant Human Epidermal Model. Cosmetics, 11(3), 98. https://doi.org/10.3390/cosmetics11030098