Germination Enhances Phytochemical Profiles of Perilla Seeds and Promotes Hair Growth via 5α-Reductase Inhibition and Growth Factor Pathways
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Extract Preparation
2.3. Phytochemical Evaluation
2.3.1. Evaluation of Total Phenolic Content
2.3.2. Evaluation of Tocopherol Composition
2.3.3. Evaluation of Antioxidant Activities
ABTS Radical Scavenging Assay
DPPH Radical Scavenging Assay
2.3.4. Evaluation of Fatty Acid Composition
2.4. In Vitro Cell Viability and Proliferation Assay
2.5. Cell Migration Assay
2.6. TBT-Induced Potassium Channel Blockade Model
2.7. Anti-Inflammatory Activity Assay
2.8. Thiobarbituric Acid-Reactive Substances (TBARS) Assay
2.9. Assessment of Gene Expression
2.10. Statistical Analysis
3. Results and Discussion
3.1. Extraction Yield, Phytochemical Profile, and Antioxidant Properties of Perilla Seed Extracts
3.2. Effect of Perilla Seed Extracts on Cell Viability and Proliferation
3.3. Effect of Perilla Seed Extracts on Cell Migration
3.4. Effect of Perilla Seed Extracts on Potassium Ion Channel
3.5. Effect of Perilla Seed Extracts on Anti-Inflammatory Activities
3.6. Effect of Perilla Seed Extracts on Antioxidant Activities
3.7. Effects of Perilla Seed Extracts on Gene Expression Associated with Hair Loss and Hair Growth
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ntshingila, S.; Oputu, O.; Arowolo, A.T.; Khumalo, N.P. Androgenetic alopecia: An update. JAAD Int. 2023, 13, 150–158. [Google Scholar] [CrossRef] [PubMed]
- Muangsanguan, A.; Ruksiriwanich, W.; Linsaenkart, P.; Jantrawut, P.; Rachtanapun, P.; Jantanasakulwong, K.; Sommano, S.R.; Sringarm, K.; Arjin, C.; Sainakham, M. Synergistic phytochemical and pharmacological actions of Hair RiseTM microemulsion: A novel herbal formulation for androgenetic alopecia and hair growth stimulation. Plants 2024, 13, 2802. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Liu, Y.; He, J.; Wang, J.; Chen, X.; Yang, R. Regulation of signaling pathways in hair follicle stem cells. Burn. Trauma 2022, 10, tkac022. [Google Scholar] [CrossRef] [PubMed]
- Abe, Y.; Tanaka, N. Roles of the hedgehog signaling pathway in epidermal and hair follicle development, homeostasis, and cancer. J. Dev. Biol. 2017, 5, 12. [Google Scholar] [CrossRef] [PubMed]
- Yuan, A.; Gu, Y.; Bian, Q.; Wang, R.; Xu, Y.; Ma, X.; Zhou, Y.; Gao, J. Conditioned media-integrated microneedles for hair regeneration through perifollicular angiogenesis. J. Control Release 2022, 350, 204–214. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.; Zhao, P.; Zhang, G.; Su, X.; Li, H.; Gong, H.; Ma, X.; Liu, F. Application of non-pharmacologic therapy in hair Loss treatment and hair regrowth. Clin. Cosmet. Investig. Dermatol. 2024, 17, 1701–1710. [Google Scholar] [CrossRef] [PubMed]
- Al-Khayri, J.M.; Rashmi, R.; Toppo, V.; Chole, P.B.; Banadka, A.; Sudheer, W.N.; Nagella, P.; Shehata, W.F.; Al-Mssallem, M.Q.; Alessa, F.M. Plant secondary metabolites: The weapons for biotic stress management. Metabolites 2023, 13, 716. [Google Scholar] [CrossRef] [PubMed]
- Adam, G.; Robu, S.; Flutur, M.-M.; Cioanca, O.; Vasilache, I.-A.; Adam, A.-M.; Mircea, C.; Nechita, A.; Harabor, V.; Harabor, A. Applications of Perilla frutescens extracts in clinical practice. Antioxidants 2023, 12, 727. [Google Scholar] [CrossRef] [PubMed]
- Kaur, S.; Seem, K.; Ali, A.; Jaiswal, S.; Gumachanamardi, P.; Kaur, G.; Singh, N.; Touthang, L.; Kumar, S.; Bhardwaj, R. A comprehensive review on nutritional, nutraceutical, and industrial perspectives of perilla (Perilla frutscens L.) seeds–An orphan oilseed crop. Heliyon 2024, 10, e33281. [Google Scholar] [CrossRef] [PubMed]
- Korsirikoon, C.; Techaniyom, P.; Kettawan, A.; Rungruang, T.; Metheetrairut, C.; Prombutara, P.; Kettawan, A.K. Cold-pressed extraction of perilla seed oil enriched with alpha-linolenic acid mitigates tumour progression and restores gut microbial homeostasis in the AOM/DSS mice model of colitis-associated colorectal cancer. PLoS ONE 2024, 19, e0315172. [Google Scholar] [CrossRef] [PubMed]
- Muangsanguan, A.; Ruksiriwanich, W.; Arjin, C.; Jamjod, S.; Prom-u-Thai, C.; Jantrawut, P.; Rachtanapun, P.; Hnorkaew, P.; Satsook, A.; Sainakham, M. Comparison of in vitro hair growth promotion and anti-hair loss potential of Thai rice by-product from Oryza sativa L. cv. buebang 3 CMU and sanpatong. Plants 2024, 13, 3079. [Google Scholar] [CrossRef] [PubMed]
- El-Badri, A.M.; Batool, M.; Wang, C.; Hashem, A.M.; Tabl, K.M.; Nishawy, E.; Kuai, J.; Zhou, G.; Wang, B. Selenium and zinc oxide nanoparticles modulate the molecular and morpho-physiological processes during seed germination of Brassica napus under salt stress. Ecotoxicol. Environ. Saf. 2021, 225, 112695. [Google Scholar] [CrossRef] [PubMed]
- Moulick, D.; Ghosh, D.; Santra, S.C. Evaluation of effectiveness of seed priming with selenium in rice during germination under arsenic stress. Plant Physiol. Biochem. 2016, 109, 571–578. [Google Scholar] [CrossRef] [PubMed]
- Piekarska, A.; Kołodziejski, D.; Pilipczuk, T.; Bodnar, M.; Konieczka, P.; Kusznierewicz, B.; Hanschen, F.S.; Schreiner, M.; Cyprys, J.; Groszewska, M. The influence of selenium addition during germination of Brassica seeds on health-promoting potential of sprouts. Int. J. Food Sci. Nutr. 2014, 65, 692–702. [Google Scholar] [CrossRef] [PubMed]
- Ahmad, I.; Younas, Z.; Mashwani, Z.-u.-R.; Raja, N.I.; Akram, A. Phytomediated selenium nanoparticles improved physio-morphological, antioxidant, and oil bioactive compounds of sesame under induced biotic stress. ACS Omega 2023, 8, 3354–3366. [Google Scholar] [CrossRef] [PubMed]
- Leila, M.; Ratiba, D.; Al-Marzouqi, A.-H. Experimental and mathematical modelling data of green process of essential oil extraction: Supercritical CO2 extraction. Mater. Today Proc. 2022, 49, 1023–1029. [Google Scholar] [CrossRef]
- Jirarattanarangsri, W.; Muangrat, R. Comparison of supercritical CO2 and screw press extraction methods for producing oil from Camellia sinensis var. assamica seeds: Physicochemical properties and antioxidant activity. J. Appl. Res. Med. Aromat. Plants 2022, 31, 100413. [Google Scholar]
- Tangjaidee, P.; Xiang, J.; Yin, H.; Wen, X.; Quek, S.Y. Selenium, fibre, and protein enrichment of rice product: Extrusion variables and product properties. Food Qual. Saf. 2019, 3, 40–51. [Google Scholar] [CrossRef]
- Muangrat, R.; Chalermchat, Y.; Siriwoharn, T.; Jirarattanarangsri, W.; Tangjaidee, P.; Pongsirikul, I.; Pannasai, S. Ultrasound and low-pressure supercritical CO2 extraction: A synergistic approach to hemp seed oil extraction. J. Appl. Res. Med. Aromat. Plants 2024, 43, 100595. [Google Scholar] [CrossRef]
- Muangsanguan, A.; Linsaenkart, P.; Chaitep, T.; Sangta, J.; Sommano, S.R.; Sringarm, K.; Arjin, C.; Rachtanapun, P.; Jantanasakulwong, K.; Phimolsiripol, Y. Hair growth promotion and anti-hair loss effects of by-products arabica coffee pulp extracts using supercritical fluid extraction. Foods 2023, 12, 4116. [Google Scholar] [CrossRef] [PubMed]
- Sringarm, K.; Chaiwang, N.; Wattanakul, W.; Mahinchai, P.; Satsook, A.; Norkeaw, R.; Seel-Audom, M.; Moonmanee, T.; Mekchay, S.; Sommano, S.R. Improvement of intramuscular fat in longissimus muscle of finishing Thai crossbred black pigs by perilla cake supplementation in a low-lysine diet. Foods 2022, 11, 907. [Google Scholar] [CrossRef] [PubMed]
- Radzali, S.A.; Markom, M.; Saleh, N.M. Co-solvent selection for supercritical fluid extraction (SFE) of phenolic compounds from Labisia pumila. Molecules 2020, 25, 5859. [Google Scholar] [CrossRef] [PubMed]
- Khantham, C.; Linsaenkart, P.; Chaitep, T.; Jantrawut, P.; Chittasupho, C.; Rachtanapun, P.; Jantanasakulwong, K.; Phimolsiripol, Y.; Sommano, S.R.; Prom-U-Thai, C. Antioxidation, anti-inflammation, and regulation of SRD5A gene expression of Oryza sativa cv. Bue Bang 3 CMU husk and bran extracts as androgenetic alopecia molecular treatment substances. Plants 2022, 11, 330. [Google Scholar] [CrossRef] [PubMed]
- Tangjaidee, P.; Swedlund, P.; Xiang, J.; Yin, H.; Quek, S.Y. Selenium-enriched plant foods: Selenium accumulation, speciation, and health functionality. Front. Nutr. 2023, 9, 962312. [Google Scholar] [CrossRef] [PubMed]
- Jang, Y.; Kim, C.Y. The Role of Vitamin E Isoforms and Metabolites in Cancer Prevention: Mechanistic Insights into Sphingolipid Metabolism Modulation. Nutrients 2024, 16, 4115. [Google Scholar] [CrossRef] [PubMed]
- Vafaei, N.; Rempel, C.B.; Scanlon, M.G.; Jones, P.J.; Eskin, M.N. Application of supercritical fluid extraction (SFE) of tocopherols and carotenoids (hydrophobic antioxidants) compared to non-SFE methods. AppliedChem 2022, 2, 68–92. [Google Scholar] [CrossRef]
- Barouh, N.; Bourlieu-Lacanal, C.; Figueroa-Espinoza, M.C.; Durand, E.; Villeneuve, P. Tocopherols as antioxidants in lipid-based systems: The combination of chemical and physicochemical interactions determines their efficiency. Compr. Rev. Food Sci. Food Saf. 2022, 21, 642–688. [Google Scholar] [CrossRef] [PubMed]
- Butsat, S.; Siriamornpun, S. Antioxidant capacities and phenolic compounds of the husk, bran and endosperm of Thai rice. Food Chem. 2010, 119, 606–613. [Google Scholar] [CrossRef]
- Goufo, P.; Trindade, H. Rice antioxidants: Phenolic acids, flavonoids, anthocyanins, proanthocyanidins, tocopherols, tocotrienols, γ-oryzanol, and phytic acid. Food Sci. Nutr. 2014, 2, 75–104. [Google Scholar] [CrossRef] [PubMed]
- Upton, J.H.; Hannen, R.F.; Bahta, A.W.; Farjo, N.; Farjo, B.; Philpott, M.P. Oxidative stress–associated senescence in dermal papilla cells of men with androgenetic alopecia. J. Investig. Dermatol. 2015, 135, 1244–1252. [Google Scholar] [CrossRef] [PubMed]
- Jung, Y.H.; Chae, C.W.; Choi, G.E.; Shin, H.C.; Lim, J.R.; Chang, H.S.; Park, J.; Cho, J.H.; Park, M.R.; Lee, H.J. Cyanidin 3-O-arabinoside suppresses DHT-induced dermal papilla cell senescence by modulating p38-dependent ER-mitochondria contacts. J. Biomed. Sci. 2022, 29, 17. [Google Scholar] [CrossRef] [PubMed]
- Tantipaiboonwong, P.; Chaiwangyen, W.; Suttajit, M.; Kangwan, N.; Kaowinn, S.; Khanaree, C.; Punfa, W.; Pintha, K. Molecular mechanism of antioxidant and anti-inflammatory effects of omega-3 fatty acids in perilla seed oil and rosmarinic acid rich fraction extracted from perilla seed meal on TNF-α induced A549 lung adenocarcinoma cells. Molecules 2021, 26, 6757. [Google Scholar] [CrossRef] [PubMed]
- Xu, D.; Hao, J.; Wang, Z.; Liang, D.; Wang, J.; Ma, Y.; Zhang, M. Physicochemical properties, fatty acid compositions, bioactive compounds, antioxidant activity and thermal behavior of rice bran oil obtained with aqueous enzymatic extraction. LWT 2021, 149, 111817. [Google Scholar] [CrossRef]
- Khantham, C.; Ruksiriwanich, W.; Sringarm, K.; Prom-U-Thai, C.; Jamjod, S.; Arjin, C.; Muangsanguan, A.; Rachtanapun, P.; Jantanasakulwong, K.; Phimolsiripol, Y. Effects of bioactive composition in Oryza sativa L. cv. KDML105 bran extract on gene expression related to hair cycle in human hair follicle dermal papilla cells. Agronomy 2023, 13, 295. [Google Scholar]
- ISO 10993-5:2009; Biological Evaluation of Medical Devices—Part 5: Tests for In Vitro Cytotoxicity. International Organi-zation for Standardization (ISO): Geneva, Switzerland, 2009.
- Lim, H.W.; Kim, H.J.; Jeon, C.Y.; Lee, Y.; Kim, M.; Kim, J.; Kim, S.R.; Lee, S.; Lim, D.C.; Park, H.D. Hair growth promoting effects of 15-hydroxyprostaglandin dehydrogenase inhibitor in human follicle dermal papilla cells. Int. J. Mol. Sci. 2024, 25, 7485. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Wang, X.; Zhao, M.; Zhang, H.; Liu, C. The chemical and pharmacological research progress on a kind of Chinese herbal medicine, Fructus Malvae. Molecules 2022, 27, 5678. [Google Scholar] [CrossRef] [PubMed]
- Peixoto Pinheiro, B.; Vona, B.; Löwenheim, H.; Rüttiger, L.; Knipper, M.; Adel, Y. Age-related hearing loss pertaining to potassium ion channels in the cochlea and auditory pathway. Pflügers Arch.-Eur. J. Physiol. 2021, 473, 823–840. [Google Scholar] [CrossRef] [PubMed]
- Richter-Laskowska, M.; Trybek, P.; Delfino, D.V.; Wawrzkiewicz-Jałowiecka, A. Flavonoids as modulators of potassium channels. Int. J. Mol. Sci. 2023, 24, 1311. [Google Scholar] [CrossRef] [PubMed]
- Szczuko, M.; Pokorska-Niewiada, K.; Kwiatkowska, L.; Nawrocka-Rutkowska, J.; Szydłowska, I.; Ziętek, M. Level of Potassium is Associated with saturated fatty acids in cell membranes and influences the activation of the 9 and 13 HODE and 5 HETE Synthesis pathways in PCOS. Biomedicines 2022, 10, 2244. [Google Scholar] [CrossRef] [PubMed]
- Yanez, D.A.; Lacher, R.K.; Vidyarthi, A.; Colegio, O.R. The role of macrophages in skin homeostasis. Pflügers Arch.-Eur. J. Physiol. 2017, 469, 455–463. [Google Scholar] [CrossRef] [PubMed]
- Wolf, R.; Schönfelder, G.; Paul, M.; Blume-Peytavi, U. Nitric oxide in the human hair follicle: Constitutive and dihydrotestosterone-induced nitric oxide synthase expression and NO production in dermal papilla cells. J. Mol. Med. 2003, 81, 110–117. [Google Scholar] [CrossRef] [PubMed]
- Sowden, H.; Naseem, K.; Tobin, D. Differential expression of nitric oxide synthases in human scalp epidermal and hair follicle pigmentary units: Implications for regulation of melanogenesis. Br. J. Dermatol. 2005, 153, 301–309. [Google Scholar] [CrossRef] [PubMed]
- Cwynar, A.; Olszewska-Słonina, D.; Czajkowski, R.; Zegarska, B.; Białecka, A.; Męcińska-Jundziłł, K.; Piskorska, E.; Lampka, M. Investigation of oxidative stress in patients with alopecia areata by measuring the levels of malondialdehyde and ceruloplasmin in the blood. Adv. Dermatol. Allergol. 2018, 35, 572–576. [Google Scholar] [CrossRef] [PubMed]
- Kähkönen, M.P.; Heinonen, M. Antioxidant activity of anthocyanins and their aglycons. J. Agric. Food Chem. 2003, 51, 628–633. [Google Scholar] [CrossRef] [PubMed]
- Koonyosying, P.; Kusirisin, W.; Kusirisin, P.; Kasempitakpong, B.; Sermpanich, N.; Tinpovong, B.; Salee, N.; Pattanapanyasat, K.; Srichairatanakool, S.; Paradee, N. Perilla Fruit Oil-Fortified Soybean Milk Intake Alters Levels of Serum Triglycerides and Antioxidant Status, and Influences Phagocytotic Activity among Healthy Subjects: A Randomized Placebo-Controlled Trial. Nutrients 2022, 14, 1721. [Google Scholar] [CrossRef] [PubMed]
- Asif, M. Phytochemical study of polyphenols in Perilla Frutescens as an antioxidant. Avicenna J. Phytomed. 2012, 2, 169. [Google Scholar] [PubMed]
- Du, F.; Li, J.; Zhang, S.; Zeng, X.; Nie, J.; Li, Z. Oxidative stress in hair follicle development and hair growth: Signalling pathways, intervening mechanisms and potential of natural antioxidants. J. Cell. Mol. Med. 2024, 28, e18486. [Google Scholar] [CrossRef] [PubMed]
- Madaan, A.; Verma, R.; Singh, A.T.; Jaggi, M. Review of hair follicle dermal papilla cells as in vitro screening model for hair growth. Int. J. Cosmet. Sci. 2018, 40, 429–450. [Google Scholar] [CrossRef] [PubMed]
- York, K.; Meah, N.; Bhoyrul, B.; Sinclair, R. A review of the treatment of male pattern hair loss. Expert Opin. Pharmacother. 2020, 21, 603–612. [Google Scholar] [CrossRef] [PubMed]
- Lee, C.-Y.; Su, C.-H.; Chiang, C.-Y.; Wu, C.-N.; Kuan, Y.-H. Observation of the expression of vascular endothelial growth factor and the potential effect of promoting hair growth treated with Chinese herbal BeauTop. Evid.-Based Complement. Altern. Med. 2021, 2021, 6667011. [Google Scholar] [CrossRef] [PubMed]








| Modulated Signaling Pathways | Genes | Accession No. | Forward Sequences | Reverse Sequences |
|---|---|---|---|---|
| Androgen pathway | SRD5A1 | NM_001047.4 | AGCCATTGTGCAGTGTATGC | AGCCTCCCCTTGGTATTTTG |
| SRD5A2 | NM_000348.4 | TGAATACCCTGATGGGTGG | CAAGCCACCTTGTGGAATC | |
| SRD5A3 | NM_024592.5 | TCCTTCTTTGCCCAAACATC | TCCTTCTTTGCCCAAACATC | |
| Wnt/β-catenin | CTNNB1 | NM_001330729.2 | CCCACTAATGTCCAGCGTTT | AACCAAGCATTTTCACCAGG |
| Sonic Hedgehog | SHH | NM_000193.4 | AAAAGCTGACCCCTTTAGCC | GCTCCGGTGTTTTCTTCATC |
| SMO | NM_005631.5 | GAAGTGCCCTTGGTTCGGACA | CCGCCAGTCAGCCACGAAT | |
| GLI1 | NM_005269.3 | GCAGGGAGTGCAGCCAATACAG | GAGCGGCGGCTGACAGTATA | |
| Angiogenesis | VEGF | NM_001025366.3 | CTACCTCCACCATGCCAAGT | GCGAGTCTGTGTTTTTGCAG |
| Internal control | GAPDH | NM_001289745.3 | GGAAGGTGAAGGTCGGAGTC | CTCAGCCTTGACGGTGCCATG |
| Results | Perilla Seed Extracts | ||||||
|---|---|---|---|---|---|---|---|
| SFE-NG-PS | SFE-G0-PS | SFE-G80-PS | SC-NG-PS | SC-G0-PS | SC-G80-PS | ||
| Extraction yield (%) | 33.93 ± 0.28 | 40.03 ± 0.39 | 39.56 ± 0.48 | 22.46 ± 0.20 | 25.06 ± 0.14 | 24.04 ± 0.25 | |
| Total phenolic content (mg GAE/g extract) | 8.22 ± 0.73 d | 6.92 ± 1.38 c | 11.31 ± 0.38 e | 1.17 ± 0.39 a | 2.22 ± 0.36 b | 2.64 ± 1.17 b | |
| Caffeic acid (µg/g extract) | 12.80 ± 0.03 a | 12.39 ± 0.03 a | 12.57 ± 0.03 a | ND | ND | 11.98 ± 0.03 a | |
| Tocopherol (mg/g extract) | α-Tocopherol | 0.02 ± 0.00 a | 0.02 ± 0.00 a | 0.02 ± 0.00 a | 0.03 ± 0.00 b | 0.02 ± 0.00 a | 0.02 ± 0.00 a |
| β + γ-Tocopherol | 0.49 ± 0.00 a | 0.56 ± 0.00 e | 0.55 ± 0.05 d | 0.50 ± 0.00 b | 0.53 ± 0.00 c | 0.50 ± 0.01 b | |
| δ-Tocopherol | 0.01 ± 0.00 a | 0.01 ± 0.00 a | 0.01 ± 0.00 a | 0.01 ± 0.00 a | 0.01 ± 0.00 a | 0.01 ± 0.00 a | |
| Antioxidant activities (%) | ABTS | 38.30 ± 0.57 d | 39.11 ± 3.25 e | 42.02 ± 0.48 f | 28.89 ± 1.82 a | 36.20 ± 0.06 c | 35.39 ± 0.86 b |
| DPPH | 45.29 ± 0.72 d | 48.09 ± 0.72 e | 56.11 ± 0.18 f | 32.19 ± 0.90 a | 35.77 ± 1.08 c | 35.75 ± 2.34 b | |
| Classification | Name | SFE-NG-PS | SFE-G0-PS | SFE-G80-PS | SC-NG-PS | SC-G0-PS | SC-G80-PS |
|---|---|---|---|---|---|---|---|
| Saturated Fatty Acids | Pentadecanoic acid | 0.01 | 0.01 | 0.01 | 0.01 | 0.01 | 0.01 |
| Palmitic acid | 6.83 | 7.08 | 7.03 | 6.88 | 6.94 | 6.89 | |
| Heptadecanoic acid | 0.14 | 0.15 | 0.15 | 0.14 | 0.16 | 0.15 | |
| Stearic acid | 2.88 | 3.05 | 3.00 | 2.90 | 2.92 | 2.75 | |
| Arachidic acid | 0.18 | 0.19 | 0.18 | 0.18 | 0.19 | 0.17 | |
| Behenic acid | 0.02 | 0.02 | 0.01 | 0.03 | 0.01 | 0.02 | |
| Heneicosanoic acid | 0.05 | 0.06 | 0.06 | 0.05 | 0.06 | 0.06 | |
| Butyric acid | 0.76 | 0.83 | 1.20 | 0.86 | 0.92 | 1.07 | |
| Myristic acid | 0.02 | 0.02 | 0.02 | 0.02 | 0.02 | 0.02 | |
| Monounsaturated Fatty Acids | Palmitoleic acid | 0.01 | 0.01 | 0.02 | 0.01 | 0.02 | 0.01 |
| Heptadecenoic acid | 0.01 | 0.01 | 0.01 | 0.01 | 0.01 | 0.01 | |
| Oleic acid | 11.75 | 11.76 | 11.75 | 11.74 | 11.82 | 11.73 | |
| Gondoic acid | 0.04 | 0.05 | 0.05 | 0.07 | 0.03 | 0.06 | |
| Erucic acid | 0.03 | 0.00 | 0.00 | 0.01 | 0.01 | 0.01 | |
| Nervonic acid | 0.01 | 0.01 | 0.01 | 0.01 | 0.01 | 0.01 | |
| Polyunsaturated Fatty Acids | Trans-Linoleic acid | 0.07 | 0.07 | 0.07 | 0.06 | 0.08 | 0.07 |
| Linoleic acid | 17.45 | 17.50 | 16.90 | 17.36 | 16.98 | 17.09 | |
| γ-Linolenic acid | 0.21 | 0.21 | 0.21 | 0.21 | 0.22 | 0.22 | |
| α-Linolenic acid | 59.43 | 59.81 | 59.50 | 59.23 | 59.75 | 59.72 | |
| Eicosadienoic acid | 0.01 | 0.11 | 0.14 | 0.02 | 0.11 | 0.28 | |
| Dihomo-γ-linolenic acid | 0.02 | 0.03 | 0.03 | 0.02 | 0.02 | 0.02 | |
| Eicosatrienoic acid | 0.01 | 0.00 | 0.00 | 0.01 | 0.00 | 0.01 | |
| Eicosapentaenoic acid | 0.02 | 0.02 | 0.01 | 0.02 | 0.02 | 0.01 | |
| Docosahexaenoic acid | 0.01 | 0.00 | 0.00 | 0.01 | 0.01 | 0.00 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Muangsanguan, A.; Ruksiriwanich, W.; Linsaenkart, P.; Tangjaidee, P.; Sringarm, K.; Arjin, C.; Rachtanapun, P.; Sommano, S.R.; Chaisu, K.; Satsook, A.; et al. Germination Enhances Phytochemical Profiles of Perilla Seeds and Promotes Hair Growth via 5α-Reductase Inhibition and Growth Factor Pathways. Biology 2025, 14, 889. https://doi.org/10.3390/biology14070889
Muangsanguan A, Ruksiriwanich W, Linsaenkart P, Tangjaidee P, Sringarm K, Arjin C, Rachtanapun P, Sommano SR, Chaisu K, Satsook A, et al. Germination Enhances Phytochemical Profiles of Perilla Seeds and Promotes Hair Growth via 5α-Reductase Inhibition and Growth Factor Pathways. Biology. 2025; 14(7):889. https://doi.org/10.3390/biology14070889
Chicago/Turabian StyleMuangsanguan, Anurak, Warintorn Ruksiriwanich, Pichchapa Linsaenkart, Pipat Tangjaidee, Korawan Sringarm, Chaiwat Arjin, Pornchai Rachtanapun, Sarana Rose Sommano, Korawit Chaisu, Apinya Satsook, and et al. 2025. "Germination Enhances Phytochemical Profiles of Perilla Seeds and Promotes Hair Growth via 5α-Reductase Inhibition and Growth Factor Pathways" Biology 14, no. 7: 889. https://doi.org/10.3390/biology14070889
APA StyleMuangsanguan, A., Ruksiriwanich, W., Linsaenkart, P., Tangjaidee, P., Sringarm, K., Arjin, C., Rachtanapun, P., Sommano, S. R., Chaisu, K., Satsook, A., & Castagnini, J. M. (2025). Germination Enhances Phytochemical Profiles of Perilla Seeds and Promotes Hair Growth via 5α-Reductase Inhibition and Growth Factor Pathways. Biology, 14(7), 889. https://doi.org/10.3390/biology14070889

